M8L U.S. Department of Commerce Seattle, Washington Volume 93 Number 1 January 1995 Fishery Bulletin Contents *Jfc'&**j*. Cceanr 15 Companion articles JAN 9 1995 Woods Hci; Barlow, Jay The abundance of cetaceans in California waters. Part I: Ship surveys in summer and fall of 1991 Forney, Karin A., Jay Barlow, and James V. Carretta The abundance of cetaceans in California waters. Part II: Aerial surveys in winter and spring of 1991 and 1992 The National Marine Fisheries Service (NMFS) does not approve, recommend, or endorse any proprietary product or proprietary material mentioned in this publication. No reference shall be made to NMFS, or to this publication fur- nished by NMFS, in any advertising or sales promotion which would indicate or imply that NMFS approves, recom- mends, or endorses any proprietary product or pro-prietary material men- tioned here-in, or which has as its pur- pose an intent to cause directly or indirectly the advertised product to be used or purchased because of this NMFS publication. Articles 27 Bruce, Barry D. Larval development of King George whiting, Sillaginodes punctata, school whiting, Sillago bassensis, and yellow fin whiting, Sillago schomburgkii (Percoidei: Sillaginidae), from South Australian waters 44 Carls, Mark G., and Charles E. O'Clair Responses of Tanner crabs, Chionoecetes bairdi, exposed to cold air 57 Cortes, Enric Demographic analysis of the Atlantic sharpnose shark, Rhizoprionodon terraenovae. in the Gulf of Mexico 67 Ellis, Denise M., and Edward E. DeMartini Evaluation of a video camera technique for indexing abundances of juvenile pink snapper, Pristipomoides filamentosus. and other Hawaiian insular shelf fishes 78 Finnerty, John R., and Barbara A. Block Evolution of cytochrome b in the Scombroidei (Teleostei): molecular insights into billfish (Istiophoridae and Xiphiidae) relationships Fishery Bulletin 93 1 1), 1995 97 Kornfield, Irv, Austin B. Williams, and Robert S. Steneck Assignment of Homarus capensis (Herbst, 1 792), the Cape lobster of South Africa, to the new genus Homarinus (Decapoda: Nephropidae) 1 03 Milton, David A., Steven A. Short, Michael F. O'Neill, and Stephen J. M. Blaber Ageing of three species of tropical snapper (Lutjanidae) from the Gulf of Carpentaria, Australia, using radiometry and otolith ring counts 1 16 Natanson, Lisa J., John G. Casey, and Nancy E. Kohler Age and growth estimates for the dusky shark, Carcharhinus obscurus, in the western North Atlantic Ocean 1 27 Rickey, Martha H. Maturity, spawning, and seasonal movement of arrowtooth flounder, Atheresthes stomias, off Washington 1 39 Schmid, Jeffrey R. Marine turtle populations on the east-centrai coast of Florida: results of tagging studies at Cape Canaveral, Florida, 1986-1991 Notes 1 52 Benetti, Daniel D., Edwin S. Iversen, and Anthony C. Ostrowski Growth rates of captive dolphin, Coryphaena hippurus, in Hawaii 1 58 Canino, Michael F, and Elaine M. Caldarone Modification and comparison of two fluorometric techniques for determining nucleic acid contents of fish larvae 1 66 Laidig, Thomas E., and Stephen Ralston The potential use of otolith characters in identifying larval rockfish (5eo<3sfe5 spp.) 1 72 Matsuura, Yasunobu, and Roger Hewitt Changes in the spatial patchiness of Pacific mackerel. Scomber japonicus, larvae with increasing age and size 1 79 Riley, Cecilia M., G. Joan Holt, and Connie R. Arnold Growth and morphology of larval and juvenile captive bred yellowtail snapper, Ocyurus chrysurus 1 86 Secor, David H., T. Mark Trice, and Harry T. Hornick Validation of otolith-based ageing and a comparison of otolith and scale-based ageing in mark-recaptured Chesapeake Bay striped bass, Morone saxatilis 191 Szedlmayer, Stephen T, and Jeffrey C. Howe An evaluation of six marking methods for age-0 red drum, Sciaenops ocellatus 1 96 Wiley, David N., Regina A. Asmutis, Thomas D. Pitchford, and Damon P. Gannon Stranding and mortality of humpback whales, Megaptera novaeangliae, in the mid-Atlantic and southeast United States, 1 985-1 992 207 Awards Abstract. — A ship survey was conducted in summer and fall of 1991 to estimate the abundance of cetaceans in California waters be- tween the coast and approximately 555 km (300 nmi) offshore. Line- transect methods were used from a 53-m research vessel. Approxi- mately 10,100 km were searched, and 515 groups of cetaceans were seen. The estimated abundances and coefficients of variation (in pa- rentheses) of the most common small cetaceans are the following: 226,000 (0.28) short-beaked com- mon dolphins, Delphinus delphis; 78,400 (0.35) Dall's porpoises, Pho- coenoides dalli; 19,000 (0.41) striped dolphins, Stenella coeruleo- alba; 12,300 (0.54) Pacific white- sided dolphins, Lagenorhynchus obliquidens; 9,470 (0.68) long- beaked common dolphins, Delphinus capensis; and 9,340 (0.57) northern right whale dolphins, Lissodelphis borealis. The estimated abun- dances (and CV's) of the most com- mon large cetaceans are 2,250 (0.38) blue whales, Balaenoptera musculus; 935 (0.63) fin whales, Balaenoptera physalus; 756 (0.49) sperm whales, Physeter macrocephalus; and 626 (0.41) humpback whales, Megap- tera novaeangliae. Estimates are also made for other species and for higher-level taxa that could not be identified to species. The abundance of cetaceans in California waters. Part I: Ship surveys in summer and fall of 1991 Jay Barlow Southwest Fisheries Science Center National Marine Fisheries Service. NOAA RO. Box 271. La Jolla. California 92038 Manuscript accepted 31 May 1994. Fishery Bulletin 93:1-14 ( 1995). The abundance of cetaceans in Cali- fornia waters is poorly known for the majority of species found there. For small cetaceans, quantitative estimates of abundance with statis- tical confidence limits are available only for common dolphins, Delphi- nus delphis (Dohl et al., 1986) and for harbor porpoise, Phocoena phocoena (Barlow, 1988). For large cetaceans, such estimates are avail- able for gray whales, Eschrichtius robustus (Reilly, 1984; Buckland et al., 1993a); humpback whales, Meg- aptera nov aeangliae (Calambokidis et al., 1990a, 1993 1 ), and blue whales, Balaenoptera musculus. 1 Estimates have been made for some of the other species (Dohl et al. 2,3 ), but these estimates are more than 10 years old, and most lack informa- tion on statistical precision. Many, and perhaps all, cetaceans in California waters are vulnerable to entanglement and death in gillnet fisheries. A program is now in place to estimate the incidental mortality of cetaceans in the Cali- fornia gillnet fisheries (Lennert et al., in press). It is difficult, however, to assess the impact of gillnet mor- tality on cetacean populations with- out knowing population sizes. Co- ordinated ship and aerial surveys were initiated recently to estimate the abundance of all cetacean spe- cies in the region of California gillnet fisheries. To evaluate the ef- fect of seasonality on cetacean abun- dance, surveys were designed to cover both cold-water months (Feb- Apr) and warm-water months ( Jul- Nov). A ship survey was conducted during the warm-water period of 1991; an aerial survey was conducted during the cold-water periods of both 1991 and 1992. Results from the ship survey are reported here; population estimates from the aerial surveys are reported in a companion paper (Forney et al., this issue). Field methods A line-transect survey was con- ducted from 28 July to 5 November 1991 with the 53-m National Ocean- ographic and Atmospheric Admin- 1 Calambokidis, J., G. H. Steiger, and J. R. Evenson. 1993. Photographic identification and abundance estimates of humpback and blue whales off California in 1991-92. Final Contract Rep. 50ABNF100137, sub- mitted to the Southwest Fish. Sci. Cent., P.O. Box 271, La Jolla, CA 92038, 40 p. 2 Dohl, T. P., K. S. Norris, R. C. Guess, J. D. Bryant, and M. W. Honig. 1978. Cetacea of the Southern California Bight. Part II of Summary of marine mammals and sea- bird surveys of the Southern California Bight area, 1975-78. Final Rep. to the Bu- reau of Land Management, 414 p. [NTIS Rep. No. PB81248189.] 3 Dohl, T. P., R. C. Guess, M. L. Duman, and R. C. Helm. 1983. Cetaceans of central and northern California, 1980-83: status, abundance, and distribution. Final report to the Minerals Management Serv., Con- tract No. 14-12-0001-29090, 284 p. 1 Fishery Bulletin 93(1). 1995 istration (NOAA) vessel McArthur to assess the abun- dance of cetaceans in California waters. Primary cruise tracks were drawn for a unifirm survey of the 814,900 km 2 area between the 18-m (10-fathom) isobath and approximately 555 km (300 nmi) offshore (Fig. 1). Primary observation team The basic survey method was that which was devel- oped and used to estimate the abundance of small cetaceans in the eastern tropical Pacific (Holt and Powers, 1982; Holt, 1987; Holt and Sexton, 1989; Wade and Gerrodette, 1993). The primary observa- tion team consisted of three observers who searched from a viewing height of 10 m above the sea surface: two observers searched with 25x pedestal-mounted binoculars; the third observer searched with unaided eye, and (occasionally) 7x binoculars, and also served as data recorder. Observers rotated among these three duty stations every 1/2 hour, and two observer teams alternated work and rest periods every two hours. Sighting effort was maintained from dawn to dusk whenever weather conditions allowed, and searching covered the entire region from directly in front of the vessel to 90 degrees left and right and Figure 1 Transect lines (thin solid lines) completed during the survey. The bold polygon indicates the limit of the main study area. out to the horizon. Data were recorded on a lap-top computer that had direct input from the ship's GPS (Global Positioning System) navigation system. Re- corded data included sighting conditions (sea state, cloud cover, sun position, etc.), observer positions, the beginning and end of effort, and information per- taining to sightings. When a sighting was made, all observers were made aware of the animals' location. The perpendicu- lar distance from the trackline to the center of the group was estimated from the initial bearing and distance. The initial bearing of a cue (a blow, a splash, or a sighting of animals) was measured relative to the bow of the vessel by means of a calibrated collar on the base of the yoke of the 25x binoculars. The initial distance was typically estimated from a cali- brated reticle scale in the oculars of both the 25x and 7x binoculars with the formula derived by Smith ( 1982) and was calibrated by using radar-measured distances to inanimate objects (Barlow and Lee, 1994). If a shore horizon was closer than 11.1 km (6 nmi), distance was estimated by comparison with the radar-measured distance to shore. Occasionally, for very close animals seen only by the third observer, sighting distances and angles were estimated by eye. If a cue turned out to be a cetacean, effort was inter- rupted and the ship was typically diverted towards the animals in order to obtain esti- mates of species composition and group size. The vessel was not typically diverted for ce- taceans that were greater than 5.55 km (3 nmi) perpendicular distance from the trackline. Species identification was made collec- tively by the team, but quantitative estimates of species composition and group size were made independently by each observer. For estimation purposes, a group was defined as a collection of closely associated individuals (typically within several body lengths of each other) that exhibited cohesive behavior. In the field, however, a single distant sighting might prove to be two behaviorally distinct groups upon closer inspection. In such cases, when it was impossible to determine which was the original group sighted, both groups were pooled to estimate group size and spe- cies composition. For mixed-species groups, species composition was recorded as an observer's estimate of the percentage of each species present in the group. The observers recorded species composition and group-size data in confidential personal notebooks, and the data were transcribed at the end of the day into the computer data record by the cruise leader. Barlow. Abundance of cetaceans in California waters: ship surveys Species identification Observers attempted to classify all the species present in a group to the lowest possible taxonomic level (one member of each team was a cetacean iden- tification expert with at least nine months of at-sea survey experience on prior marine mammal surveys). Several higher taxonomic groups were used in cases where species identification was not possible. These higher groups were beaked whales of the genus Mesoplodon; unidentified sei or Bryde's whales; uni- dentified beaked whales (including members of the genera Mesoplodon and Ziphius); unidentified large whales (including members of the species group "large whale" in Table 1 as well as the genera Esch- richtius and Eubalaena); unidentified baleen whales (including members of the genera Balaenoptera, Megaptera, Eschrichtius, and Eubalaena); unidenti- fied small whales (including members of the species groups "small whales" and "large delphinids" in Table 1 ); unidentified delphinoids (including members of the species groups "small delphinids," 'large delphinids," and "cryptic species" in Table 1); and unidentified cetaceans (which could include any of the species listed above or in Table 1). The number of sightings identi- fied to these higher taxonomic levels is relatively small, and these animals were not included in the abundance estimates for individual species. Conditionally independent observer In addition to the primary observation team, a fourth observer was on duty 81% of the time and looked for cetaceans that were missed by the primary team. This conditionally independent observer was sta- tioned immediately next to the other observers, searched with 7x binoculars and unaided eyes, and did not reveal the presence of cetaceans until after they were clearly missed by the primary observation team (i.e. after they had passed abeam of the vessel or were bow-riding). Nine different people served as independent observers during the survey, and all worked irregular schedules that overlapped with both primary teams. Independent observers did not work more than two consecutive hours. When a sighting was made by the independent observer, that person maintained their normal behavior so as to avoid drawing the attention of the primary observer team. Initial bearing and distance were estimated by eye or with the aid of reticles in the ocular of 7x binocu- lars and a hand-held protractor. After a group was clearly missed by the primary team, the independent observer announced the presence of the animals to the data recorder and gave the initial bearing and distance. Typically the vessel was diverted towards the group, and species composition and group size were estimated by the primary observation team. Analytical methods Cetacean abundance was estimated from survey data with line-transect methods (Buckland et al., Table 1 Number of groups of cetaceans which contained members of the indicated species and species groups. The sum of all species in a group may be greater than the total for that group because the latter contains mixed-species groups. Totals do not include off-effort sightings. Species group and No. of species sightings Small delphinids 285 short-beaked common dolphin, Delphi nus delphis 123 long-beaked common dolphin, Delphinus capensis 6 unclassified common dolphin, Delphinus spp. 8 striped dolphin, Stenella coeruleoalba 24 Pacific white-sided dolphin, Lagenorhynchus obliquidens 12 northern right whale dolphin, Lissodelphis borealis 16 unidentified delphinoid 21 Cryptic species 132 harbor porpoise, Phocoena phoeoena 32 Dall's porpoise, Phocoenoides dalli 97 pygmy sperm whale, Kogia breviceps 3 Large delphinids 37 bottlenose dolphin, Tursiops truncatus 16 Risso's dolphin, Grampus griseus 29 killer whale, Orcinus orca 5 Large whales 127 sperm whale, Physeter macrocephalus 13 Baird's beaked whale, Berardius bairdii 1 Bryde's whale, Balaenoptera edeni 1 Bryde's or sei whale, Balaenoptera edeni or B. borealis 2 fin whale, Balaenoptera physalus 22 blue whale, Balaenoptera musculus 49 humpback whale, Megaptera novaeangliae 13 unidentified baleen whale 9 unidentified large whale 22 Small whales 48 unidentified beaked whale 7 mesoplodont beaked whale {Mesoplodon spp.) 5 Cuvier's beaked whale, Ziphius cavirostris 14 minke whale, Balaenoptera acutorostrata 4 unidentified small whale 11 unidentified cetacean 8 Fishery Bulletin 93(1). 1995 1993b). The basic equation for estimating abundance, N, for grouped animals with line transect is given by N- AnSf(O) 2Lg(0) (1) where A = size of the study area; n = number of sightings; S = mean group size; fiO) = sighting probability density at zero per- pendicular distance; L = length of transect line completed; and g(0) = probability of seeing a group directly on the trackline. Ideally, S, /10), and g(0) would be estimated sepa- rately for each species. However, the presence of mixed-species groups and small sample sizes required pooling for the estimation of/10) andg(O). The param- eter /(0) was estimated with the Hazard rate model (Buckland, 1985). This model was fitted by maximum likelihood with ungrouped perpendicular distances. Perpendicular distances were estimated from bearing and radial distance estimates made by observers. Pooling and stratification for estimating f (0) Pooled /T0)'s were estimated for five species groups: "small delphinids," "large delphinids," "small whales," "large whales," and "cryptic species." The five species groups were defined to include all of the species seen on the survey (Table 1) and were based on patterns of species cooccurrence in groups and on similarities in the physical and behavioral attributes that affect sightability from a ship. As an example, bottlenose dolphins, Tursiops truncatus, were never seen in a single-species group but were seen with Risso's dolphins, Grampus griseus, 13 times, with striped dolphins, Stenella coeruleoalba, one time, and with sperm whales, Physeter macrocephalus , three times. Bottlenose dolphins were pooled together with Risso's dolphins because they were seen most fre- quently with that species and because their sighting characteristics are more similar to Risso's dolphins (medium body size, prominent dorsal fin, occasional low puffy blow, small to medium group size) than to the other two species with which they were seen. Because killer whales, Orcinus orca, were never seen with other species but share the same sighting char- acteristics, these were also included in the species group "large delphinids." The other four groups are "small delphinids" which are of small body size (2-3 m) and are found in medium to large groups; "small whales" which are of medium body size (4-10 m), typically show no blow, often surface inconspicuously, and are typically found in small groups; "large whales" which are of large body size (10-30 m), al- most always show a conspicuous blow, and are found in small to medium groups; and "cryptic species" which are small (1.5—4.0 m), show no blow, typically surface inconspicuously, and are found in small groups. The assignment of higher-than-species taxa to species groups is given in Table 1. In estimating /10) for each species group, I explored stratification by two factors that are likely to affect sightability: sea state and group size. To avoid esti- mating more parameters than are justified by the data, I chose the most parsimonious stratification model by minimizing Akaike's Information Criterion (AIC) (Akaike, 1973), defined as 2 multiplied by the number of parameters used to estimate f\ 0) minus 2 multiplied by the sum of the log-likelihoods of the fitted values of/tO). Sea state was subjectively strati- fied into calm (Beaufort 0-2) and rough ( Beaufort 3- 5), based on the obvious degradation in sighting con- ditions that occurs with the presence of whitecaps at Beaufort 3. I stratified by group size by first finding the group size that divided the data into two samples with approximately the same number of sightings in each. If this stratification resulted in a lower AIC, I explored further stratification into three samples of approximately equal size. The above approach to stratification resulted in different strata for each species group. For small delphinids, AIC was minimized by stratifying group size into the categories 1-20, 21-100, and >100. For large delphinids, optimal stratification was with group size categories of 1-20 and >20. For large whales, AIC was minimized by using group size strata of 1-3 and >3. Because "cryptic species" and "small whales" were seldom seen in rough conditions, I estimated abundance for these species by using only data from calm conditions and did not explore strati- fication by sea state. Group size stratification re- sulted in higher AIC values for "cryptic species" and "small whales," so these groups were not stratified by group size. Sea-state stratification was not cho- sen on the basis of AIC values for any species group. In stratification by group size, estimates of den- sity in the various strata are added together to give an overall density. The equation for estimating abun- dance of each species k is therefore given by N t 1 7 = 1 An hk S hk f hk (0) 2Lg jk (0) (2) where A = size of study area; Barlow. Abundance of cetaceans in California waters: ship surveys l j,k J j-k = number of sightings of species k in group size stratum,/'; = mean group size of species k in group size stratum j; f k (0) - sighting probability density at zero per- pendicular distance for group size stra- tum./ of the species group to which spe- cies k belongs; L = length of transect line completed; and g k (0) = probability of detecting a group directly on the trackline for group size stratum j of the species group to which species k belongs. Perpendicular distance truncation Sightings of distant groups add little to the estima- tion of trackline density and can introduce bias. Buckland et al. (1993b) recommend truncating to eliminate at least the most distant 5% of all sightings. In the current study, groups of cetaceans were typi- cally not pursued for species identification and group size estimation if they were farther than 5.5 km (3 nmi) from the trackline. Therefore, by survey design, perpendicular distances must be truncated at no more than 5.5 km. I used a truncation distance of 3.7 km (2 nmi) for "small delphinids," "cryptic spe- cies," "large delphinids," and "small whales," which eliminated 8.8%, 2.4%, 4.6%, and 12.8% of all groups (respectively). A truncation distance of 5.5 km was used for "large whales," which eliminated 10.9% of groups. Group-size estimation The estimation of group size for cetaceans is diffi- cult and can lead to bias in the estimation of abun- dance. To avoid bias, correction factors were devel- oped for individual observers. The estimates of four of the six primary observers on the present survey had been previously calibrated by means of aerial photographic estimates to represent "true" group size. 4 The "best" estimates of two of these four were found to indicate group size with accuracy and did not require any correction factors. The other two re- quired correction factors, and, for one, correction fac- tors varied significantly from one year to the next. A helicopter was not available to make aerial photo- graphic estimates of group size on the present sur- vey, so correction factors for individual observers were estimated indirectly by comparison with the two 4 Gerrodette, T. D., and C. Perrin. 1991. Calibration of shipboard estimates of dolphin school size from aerial photographs. Admin. Rep. LJ-91-36, available from Southwest Fish. Sci. Cent., P.O. 271, La Jolla, CA 92038. 73 p. observers who, in the previous study, did not require correction. Linear regression was used to compare one obser- ver's estimates of group size to another's for the sub- set of groups that were estimated by both. Group sizes were log 10 -transformed to normalize variances. For the two observers who did not require a correction factor in the previous study, 4 the slope of the regres- sion was 1.009 (SE=0.017), indicating that, relative to each other, the observers were still estimating group size consistently. Correction factors for the other four observers were based on the slope and in- tercept of the regression of their "best" estimates against the mean of "best" estimates of the two who did not need calibration. The group size for each species in a group was es- timated as the average of all observers' corrected estimates of the size of the group multiplied by the average of all observers' estimates of the percentage of that species present (if in a mixed-species group). Probability of detecting trackline groups Estimating the probability that a group on the transect line will be seen, g(0), is fraught with diffi- culties (see Buckland et al. [1993b] for a review of previous attempts). In the context of bias from missed groups of marine mammals, it is useful to think in terms of the dichotomy proposed by Marsh and Sinclair ( 1989): bias can result from groups that were available to be seen but were not (perception bias) and from groups that were not available to be seen either because they did not surface or because they surfaced behind a swell (availability bias). I will make a minimum estimate of perception bias based on data collected by the conditionally independent observer and on the approach given in the Appendix. Because the sample of sightings made by independent observ- ers is small (only 37 cetacean groups), f 2 (0) in Equa- tion 7 was estimated for all cetaceans pooled with- out stratification by group size or sea state. Perpen- dicular distance data were fitted with the Hazard rate model to estimate f 2 (0). (Groups are only avail- able to the independent observer if they were missed by the other observers; therefore the distribution of perpendicular distances need not be monotonically decreasing. In this case, however, it was, and a more general model is not likely to have performed better than the Hazard rate model.) The analytical vari- ances of /"j(O) and f 2 (0) (from the information matrix method) were used in estimating the coefficient of variation ofg^O) from Equation 8, and the variances of n 1 and n 2 were estimated by assuming a Poisson distribution. Consideration of availability bias is deferred to the Discussion section. Fishery Bulletin 93(1), 1995 Coefficients of variation and confidence intervals Coefficients of variation (CV) and confidence inter- vals (CI) of the abundance estimates are based on the bootstrap method (Efron, 1977; Buckland et al., 1993b). The sightings associated with consecutive segments of search effort were combined to form a set of subsamples of 139 km (75 nmi) of search effort (corresponding to approximately one day of survey effort). 5 I drew subsamples randomly with replace- ment from this set of effort segments, and a pseudo- population size was estimated by using the same group size stratification as was used for the actual abundance estimates. For each bootstrap sample, the probability of detecting trackline groups, g(0), was estimated as a random number between and 1 drawn from the probability distribution of a bino- mial ratio with a mean and coefficient of variation equal to the estimated values. This process was re- peated 1,000 times, and the CV of the estimated population size was calculated as the standard error of the 1,000 pseudo-population sizes divided by the estimated population size. Bootstrap 95% confidence intervals on the population estimates were based on the 25th and 976th ranked estimates from the boot- strap samples. Log-normal 95% confidence intervals were based on the method given by Buckland et al. (1993b) and used the bootstrap estimate of CV. Results During the survey approximately 10,100 km of searching effort were completed (Fig. 1), and 515 cetacean groups were seen during the sampling ef- fort. Tracklines included 2,386 km in calm sea states (Beaufort 2 or less) and 7,696 km in rough sea states (Beaufort 3-5). During the survey, 18 cetacean spe- cies were identified (as well as at least one species that could only be identified to genus) (Table 1 ). More detailed data summaries for this survey are pre- sented by Hill and Barlow (1992), including the po- sitions and school sizes of all on- and off-effort sightings of cetaceans and pinnipeds, maps showing the distribution of sightings for each species, distri- butions of perpendicular distances for each species, patterns of association in mixed-species groups, sum- maries of searching effort completed under various conditions, and sighting rates of individual observ- ers. The fit of the probability density functions to 5 Barlow, J. 1993. The abundance of cetaceans in California wa- ters estimated from ship surveys in summer/fall 1991. Admin. Rep. LJ-93-09, available from Southwest Fish. Sci. Cent., P.O. Box 271, La Jolla, CA 92038, 39 p. the distributions of perpendicular distances are il- lustrated by Barlow. 5 Group-size estimation Group-size correction parameters, the slopes and intercepts (in parentheses) of log 10 -transformed re- gressions, were 0.922 (0.03), 1.022 (-0.03), 0.886 (0.07), and 0.777 (0.11) for the four observers who required correction. Three of these observers appear to have underestimated group size, in some cases by a large amount (a group of 500 would have been, on average, estimated as 328, 534, 283, and 152 by these four observers, respectively). Probability of detecting trackline groups Independent observers searched a total of 8,190 km. Approximately 7% of groups were detected only by the independent observer; however, all groups that were detected only by the independent observer were groups of less than 20 individuals and accounted for only 0.7% of the individuals that were seen on the survey. Of all groups that had less than 20 animals and were seen while the independent observer was on duty, 347 were seen by the primary observers, and 40 were seen by the independent observer. Abundance estimation With estimated values of/(0) and ^(0) (Table 2), den- sity and abundance were calculated for 19 cetacean species and 9 higher taxonomic categories (Table 3). Common dolphins were the most abundant cetaceans by a large margin. Of the two recently recognized common dolphin species (Heyning and Pen-in, 1994), the short-beaked variety was much more abundant than the long-beaked variety. Blue whales were the most abundant species of large whale. Discussion Distribution The distributions of cetaceans seen during this sur- vey (Figs. 2—6) are in general agreement with the results of other studies in this area (Leatherwood et al., 1982; Dohl et al., 1986; Smith et al., 1986; Barlow, 1988; Forney et al., this issue; Dohl et al. 2,3 ). How- ever, the observed distribution of some species con- tradicted results of previous studies. Striped dolphins were seen rather commonly in mixed groups with short-beaked common dolphins in southern and cen- tral California between 185 and 555 km (100-300 Barlow: Abundance of cetaceans in California waters: ship surveys Table 2 Estimated values of flO) andg(O) for each ( )f the species group stratifications which were chosen jn the basis of Akaike's [nforma- tion Criterion (AICl minimization. Truncation distances for estimating f[ 1 are 5.5 km for large whales and 3.7 km for all other species. Sample sizes include the total number of groups seen by the primary team, n, the number of groups seen by the primary team when an independent observer was on duty, n ,, and the number of groups seen by the independent observers but not by the primary team, n. 2 . NA indicates information that is not available because it could not be estimated. CV is the coefficient of variation. Primary observers Secondary observers Primary observers Number of si ghtings flO) CV f{0) CV CV Main stratum and substrata n "i n 2 km' 1 flO) km- 1 A0) giO) giO) Small delphinids (3.7 km truncation) group size 1-20 67 58 9 1.258 0.249 1.864 0.147 0.770 0.137 group size 21-100 58 51 0.944 0.336 1.864 0.147 1.000 NA group size 101+ 47 44 0.283 0.193 1.864 0.147 1.000 NA Cryptic species (3.7 km truncation) calm seas 102 78 14 1.574 0.199 1.864 0.147 0.787 0.103 Large delphinids (3.7 km truncation) group size 1-20 15 14 1 0.504 0.306 1.864 0.147 0.736 0.391 group size 21+ 17 17 0.352 NA 1.864 0.147 1.000 NA Large whales (5.5 km truncation) group size 1-3 87 81 3 0.696 0.278 1.863 0.146 0.901 0.073 group size 4+ 26 22 0.256 NA 1.863 0.146 1.000 NA Small whales (3.7 km truncation! calm seas 23 19 1 0.614 0.488 1.864 0.147 0.840 0.218 nmi) from shore. Although striped dolphins were known to inhabit this area (Leather- wood et al., 1982), their frequency of occur- rence was much greater than expected. Blue whales were seen primarily in southern Cali- fornia between 92 and 370 km (50-200 nmi) offshore. In previous years, this species was seen commonly in central California between the coast and 92 km (50 nmi) offshore (Calambokidis et al., 1990b). One species was surprising in its absence: short-finned pilot whales, Globicephala macrorhynchus, were previously common in southern California, es- pecially around the Channel Islands in winter (Leatherwood et al., 1982). (Note: one group of pilot whales was seen and photographed by independent researchers between San Fran- cisco and Monterey on 2 November 1991. 6 ) Abundance Abundance estimates from this study are also in general agreement with previous esti- 6 Jones, P. A, and I. D. Szczepaniak. 1992. Report on the seabird and marine mammal censuses conducted for the long-term management strategy (LTMS), August 1990 through November 1991, for the U.S. Environmental Protection Agency, Region IX, San Francisco. July 1992. 42' : C*pe Mendocino 40' \ ® X X 38' X**® «* I S«n Francisco X o ) u ® # x V 36' \ CO 8 » * * j Pcfci!Conc*pCfcin 34' PACIFIC X X CO 9 >-* * * 1. A & X It a x „ x * x x x CP» 8 x x 9* 30' 132" 130' 128' 126' 124' 122" 120' 118" Longitude Figure 2 Locations of on-effort sightings of short-beaked common dolphins (x), long-beaked common dolphins (O), unidentified common dolphins (A), and striped dolphins ( ). Scientific names are given in Table 1. Fishery Bulletin 93(1). 1995 Table 3 Number of groups seen (n ), mean group size (S), density of individuals , abunda rice estimates (N), 95% confidence intervals (CI) on those estimates, and coefficients of variation (CV) for al species and higher taxa that were identified. Density estimates are based on lengths of transect given in the text and estimates of/tO) andg(O) given in Table 2. Mean group size includes only the indicated species and can therefore be less than the minimum of the group size category (which is defined based on the total number of all species present). Scientific names are given in Table 1. Number Mean Animal Pop. Boot strap Log-normal Lower Upper Lower Upper of groups group size density size 95% 95% 95% 95% Species strata n S km 2 N CV CI CI CI CI Small delphinids short-beaked common dolphin 3.248 225,821 0.279 143,026 419,911 132,139 385,918 group size 1-20 25 11.0 0.261 group size 21-100 52 44.7 1.274 group size 101 + 39 267.3 1.713 long-beaked common dolphin 0.136 9,472 0.683 27,029 2,817 31,842 group size 1-20 1 11.8 0.011 group size 21-100 0.0 0.000 group size 101+ 4 190.2 0.125 common dolphin (unclassified) 0.148 10,286 0.815 573 37,007 2,539 41,664 group size 1-20 6 5.4 0.031 group size 21-100 1 15.1 0.008 group size 101 + 1 661.5 0.109 striped dolphin 0.273 19,008 0.412 8,234 45,864 8,755 41,267 group size 1-20 2 7.7 0.015 group size 21-100 5 29.3 0.080 group size 101 + 14 77.6 0.178 Pacific white-sided dolphin 0.177 12,310 0.537 1,888 27,965 4,590 33,010 group size 1-20 7 11.5 0.076 group size 21-100 3 46.2 0.076 group size 101 + 2 75.4 0.025 northern right whale dolphin 0.134 9,342 0.567 2,125 21,488 3,322 26,272 group size 1-20 10 9.9 0.094 group size 21-100 3 9.4 0.015 group size 101 + 2 75.7 0.025 unidentified delphinoid 0.052 3,603 0.462 1,180 6,197 1,521 8,536 group size 1-20 17 3.2 0.052 group size 21-100 0.0 0.000 group size 101+ 0.0 0.000 Cryptic species harbor porpoise' 31 5.0 0.758 52,743 0.682 147,905 15,714 177,026 Dall's porpoise 69 3.3 1.127 78,422 0.354 33,462 150,487 40,026 153,649 pygmy sperm whale 2 1.3 0.013 870 0.796 2,741 220 3,433 Large delphinids bottlenose dolphin 0.022 1,503 0.481 499 3,819 615 3,674 group size 1-20 4 2.8 0.004 group size 21+ 10 8.3 0.017 Risso's dolphin 0.122 8,496 0.415 4,236 21,676 3,890 18,555 group size 1-20 12 8.3 0.039 group size 21+ 16 25.2 0.082 killer whale 0.004 307 1.196 2,340 48 1,947 group size 1-20 3 3.7 0.004 group size 21+ 0.0 0.000 Large whales sperm whale 0.011 756 0.493 211 1,537 303 1,886 group size 1-3 4 1.2 0.002 group size 4+ 9 6.6 0.009 Barlow: Abundance of cetaceans in California waters ship surveys Table 3 (Continued) Number Mean Animal Pop. Boot strap Log-normal Lower Upper Lower Upper of groups group size density size 95% 95% 95% 95% Species strata n S km- 2 N CV CI CI CI CI Baird's beaked whale 0.001 38 1.025 127 7 203 group size 1-3 0.0 0.000 group size 4+ 1 3.7 0.001 Bryde's whale 0.001 61 1.078 242 11 339 group size 1-3 1 1.9 0.001 group size 4+ 0.0 0.000 Bryde's or sei whale 0.001 63 1.093 232 11 355 group size 1-3 2 1.0 0.001 group size 4+ 0.0 0.000 fin whale 0.013 935 0.635 130 2,607 299 2,925 group size 1-3 17 1.4 0.011 group size 4+ 4 4.7 0.003 blue whale 0.033 2,250 0.381 899 4,131 1,093 4,632 group size 1-3 36 1.6 0.026 group size 4+ 13 3.3 0.007 humpback whale 0.009 626 0.411 196 1,133 289 1,359 group size 1-3 7 1.8 0.006 group size 4+ 3 7.3 0.003 unidentified baleen whale 0.003 214 0.631 26 530 69 665 group size 1-3 5 1.2 0.003 group size 4+ 1 2.1 0.001 unidentified large whale 0.009 629 0.470 167 1,306 262 1,508 group size 1-3 15 1.3 0.009 group size 4+ 0.0 0.000 Small whales unidentified beaked whale 3 3.5 0.019 1,322 0.892 4,541 295 5,921 mesoplodont beaked whale 2 1.0 0.004 250 0.834 746 60 1,040 Cuvier's beaked whale 7 1.9 0.023 1,621 0.823 186 5,555 396 6,637 minke whale 4 1.1 0.008 526 0.971 2,244 106 2,596 unidentified small whale 5 1.0 0.009 645 0.767 127 2,061 170 2,446 unidentified cetacean 3 1.7 0.009 620 0.879 2,026 141 2,731 ' More precise estimates for harbor porpoise are recently available in Barlow and Forney (1994). mates (Dohl et al., 1986; Barlow, 1988; Calambokidis et al., 1990a; Dohl et al. 23 ). This is the first cetacean survey in California waters to include the region between 277 and 555 km (150-300 nmi) offshore. The studies of Dohl et al. 2 - 3 included only the inshore 185 km (100 nmi) of the present study area, making di- rect abundance comparisons difficult. The mark-re- capture population estimates of blue and humpback whales by Calambokidis et al. (1990, a and b) were based on individuals sighted near the coast. Further- more, the estimates of Dohl et al. 2 - 3 do not have as- sociated statistical confidence intervals. Hence, ac- curate comparisons with previous studies can be made only for the more coastal species and mean- ingful statistical tests of differences can be made for even fewer species. Direct comparisons with the 1991 and 1992 aerial surveys (Forney et al., this issue) are planned for future publications. The abundance of harbor porpoise estimated for 1984 and 1985 was approximately 9,576 (CV=0.51) (Barlow [1988] his regions 1-4), which is smaller than the present estimate of 52,700 (CV=0.68). This dis- crepancy may be due to the inappropriate design of the present survey for a coastal species such as har- bor porpoise. Humpback whale abundance in central California was estimated as 338 based on aerial surveys from Au- gust to November of 1980-83 (Dohl et al. 3 ); however, this estimate does not include a correction factor for submerged whales. Based on mark-recapture methods, the abundance of humpback whales in 1991 and 1992 was estimated to be 581 (CV=0.03). 1 This estimate is Fishery Bulletin 93(1). 1995 42' x 3"««x \ 1 40' ^i» f Cape Mendocino 38' x X o SrV *%\^ft»*w Latitude X J *] Point Conception 34' A 4 ^ -. Loe ^^V__Ari9eto6 PACIFIC OCEAN V 1 32' \ A 30' *■* 132' 130' 128' 126' 124' 122' 120' 118' Longitude Figure 3 Locations of on-effort sightings of Dall's porpoise (x ), northern right whale dolphins ( ), and Pacific white-sided dolphins (O). Scientific names are given in Table 1. 42 O *1 1 a, ( Cape Mendocino 40' A \ \ ° ) 38' & *-A H V\ \ San Francisco N, Latitude CO a r A\ \ ' *\ 34' | Point Conception O A -oS-X-*"* 01 " PACIFIC a '*-& \ OCEAN * * \ 32' AA 30' ' 132' 130' 128' 126' 124' 122' 120' 118' Longitude Figure 4 Locations of on-effort sightings of killer whales (O), Risso's dolphins (A), and bottlenose dolphins (x). Scientific names are given in Table 1. very close to the present estimate of 626 and is well within its 95% confidence interval. For two species, new estimates of abun- dance appear to be substantially different from previous estimates. For the late 1970's, the combined summer and fall estimate of common dolphin abundance was 57,270 (CV=0.17) (Dohl et al., 1986). Although the methods used were very different and the area surveyed was smaller in that study, es- timates for other small cetaceans are simi- lar in the two studies. A large increase in common dolphin abundance is likely. This could have resulted as an effect of the 1991— 92 El Nino. Although there were no surface temperature manifestations of El Nino in the study area at the time of the survey, it is pos- sible that common dolphins were moving into California waters from farther south as a result of El Nino changes there. Since 1980, a decline has been noted in the abundance of the northern stock of common dolphins south of 30°N (Anganuzzi et al., 1993), and those authors hypothesize that this could have been caused by a general northward move- ment of that stock. This interpretation is con- sistent with the increases noted here, but the magnitude of the decrease in the south (from approximately 500,000 in 1980 to approxi- mately 100,000 in 1991 [Anganuzzi et al. 1993]) is greater than the entire estimated population in California waters. The abundance of blue whales, based on the current line-transect data (2,250), is also much higher than recent estimates made from individual-identification mark-recap- ture techniques (904 based on left-side pho- tographs and 1,112 based on right-side pho- tographs). 1 Although some mark-recapture estimates may be biased low because of geo- graphic heterogeneity in habitat use by indi- vidual whales (Hammond, 1990), the meth- ods used for mark-recapture should have minimized those effects. 1 South of the present study area, the abundance of blue whales was estimated to be 1,415 (CV=0.24) based on line- transect ship surveys in the eastern tropical Pacific from 1986 to 1990 (Wade and Ger- rodette, 1993). The latter study included sightings made along the coast of Baja Califor- nia (which probably belong to the California feeding population) as well as sightings made near the Costa Rica Dome and along the Equa- tor (which are likely to be part of a different population; Reilly and Thayer [1990]). Barlow: Abundance of cetaceans in California waters, ship surveys I I 42 ' ° 1 Of Cape Mendocino 40 38' x \ San Francisco N Latitude 5> Ox |> A 0\ o \ 34' *^\ Point Conception >yO *^ *— -. LO. PACIFIC ©x^x,, ^ , J%. OCEAN #*##* • \ X X ^ 32" 30 x x * o x ^ x 132' 130' 128' 126' 124' 122' 120' 118' Longitude Figure 5 Locations of on-effort sightings of fin whales ( ), humpback whales (O), blue whales (x), and sperm whales ( ). Scientific names are given in Table 1. Probability of detecting trackline groups The probability of detecting a trackline group of ani- mals,^), varied between 0.74 and 1.0 (Table 2 ). The data clearly indicated that small groups are much more likely to be missed than are large groups. This is intuitively obvious and justifies stratifying by group size when estimating ^(0) values. The fraction of trackline harbor porpoise seen in calm seas has been estimated previously to be 0.78 (with five ob- servers on a similar platform in California, Barlow [1988] and 0.70 (with six observers in the Gulf of Maine, Palka [1993]). The higher value ofg(0) esti- mated here for "cryptic species" with only three ob- servers (0.81) may be due to the inclusion of Dall's porpoise which may be easier to see or may simply be an artifact of small sample size. These estimates of the fraction of animals seen include only animals that were available to be seen. Availability bias is likely to be large for species such as beaked whales, which have extremely long dive times, and harbor porpoise and Dall's porpoise, which have shorter dive times but seldom are seen more than 0.5 km from the ship and may therefore remain submerged during the entire time they are within visual range. Correcting for availability bias is more difficult than for perception bias. Attempts that have been made so far have involved detailed modeling of the surfacing behavior of the animal and the searching behavior of the researchers (Doi, 1971, 1974; Barlow et al., 1988; Stern, 1992; Kasamatsu and Joyce 7 ). In addition, there are still problems with estimating perception bias because the methods used here assume that all animals are equally available to be seen if they sur- face. Heterogeneity in sightability (e.g. ani- mals that splash vs. animals that do not) gen- erally will result in an underestimate of the fraction missed. Additional work is needed to obtain complete estimates of the fraction of trackline animals seen for all species. Previous studies of Dall's porpoise have shown that attraction to the vessel is a greater problem for estimating the abun- dance of this species than are missing trackline animals (Turnock and Boucher 8 ). Turnock and Quinn (1991) estimated a cor- rection factor of 0.2378 (CV=0.3391) to ad- just Dall's porpoise abundance estimates for ship surveys (effectively then, g =4.2). That study was based, however, on a design that used only one observer who searched with 7x binoculars and unaided eyes. In the present study, very few Dall's porpoise ap- peared to be attracted to the vessel; of those sighted in calm conditions and used for abundance estimation, only 10% (9 of 88) of the Dall's porpoise groups approached the vessel to "ride the bow wave," and 89% (78 of 88) were exhibiting a "slow roll" sur- facing behavior at the time they were first sighted. Because attraction to the vessel was less than in other studies and because most Dall's porpoise were sighted before showing any apparent reaction to the vessel (perhaps because 25x binoculars were used), the magnitude of bias is probably less than that es- timated by Turnock and Quinn ( 1991). Statistical precision An attempt was made to account for most sources of sampling error in the bootstrap estimates of confi- dence intervals and coefficients of variation. How- ever, several sources of variation could not be easily included. The process of selecting a stratification 7 Kasamatsu, F., and G. G. Joyce. 1991. Abundance of beaked whales in the Antarctic. Int. Whaling Comm. working paper SC/43/012. 8 Turnock, B. J., and G. C. Boucher. 1990. Population abundance of Dall's porpoise, Phocoenoides dalli, in the western North Pacific Ocean. Int. Whaling Comm. working paper SC/42/SM10. 12 Fishery Bulletin 93(1), 1995 40" 38 ■£ 36 ' 34" 30' 132' 120' 118' Longitude Figure 6 Locations of on-effort sightings of beaked whales of the genus Mesoplo- don (...), Cuvier's beaked whales (O), Baird's beaked whales ( ), and unidentified beaked whales (x). Scientific names are given in Table 1. model by minimizing AIC would have been too time consuming to include in the bootstrap procedure; hence, precision estimates are contingent on the cho- sen models being approximately correct. Variability in estimating mean group size was included implic- itly in the Monte Carlo sampling, but it was assumed that the group size estimate for any given group was accurate. Pooling of data to estimate /10) and g(0) introduces a bias (to the extent that individuals dif- fer within a pooled group) which is not accounted for in precision estimates. All of these factors would tend to result in precision being overestimated. Overall, coefficients of variation are likely to be too small and true confidence intervals are probably wider than those reported. Acknowledgments This survey could not have been accomplished with- out the diligent work of many people, including the officers and crew of the RV McArthur. S. Hill served as cruise coordinator. The six primary observers were W. Armstrong, S. Benson, J. Cotton, D. Everhardt, M. Lycan, and R. Mellon. The independent observ- ers included E. Archer, K. Forney, S. Hill, S. Kruse, M. Lowry, V. Philbrick, B. Taylor, and P. Wade (and J. B.). The ship-board data log- ging software was written by J. Cubbage (and J. B.). Observer training was provided by S. Hill, A. Jackson, W. Perryman, and R. Pit- man. Data were edited and archived by A. Jackson and K. Wallace. Sighting distribu- tions were plotted with software written by T Gerrodette. The survey design was im- proved by thoughtful suggestions from T Gerrodette and D. DeMaster. This manu- script was improved by helpful suggestions from S. Buckland, K. Burnham, J. Calam- bokidis, J. Carretta, K. Forney, T Gerrodette, J. Laake, R. Brownell, P. Wade, and two anonymous reviewers. Literature cited Akaike, H. 1973. Information theory and an extension of the maximum likelihood principle. In B. N. Petran and F. Csaaki (eds.), International symposium on information theory, 2nd ed., 1451 p. Akadeemiai Kiadi, Budapest, Hungary. Anganuzzi, A. A., S. T. Buckland, and K. L. Cattanach. 1993. Relative abundance of dolphins associated with tuna in the eastern Pacific Ocean: analysis of 1991 data. Rep. Int. Whaling Comm. 43:459^165. Barlow, J. 1988. Harbor porpoise (Phocoena phocoena ) abundance es- timation in California, Oregon and Washington: I. Ship surveys. Fish. Bull. 86:417-432. Barlow, J., and K. A. Forney. 1994. An assessment of the 1994 status of harbor porpoise in California. U.S. Dep. Commer., NOAA Tech. Memo. NMFS. NOAA-TM-NMFS-SWFSC-205, 17 p. Barlow, J., and T. Lee. 1994. The estimation of perpendicular sighting distance on SWFSC research vessel surveys for cetaceans: 1974 to 1991. U.S. Dep. Commer., NOAA Tech. Memo. NMFS. NOAA- TM-NMFS-SWFSC-207, 46 p. Barlow, J., C. Oliver, T. D. Jackson, and B. L. Taylor. 1988. Harbor porpoise (Phocoena phocoena ) abundance es- timation in California, Oregon and Washington: II. Aerial surveys. Fish. Bull. 86:433-444. Buckland, S. T. 1985. Perpendicular distance models for line transect sampling. Biometrics 41:177-195. Buckland, S. T., J. M. Breiwick, K. L. Cattanach, and J. L. Laake. 1993a. Estimated population size of the California gray whale. Mar. Mamm. Sci. 9(3):235-249. Buckland, S. T., D. R. Anderson, K. P. Burnham, and J. L. Laake. 1993b. Distance sampling: estimating abundance of biologi- cal populations. Chapman and Hall, London, 446 p. Barlow: Abundance of cetaceans in California waters: ship surveys Burnham, K. P., D. R. Anderson, and J. L. Laake. 1980. Estimation of density from line transect sampling of biological populations. Wildl. Monogr. 72, 202 p. Calambokidis, J., J. C. Cubbage, G. H. Steiger, K. C. Balcomb, P. Bloedel. 1990a. Examination of population estimates of humpback whales in the Gulf of the Farallones, California. Rep. Int. Whaling Comm., Special Issue 12:325-333. Calambokidis, J., G. H. Steiger, J. C. Cubbage, K. C. Balcomb, C. Ewald, S. Kruse, R. Wells, and R. Sears. 1990b. Sightings and movements of blue whales off cen- tral California 1986-88 from photo-identification of individuals. Rep. Int. Whaling Comm., Special Issue 12: 343-348. Dohl, T. P., M. L. Bonnell, and R. G. Ford. 1986. Distribution and abundance of common dolphin, Del- phinus delphis, in the Southern California Bight: a quan- titative assessment based on aerial transect data. Fish. Bull. 84:333-343. Doi, T. 1971. Further development of sighting theory on whales. Bull. Tokai Reg. Fish. Res. Lab. 68:1-22. 1974. Further development of whale sighting theory. In W. E. Schevill (ed. ), The whale problem: a status report, p. 359-368. Harvard Univ. Press, Cambridge, MA. Efron, B. 1977. Bootstrap methods: another look at the jack- knife. Ann. Statistics 7:1-26. Forney, K. A., J. Barlow, and J. Carretta. 1995. The abundance of cetaceans in California waters. Part II: Aerial surveys in winter and spring of 1991 and 1992. Fish. Bull. 93:15-26. Hammond, P. S. 1990. Heterogeneity in the Gulf of Maine? Estimating humpback whale population size when capture probabili- ties are not equal. Rep. Int. Whaling Comm., Special Is- sue 12:135-140. Heyning, J. E., and W. F. Perrin. 1994. Evidence for two species of common dolphins (genus Delphinus ) from the eastern North Pacific. Contrib. Nat. Hist. Mus. Los Angeles Co. 442, 35 p. Hill, P. S., and J. Barlow. 1992. Report of a marine mammal survey of the California coast aboard the research vessel McArthur July 28- November 5, 1991. U.S. Dep. Commer, NOAA Tech. Memo. NOAA-TM-NMFS-SWFSC-169, 103 p. Holt, R. S. 1987. Estimating density of dolphin schools in the eastern tropical Pacific Ocean using line transect methods. Fish. Bull. 85:419^134. Holt, R. S., and J. E. Powers. 1982. Abundance estimation of dolphin stocks involved in the eastern tropical Pacific yellowfin tuna fishery deter- mined from aerial and ship surveys to 1979. U.S. Dep. Commer., NOAA Tech. Memo. NOAA-TM-NMFS-SWFC- 23, 95 p. Holt, R. S., and S. N. Sexton. 1989. Monitoring trends in dolphin abundance in the east- ern tropical Pacific using research vessels over a long sam- pling period: analyses of 1986 data, the first year. Fish. Bull. 88:105-111. Leatherwood, S., R. R. Reeves, W. F. Perrin, and W. E. Evans. 1982. Whales, dolphins, and porpoises of the eastern North Pacific and adjacent Arctic waters: a guide to their identification. U.S. Dep. Commer., NOAA Tech. Rep. NMFS Circular 444, 245 p. Lennert, C, S. Kruse, M. Beeson, and J. Barlow. In press. Incidental marine mammal bycatch in California gillnet fisheries. Rep. Int. Whaling Comm., Special Issue. Marsh, H., and D. F. Sinclair. 1989. Correcting for visibility bias in strip transect aerial surveys of aquatic fauna. J. Wildl. Manage. 53:1017-1024. Palka, D. 1993. Estimates of g(0) for harbor porpoise groups found in the Gulf of Maine in August 1991. Ph.D. diss., Univ. California, San Diego. Reilly, S. B. 1984. Assessing gray whale abundance: a review. In M. L. Jones, S. L. Swartz, and J. S. Leatherwood (eds.), The gray whale, Eschriehtius robustus. Acad. Press, 624 p. Reilly, S. B., and V. G. Thayer. 1990. Blue whale {Balaenoptera musculus) distribution in the eastern tropical Pacific. Mar. Mamm. Sci. 6(4):265-277. Smitb, R. C, P. Dustan, D. Au, K. S. Baker, and E. A. Dunlap. 1986. Distribution of cetaceans and sea surface chlorophyll concentrations in the California Current. Mar. Biol. 91:385-402. Smith, T. D. 1982. Testing methods of estimating range and bearing to cetaceans aboard the RVD.S. Jordan. U.S. Dep. Commer., NOAA Tech. Memo. NOAA-TM-NMFS-SWFC-20 [avail, from National Tech. Information Serv., Springfield, VA 22161], 30 p. Stern, S. J. 1992. Surfacing rates and surfacing patterns of minke whales (Balaenoptera aeutorostrata ) off central California, and the probability of a whale surfacing within the visual range. Rep. Int. Whaling Comm. 42:379-386. Turnock, B. J., and T. J. Quinn II. 1991. The effect of responsive movement on abundance es- timation using line transect sampling. Biometrics 47:701- 715. Wade, P. R., and T. Gerrodette. 1993. Estimates of cetacean abundance and distribution in the eastern tropical Pacific. Rep. Int. Whaling Comm. 43: 477-494. 14 Fishery Bulletin 93fl), 1995 Appendix "S =n m f(0)5. (5) To estimate the total fraction of trackline groups missed owing to perception bias requires that the survey be designed with two teams of completely in- dependent observers. To be independent, both teams would have to search simultaneously, not notifying or cueing each other until a group of animals had passed abeam of the vessel and were clearly missed by the other team. This approach was deemed infea- sible because of the need to approach groups to esti- mate group size and species composition. If the ves- sel was not turned until after all groups had passed abeam, a very large percentage of those groups would not be relocated. The probability of relocation would depend on group size and species composition. These factors would add considerably to the difficulty in interpreting such survey data. Instead, the survey was designed to use a single, conditionally independent observer who was aware of sightings made by the primary team, but who did not reveal the presence of a group until that group was clearly missed by the primary team. Data from the conditionally independent observer are used to make an estimate of the probability that the primary survey team detected a trackline group. The expected number of groups, n, seen very close to the transect line, say within distance 8, can be estimated as n a g(x)h(x)dx ' (3) n 5 = g(x)h(x)dx where n m is the total number of groups seen within the truncation distance co, g(x) is the probability of seeing a group that is at perpendicular distance x, and h(x) is the probability that a group will be at perpendicular distance x (usually assumed to be 1.0 for primary observers at all x). As 5 approaches zero distance, the above equation can be reexpressed as n s n a g(0)h{0)8 g{x)h(x)dx (4) which, from the line-transect definition of /TO) (Burnham et al., 1980), can be simplified to The probability of a trackline group being seen by the primary observers can be expressed as £l(0)= '1,S "is + n 2S I g 2 (0) (6) where the subscript 1 refers to sightings made by the primary observers and subscript 2 refers to sightings missed by the primary observers but seen by the independent observer. Combining Equations 5 and 6 and simplifying results in Sl(0): l lca A<0) n lol k(0) + n 2l J 2 (0)/g 2 (0) (7) Because there were three primary observers and only one independent observer, g x (0) should be greater than or equal tog 2 (0). Thus Si(0) fi(0) (9) (10) CV 2 (n 1 J + CV 2 (n 2(O ) + CV 2 {f 1 (0)) + CV 2 {k(0)). (11) Abstract. Two aerial line- transect censuses of cetaceans were conducted along the California coast during March-April 1991 and February-April 1992. The two sur- veys were designed to provide a combined estimate of cetacean abundance for winter and spring (cold-water) conditions; they com- plemented a summer and fall ship survey in 1991. The study area (264,270 km 2 ) extended about 278 km ( 150 nmi ) off the coast of south- ern California, and 185 km (100 nmi) off the coast of central and northern California. A primary team of two observers searched for cetacean species through bubble windows that allowed an unob- structed view to the sides and di- rectly beneath the aircraft. A third, conditionally independent observer searched through a belly window and reported animals that were missed by the primary team. Ap- proximately 7,069 km and 5,973 km were searched in 1991 and 1992, respectively, resulting in 253 sightings of at least 18 cetacean species (some animals could only be identified to higher taxa). Esti- mates of abundance and coeffi- cients of variation (in parentheses) for the most common small ceta- ceans are the following: 306,000 (0.34) common dolphins, Delphinus spp.; 122,000 (0.47) Pacific white- sided dolphins, Lagenorhynchus obliquidens; 32,400 (0.46) Risso's dolphins, Grampus griseus; and 21,300 (0.43) northern right whale dolphins, Lissodelphis borealis. Abundance estimates (and CV's) for the most common whales are the following: 892 (0.99) sperm whales, Physeter macrocephalus; 392 (0.41) beaked whales, genera Meso- plodon and Ziphius; 319 (0.41) humpback whales, Megaptera novae- angliae; and 73 (0.62) minke whales, Balaenoptera acutorostrata. The abundance of cetaceans in California waters. Part II: Aerial surveys in winter and spring of 1991 and 1992 Karin A. Forney Jay Barlow James V. Carretta Southwest Fisheries Science Center National Marine Fisheries Service. NOAA RO. Box 271, La Jolla, California 92038 Manuscript accepted 31 May 1994. Fishery Bulletin 93:15-26 (1995). California coastal waters are a pro- ductive and highly variable oceano- graphic region with a diverse ma- rine fauna. Coastal fisheries, prima- rily gillnet fisheries, cause the inci- dental death of a variety of marine mammal species (Barlow et al., in press). However, the impact of this mortality can only be evaluated if estimates of population size are available for the affected species. In the late 1970's and early 1980's, abundance estimates were obtained based on aerial surveys, 1 - 2 but esti- mates of precision were not ob- tained for most species. Because of the age and uncertainty of these es- timates, the National Marine Fish- eries Service conducted aerial and shipboard surveys during 1991 and 1992. Based on evidence of season- ality in the abundance and distri- bution of some cetaceans (Leather- wood and Walker, 1979; Dohl et al., 1986), separate abundance esti- mates were obtained for winter and summer conditions. Two aerial sur- veys (March-April 1991 and Febru- ary-April 1992) were completed during cold-water conditions, and one ship survey (July-November 1991) was conducted during warm- water conditions (Barlow, this is- sue). The survey periods were cho- sen based on climatic atlases of the California coast which show that, on average, March and April have the coldest, and September and October the warmest sea-surface tempera- tures (U.S. Navy, 1977). Standard line-transect methods (Burnham et al., 1980; Buckland et al., 1993a) were used from both platforms. Pre- liminary abundance estimates were calculated after completion of the first aerial survey in 1991 (Forney and Barlow, 1993), but confidence limits were large. In this paper, we present combined abundance estimates for the 1991 and 1992 aerial surveys. Survey methods The methods used during the 1991- 92 aerial surveys are described in detail by Forney and Barlow (1993) and Carretta and Forney (1993), and only a summary is presented below. The study area (264,270 km 2 ) 1 Dohl, T. P., K. S. Norris, R. C. Guess, J. D. Bryant, and M. W. Honig. 1978. Cetacea of the Southern California Bight. Part II of Summary of marine mammal and sea- bird surveys of the Southern California Bight area, 1975-1978. Final Report to the Bureau of Land Management, 414 p. [NTIS Rep. PB81248189.] 2 Dohl, T. P., R. C. Guess, M. L. Duman, and R. C. Helm. 1983. Cetaceans of central and northern California, 1980-1983: status, abundance and distribution. OCS Study MMS 84-0045. Minerals Management Ser- vice contract No. 14-12-0001-29090, 284 p. 15 16 Fishery Bulletin 93(1). 1995 encompasses California waters out to a distance of 185-278 km (100-150 nmi) from the coast and roughly a depth of 3,000-4,000 m (Fig. 1). It was defined on the basis of the distribution of fisheries that are known to take marine mammals and does not reflect a distributional boundary for any marine mammal population. Surveys were conducted along transect lines forming two nearly uniform, overlap- ping grids (Fig. 1). The resulting overall grid lines were spaced 41^46 km (22-25 nmi) apart. The loca- tion of the transect grid was chosen without refer- ence to specific areas or topographical features. To avoid potential differences in regional coverage, an attempt was made in each year to complete all transects of the first grid, providing coarse coverage of the entire study area, before beginning the second grid. However, in both years, poor weather conditions prevented the completion of both survey grids. In 1991, 85% (5,326 km) of transect grid 1 and 27% (1,739 km) of grid 2 were completed, and in 1992, jjrto 41°- - / / f — 1 Cape Mendocino 40°- 39°- .., V__ / 7\ San Francisco "'-. 38°- \""/~— -— V ^-J? '- \L_/ ~~7V California \ 37°- Latitude CO 1 35°- \7 / 7\Ft Conception 34°- \ / ^ ^r^"^ 7 P\ Los Angeles Pacific ^^\r~^~~L 7 ^^X 33°- Ocean X. 7~^~7^-----^' / -ZL 32°- 31°- Tn° JU | i | | i | | i | ' | i | ' | 127° 126° 125° 124° 123° 122° 121° 120° 119° 118° 11 7° Longitude Figure 1 Study area with two overlapping transects grids. The solid line represents grid 1, the dotted line grid 2. 81% (5,065 km) of transect grid 1 and 14% (890 km) of grid 2 were completed. The relative proportions of survey effort in different sea state and cloud cover conditions were similar for the two years (Table 1). The survey platform was a twin-engine turbo-prop DeHavilland Twin Otter, flown approximately at an altitude of 213 m (700 ft) and an airspeed of 165-185 km/h (90-100 knots). All cetacean and sea turtle sightings were recorded, but because of the high den- sities of pinnipeds near rookeries, these species were recorded only when seen farther than 10 km from land. Two "primary" observers searched through bubble windows on the left and right sides of the air- craft. These windows allowed observers to view to the side and directly beneath the aircraft with at least 10° of overlap between sides. To achieve higher sight- ing efficiency near the transect line, observers searched for cetaceans only out to a declination angle of 12° (1,004 m perpendicular distance). An addi- tional "secondary" observer monitored the trackline area out to 55° declination angles (on both sides) through a round 45-cm ( 18- in) viewing hole in the belly of the air- craft and reported sightings missed by the primary team. A fourth person re- corded all sighting, effort, and environ- mental data. To minimize observer fa- tigue, all observers rotated between these four active positions and one resting position roughly every 30 min- utes. All observers had previous experi- ence in identifying cetacean species from aerial or shipboard platforms, or both. All survey data were recorded on a laptop computer connected to a LORAN or GPS (Global Positioning System) navigational receiver, providing a con- tinuous record of position (updated every few seconds), altitude, air speed, and survey conditions. Environmental conditions, such as Beaufort sea state, percent cloud cover, and glare, were updated whenever changes occurred. Conversation in the aircraft was re- corded on a central cassette recorder as a backup to the computer record. Observers also recorded individual sighting information into personal notebooks. Surveys were conducted only in Beaufort sea states 0-4. Following the methods described in Forney and Barlow ( 1993) and Carretta and Forney (1993), the aircraft circled for each sighting to obtain species iden- tifications and school size estimates Forney et al.: Abundance of cetaceans in California waters: aerial surveys 17 Table 1 Survey effort (in km) stratified by sea state and percent cloud cover. Beaufort sea state Cloud cover and 1 2 Total 1991 0-24 25-49 50-74 75-100 Total 1992 0-24 25-49 50-74 75-100 Total 212 26 45 76 359 406 2 78 913 66 58 129 1,166 933 8 43 251 486 1,235 1,932 96 331 980 3,338 1,349 141 192 758 2,440 1,346 85 241 532 4,403 273 676 1716 2,205 7,069 1,220 113 47 433 1,813 3,908 262 284 1,519 5,973 Both years combined 0-24 25-49 50-74 75-100 Total 618 26 47 154 845 1,846 74 101 380 2,401 3,280 2,566 8,311 238 199 536 523 288 960 1,737 965 3,235 5,778 4,018 13,042 (each observer made a confidential record of best, high, and low estimate into a personal field notebook). Any additional schools sighted while the aircraft was di- verted from the transect were recorded as 'off-effort' sightings. Only sightings made during active searches on predetermined transect lines Con-effort') were in- cluded for abundance estimation. The secondary obser- ver only reported sightings missed by the primary observer team; these secondary sightings were used to estimate the fraction of animals missed on the transect line. Analytical methods Stratification Because we were not able to complete both grids in all regions of the coast, the study area was divided into four a posteriori geographic areas to approximate uni- form coverage within each stratum (Fig. 2). Environ- mental conditions such as sea state and percent cloud cover were recorded throughout the survey, as they have been shown to influence cetacean sighting rates (Holt and Cologne, 1987; Forney et al., 1991). However, be- cause of the small number of sightings made during each combination of environmental conditions, it was not possible to evaluate their effect quantitatively. Because of the difficulty in identifying beaked whales to species level during aerial surveys, only a combined abundance estimate was obtained for this group. In the preliminary analyses of the 1991 aerial survey data, Forney and Barlow ( 1993) assigned other unidentified species based on a 'nearest identified neighbor' ap- proach. In the analyses presented here, unidentified cetacean sightings were treated separately as either 'unidentified dolphin or porpoise,' 'unidentified small whale,' or 'unidentified large whale,' because they rep- resented only a small fraction of the total animals seen. The small number of sightings for each species made it necessary to pool distributions of perpendicu- lar sighting distances for line-transect calculations. Forney and Barlow (1993) created preliminary spe- cies groups based on considerations of school size, body size and behavior, and pooled distributions for groups that were not statistically different from one another. The same procedure was used for this analy- sis, resulting in the same three species/group-size categories: 1 ) small cetacean groups with 1-10 animals; 2) small cetacean groups with more than 10 animals; and 3) medium and large cetaceans (Table 2). Table 2 Estimates of flO) and g(0), and number of sightings (n) for the three species/group-size categories used in the analysis. Small cetaceans Group size n /t0) g(0) 1-10 > 10 99 53 4.70 2.85 0.67 0.85 Species Harbor porpoise, Phocoena phocoena Dall's porpoise, Phocoenoides dalli Pacific white-sided dolphin, Lagenorhynchus obliquidens Risso's dolphin, Grampus griseus Bottlenose dolphin, Tursiops truncatus Common dolphins Delphinus delphis and D. capensis Northern right whale dolphin, Lissodelphis borealis Medium and large cetaceans Group size n f{0) giO) 1-22 57 2.49 0.95 Species Killer whale, Orcinus orca Small beaked whales, Ziphius cavirostris and Mesoplodon spp. Sperm whale, Physeter macrocephalus Right whale, Eubalaena glacialis Gray whale, Eschrichtius robustus Minke whale, Balaenoptera acutorostrata Blue whale, B. musculus Fin whale, B. physalus Humpback whale, Megaptera novaeangliae Fishery Bulletin 93| 1995 42" 39° - -a B 36° 35° 34° 33° 32° 31°- 30° Pacific Ocean 127° 126° 125° 124° 123° 122° 121° 120° 119° 118° 117° 127° 126° 125° 124° 123° 122° 121° 120° 119° 118° 117° Longitude Longitude Figure 2 Completed transects (solid lines) for 1991 and 1992, and a posteriori geographic strata (separated by broken lines) used in the analysis. Area numbers are shown in circles. Abundance estimation Line transect methods (Burnham et al., 1980; Buck- land et al., 1993a) were applied to estimate abun- dances separately for each species in each stratum: N h yy A n ij,k \j,k /}<0) 2L, gj (0) (1) where Ni = l u,k 'ij.k estimated total number of animals of species k in the study area; number of sightings of species k in area i and species/group-size category,/'; average group size of species k in area i and species/group-size category J, calculated as the total number of animals in all groups di- vided by the number of groups sighted; /"■(0) - the probability density function evaluated at zero perpendicular distance for species/group- size category j; giO) = the probability of detecting a group of ani- mals on the transect line for species/group- size category j ; L = the length of transect surveyed in area i (in km); and A- = the size of area i (in km 2 ). Values for/(0) were obtained for each species/group- size category by fitting the distribution of all per- pendicular sighting distances (primary and second- ary; measured in km) to the Hazard rate model with the statistical software program HAZARD (Buckland, 1985). A value for ^(0) was estimated fol- lowing the methods described in Forney and Barlow ( 1993 ), but because of small sample sizes, it was not possible to estimate the variance ing(0). This should result in a downward bias in the variance of the abun- dance estimates, but bias in the abundance estimates themselves will be reduced. The lengths of transect lines flown, L- (and total sizes, A-), for the four areas are 3,715 km (46,300 km 2 ) for area 1; 2,831 km (63,772 km 2 ) for area 2; 4,461 km (120,108 km 2 ) for area 3; and 2,035 km (34,090 km 2 ) for area 4. Variance estimation Variance in estimated abundance was calculated with bootstrap techniques applied to the complete data Forney et al.: Abundance of cetaceans in California waters: aerial surveys 19 set. The data were subdivided by area into effort seg- ments of equal length, and the segments were then drawn randomly with replacement until the total number of kilometers actually surveyed in each area was reached. This process was replicated 1,000 times. Forney and Barlow (1993) demonstrated that the choice of segment lengths between 5 km and 20 km did not influence the resulting estimates of precision. In this analysis we also performed bootstrap simula- tions for 50 km and 100 km segments and again found that segment length did not affect estimates of vari- ance. For the bootstrap analysis, we chose a segment length of 50 km, which roughly reflects the degree of sampling variability for these surveys (i.e. the dimen- sion of actual gaps in the sampling grid in Figure 2). Each of the 1,000 bootstrap replicates was treated and analyzed as a separate survey: sightings were first stratified into the three species/group-size cat- egories given above. Individual values for n and s were calculated, and/10) was estimated with the pro- gram HAZARD. The estimated value of g(0) was treated as a correction factor known without error. The variance, coefficient of variation, and 95% confi- dence intervals were obtained from the distribution of the 1,000 bootstrap abundance estimates with stan- dard formulae. Because the bootstrap method (Buck- land, 1984) of obtaining confidence intervals can re- sult in the lower 95% confidence intervals being smaller than the actual number of animals seen (or even zero) we also calculated log-normal confidence intervals based on the bootstrap coefficient of variation. Results Detailed results of the survey, including sighting in- formation and plots of sighting locations for all spe- cies sighted are presented elsewhere (Carretta and Forney, 1993). Results relevant to the analyses pre- sented in this paper are given below. A total of 253 cetacean sightings were made (Fig. 3): 213 on effort (while actively searching), and an additional 40 off effort (24 while in transit, 8 beyond 12° declination angle, 7 while circling over another group of animals, and 1 by an off-effort observer). Twenty eight on-ef- fort sightings could not be positively identified to the 42° 38°- T3 3 36° -I 35°- 34° 33° 32° 31° 30° Pacific Ocean , 1 , 1 , 1 , 1 1 1 1 1 1 1 1 1 1 1 1 127° 126° 125° 124° 123° 122° 121° 120° 119° 118° 117° Longitude 42" 38° 37° 0) "O 2 36° 33° 32° 31°- 30 Pacific Ocean . 1 . 1 1 1 1 1 1 F ' 1 1 ' 1 ' I ' 127° 126° 125° 124° 123° 122° 121° 120° 119° 118° 117° Longitude Figure 3 Locations of all 253 cetacean sightings made during the 1991 and 1992 surveys. The 213 on-effort sightings (used in the abun- dance estimation) are shown by diamonds, and the 40 off-effort sightings (e.g. made while circling or in transit) are shown with plus signs. 20 Fishery Bulletin 93(1), 1995 species level. Four of these sightings were identified as ziphiid whales, for which a combined abundance estimate was calculated. The remaining 24 sightings were treated separately in the analyses. 300 400 500 600 700 Perpendicular distance 800 900 1000 100 200 300 400 500 600 700 800 900 1000 Perpendicular distance 300 400 500 600 700 Perpendicular distance 800 900 1000 Figure 4 Distribution of perpendicular sighting distances (100-m intervals; solid line) and Hazard model fit (dotted line) for (A) small cetaceans in groups <10, (B) small cetaceans in groups >10, and (C) medium and large cetaceans. The Hazard model provided adequate fits to the perpendicular distance distributions for the three species/group-size categories (Fig. 4). Estimates of f\0) andg(O) are given for each group in Table 1. Al- though the full transect grid was not completed in either year because of poor weather, the resulting estimates of abundance (Table 3) are the most precise that have been produced to date for this area and sea- son. CVs range from 0.24 to 0.49 for small cetaceans and from 0.35 to 1.11 for large cetaceans. Discussion Comparisons with previous abundance estimates Our abundance estimates (Table 3) can be compared directly with estimates based on 1975-83 aerial sur- veys, 12 which are likely to have similar biases. The estimate of 8,460 Dall's porpoise, Phocoenoides dalli, is similar to previous aerial survey estimates of 3,000-4,000 in winter and spring. 1 - 2 The current es- timate of 122,000 Pacific white-sided dolphins, 3 Lagenorhynchus obliquidens, is greater than the com- bined estimates of 26,000 (spring) to 33,500 (winter) for central and northern California 2 and 5,300 ( Jan- Jun) for southern California. 1 Our estimate of 21,300 northern right whale dolphins is less than the com- bined estimates of 29,000 (spring) to 61,500 (winter) for central and northern California 2 and 5,900 ( Jan- Jun) for southern California. 1 The prior studies do not give estimates of statistical precision for any of the above species, but given the CVs of our estimates, the above differences are not likely to be statistically significant. In contrast to the species above, common dolphins, Delphinus spp., appear to be much more abundant at present than during the period 1975—83. The cur- rent winter estimate (306,000; CV=0.34) is more than an order of magnitude larger than the previous value of 15,488 (CV=0.36; Dohl et al., 1986), and the 99% log-normal confidence limits for these two estimates do not overlap. Preliminary comparisons (Barlow, unpubl. data) of 1979 and 1980 ship surveys with the 1991 ship survey (Barlow, this issue) also show a significant increase in common dolphin abundance. Based on these two separate lines of evidence for winter and summer conditions, the abundance of common dolphins in California appears to have in- 3 Although estimates for Pacific white-sided dolphins based on the combined 1991 and 1992 survey data are over twice the preliminary estimate of 46,000 from only the 1991 data (Forney and Barlow, 1993), the new estimate lies well within the 95% confidence limit of the previous value. Forney et al.: Abundance of cetaceans in California waters: aerial surveys 21 Table 3 Number of groups seen, mean group size, density of individuals , and abundance estimates for cetaceans in the entire California study area, and subdivided by geographic stratum (See Fig. 2). Coefficients of variation (CV) and 95% confidence intervals (CI) for the overall abundance estimates are also given. Unid.=unidentified. Bootstrap CI Log-normal CI Animal Population Species and Number of Mean group density size Lower Upper Lower Upper area groups size km" 2 N CV 95% 95% 95% 95% Harbor porpoise' 18 1.2 0.0060 1,599 0.345 664 2,915 829 3,085 Area 1 0.0 0.0000 Area 2 0.0 0.0000 Area 3 10 1.0 0.0079 949 Area 4 8 1.4 0.0191 650 Dall's porpoise 38 3.1 0.0320 8,460 0.240 5,203 13,361 5,320 13,453 Area 1 9 4.0 0.0342 1,582 Area 2 2 4.5 0.0112 716 Area 3 19 2.6 00395 4,744 Area 4 8 3.0 0.0416 1,418 Pacific white-sided dolphin 21 151.6 0.4605 121,693 0.466 35,404 261,524 51,041 290,144 Area 1 5 24.6 0.0573 2,654 Area 2 7 69.4 0.2945 18,779 Area 3 7 237.1 0.6218 74,678 Area 4 2 457.0 0.7505 25,583 Risso's dolphin 19 47.6 0.1225 32,376 0.456 10,255 65,984 13,812 75,891 Area 1 14 28.5 0.2029 9,396 Area 2 1 8.0 0.0100 636 Area 3 4 124.3 0.1860 22,343 Area 4 0.0 0.0000 Bottlenose dolphin 8 17.9 0.0123 3,260 0.487 618 6,783 1,320 8,052 Area 1 7 20.3 0.0684 3,165 Area 2 0.0 0.0000 Area 3 1 1.0 0.0008 95 Area 4 0.0 0.0000 Common dolphins 27 514.9 1.1568 305,694 0.340 124,730 539,319 159.864 584,552 Area 1 22 592.7 5.8769 272,101 Area 2 4 176.0 0.4161 26,535 Area 3 1 157.0 0.0588 7,058 Area 4 0.0 0.0000 Northern right whale dolphin 31 18.9 0.0807 21,332 0.428 9,151 42,629 9,548 47,658 Area 1 18 12.3 0.1378 6,381 Area 2 4 56.5 0.1395 8,895 Area 3 6 11.8 0.0341 4,091 Area 4 3 22.7 0.0577 1,966 Killer whale 2 1.0 0.0002 65 0.689 133 19 220 Area 1 0.0 0.0000 Area 2 1 1.0 0.0005 30 Area 3 1 1.0 0.0003 35 Area 4 0.0 0.0000 Beaked whales 2 8 1.9 0.0015 392 0.408 151 774 182 845 Area 1 0.0 0.0000 Area 2 3 1.0 0.0014 89 Area 3 2 1.5 0.0009 106 Area 4 3 3.0 0.0058 197 Sperm whale 3 10.0 0.0034 892 0.990 2,798 176 4,506 Area 1 0.0 0.0000 Area 2 2 14.5 0.0134 857 22 Fishery Bulletin 93(1). 1995 Table 3 (Continued) Bootstrap CI Log-normal CI AniTTlfll Po*^>'l atinn Species and Number of Mean group .\I1L Lllill A V density size Lower Upper Lower Upper area groups size km" 2 N CV 95% 95% 95% 95% Area 3 1 1.0 0.0003 35 Area 4 0.0 0.0000 Northern right whale 1 1.0 0.0001 16 1.110 59 3 95 Area 1 1 1.0 0.0004 16 Area 2 0.0 0.0000 Area 3 0.0 0.0000 Area 4 0.0 0.0000 Gray whale 3 25 4.2 0.0108 2,844 0.347 1,187 5,270 1,469 5,507 Area 1 12 3.4 0.0145 669 Area 2 0.0 0.0000 Area 3 11 5.3 0.0170 2,043 Area 4 2 3.0 0.0039 132 Minke whale 3 1.0 0.0003 73 0.616 181 24 223 Area 1 1 1.0 0.0004 16 Area 2 0.0 0.0000 Area 3 1 1.0 0.0003 35 Area 4 1 1.0 0.0006 22 Blue whale 1 1.0 0.0001 30 0.990 100 6 149 Area 1 0.0 0.0000 Area 2 1 1.0 0.0005 30 Area 3 0.0 0.0000 Area 4 0.0 0.0000 Fin whale 2 1.5 0.0002 49 1.012 57 9 254 Area 1 2 1.5 0.0011 49 Area 2 0.0 0.0000 Area 3 0.0 0.0000 Area 4 0.0 0.0000 Humpback whale 8 1.6 0.0012 319 0.407 114 622 148 688 Area 1 1 1.0 0.0004 16 Area 2 0.0 0.0000 Area 3 2 1.5 0.0009 106 Area 4 5 1.8 0.0058 197 Unid. large whale 5 1.2 0.0006 160 0.457 40 348 68 376 Area 1 1 2.0 0.0007 33 Area 2 0.0 0.0000 Area 3 3 1.0 0.0009 106 Area 4 1 1.0 0.0006 22 Unid. small whale 3 1.0 0.0003 68 0.676 188 20 226 Area 1 2 1.0 0.0007 33 Area 2 0.0 0.0000 Area 3 1 1.0 0.0003 35 Area 4 0.0 0.0000 Unid. dolphin or porpoise 15 4.4 0.0180 4,766 0.331 2,050 8,368 2,533 8,966 Area 1 2 1.5 0.0028 132 Area 2 5 4.2 0.0223 1,419 Area 3 7 5.7 0.0258 3,096 Area 4 1 2.0 0.0035 118 1 More appropriate estimates for harbor porpoise are recently avai able in Barlow and Forney ( 1994). (See D iscussion section.) 2 This category includes beaked whales of the genus Mesoplodon and Cuvier's beaked whale, Ziphius cavirostris. No Baird's beaked whales, Berardius bairdii , were seen during the surveys. 3 A more accurate estimate of the entire population of California gray whales is presented in Buckland et al., 1993. (See Discus- sion section.) Forney et al. ; Abundance of cetaceans in California waters: aerial surveys 23 creased dramatically since the early 1980's. The causes of this increase are not known, but it is pos- sible that long-term oceanographic changes (Roemmich, 1992; Roemmich and McGowan, 1994) have resulted in a shift in the distribution of com- mon dolphins into this area. This hypothesis is con- sistent with the observed decline in population size of the northern common dolphin south of our study area (Anganuzzi and Buckland, 1994). Similarly, an apparent decrease in abundance was seen in short-finned pilot whales, Globicephala macrorhynchus . This species was commonly seen in the Southern California Bight on surveys during the late 1970's and early 1980's, 1 ' 2 but only one off-effort sighting of four animals was made during our surveys. Our estimate of 304 humpback whales is roughly half the recent estimate obtained from photo-identi- fication studies. 4 This is quite surprising because humpback whales, Megaptera novaeangliae , in the California feeding population are expected to be in waters off Mexico during the winter and spring sea- son. However, it is possible that some animals had already moved north into California at the time of the sightings. Alternatively, the sighted animals may have been part of the southeastern Alaska feeding population that migrates southward to breed in Mexi- can waters in spring (Baker et al., 1986). Previously published estimates for harbor porpoise, Phocoena phocoena (Barlow, 1988; Barlow et al., 1988; Barlow and Forney, 1994) and gray whales, Eschrichtius robustus (Reilly, 1984; Buckland et al., 1993b), are substantially higher than the estimates presented here. This is probably because the defined study area is not appropriate for the range of these animals. Gray whales have a much larger range and migrate through California waters (southward and then northward) from roughly November to May. Our estimate represents that portion of the population which was migrating through California in March and early April. Harbor porpoise are limited to a narrow coastal band, and our transect lines only over- lapped with this region at specific points. More appro- priate abundance estimates for harbor porpoise are pub- lished in Barlow (1988) and in Barlow and Forney (1994). Comparisons with 1991 ship surveys Although a statistical comparison between these winter and spring aerial survey estimates and the 1991 summer and fall ship survey estimates (Barlow, this issue) is precluded at this time because of dif- ferences in the sizes of the two study areas, a few patterns are noteworthy. Despite the differences in seasonal timing and areal coverage, estimates of abundance are very similar for several species. Simi- lar estimates of abundance were obtained for total common dolphins (306,000 vs. 246,000), northern right whale dolphins, Lissodelphis borealis (21,300 vs. 9,340), bottlenose dolphins, Tiirsiops truncatus (3,260 vs. 1,500), and sperm whales, Physeter macrocephalus (892 vs. 756) (aerial vs. ship esti- mates, respectively). More disparate estimates were obtained for Pacific white-sided dolphins ( 122,000 vs. 12,300), Risso's dolphins, Grampus griseus (32,400 vs. 8,500), harbor porpoise (1,600 vs. 52,700), Dall's porpoise (8,460 vs. 78,400), and total beaked whales, Ziphius cavirostris and Mesoplodon spp. (392 vs. 3,230). It may be important to note that all cases in which the ship estimates are substantially larger than the aerial estimates are for species which spend a large fraction of their time diving (harbor porpoise, Dall's porpoise, and beaked whales). Such species could be more easily missed by aerial observers owing to avail- ability bias. In the case of Pacific white-sided dol- phins and Risso's dolphins, the winter and spring aerial estimates may be larger because of a seasonal movement of animals out of Oregon and Washington in winter. 5 Additional analyses, which account for differences in geographic extent of the aerial vs. ship surveys, are planned in the future. Bias There are several sources of potential bias in this study. First, abundance estimates may be biased low because animals are missed by aerial observers (per- ception bias; Marsh and Sinclair, 1989). This is most likely to be a problem with poor observation condi- tions (high sea state or overcast conditions, or both). We have attempted to estimate the magnitude of perception bias in this study through the use of a conditionally independent observer and have cor- rected abundance estimates to reduce this effect. A second source of downward bias, availability bias (Marsh and Sinclair, 1989), is introduced because animals that are submerged when the aircraft passes overhead are not available to be seen. This effect is 4 Calambokidis, J., G. H. Steiger, and J. R. Evenson. 1993. Pho- tographic identification and abundance estimates of humpback and blue whales off California in 1991-92. Final Contract Re- port 50ABNF100137 to Southwest Fish. Sci. Cent., RO. Box 271, La Jolla, CA 92038, 67 p. 5 Green, G. A., J. J. Braeggeman, R. A. Grotefendt, C. E. Bowlby, M. L. Bonnell, and K. C. Balcomb III. 1992. Cetacean distribu- tion and abundance off Oregon and Washington, 1989-1990. Ch. 1 in J. J. Brueggeman (ed.), Oregon and Washington ma- rine mammal and seabird surveys. Minerals Management Ser- vice Contract Report 14-12-0001-30426 prepared for the Pacific OCS (Outer Continental Shelf) Region. 24 Fishery Bulletin 93(1). 1995 expected to be smallest for species which tend to oc- cur in large groups, such as common dolphins, and largest for species which spend relatively little time at the surface, such as porpoise, beaked whales, and sperm whales. Dive studies (Barlow et al., 1988) may provide information on the magnitude of availability bias, but each species requires a separate assessment of the average proportion of time it spends at the sur- face (and hence is 'available'), and adequate estimates are not currently available for most species in Cali- fornia waters. Rough estimates can be made for Dall's porpoise and humpback whales based on prior stud- ies. Dall's porpoise have similar sighting character- istics to those of harbor porpoise (both have a small body size and generally are found in small groups); thus, assuming that dive patterns are similar and applying the correction factor of 3.1 (CV=0.17) for harbor porpoise, 6 one would obtain a corrected esti- mate of approximately 26,200 Dall's porpoise. Based on a very small sample, a correction factor of 2.7 has been estimated for humpback whales. 7 This would yield a corrected abundance estimate of 861 humpback whales. Clearly, given the magnitude of these correc- tion factors, availability bias can be substantial. Potential upward bias in line-transect analysis can result if factors other than distance to the trackline affect the probability of seeing a school. School size has been shown to affect the probability of detection (Drummer, 1985; Holt and Sexton, 1989), and this can lead to an upward bias in the abundance esti- mate (Quinn, 1985; Drummer and McDonald, 1987; Buckland et al., 1993a). To counteract this effect, we have stratified small cetacean sightings by group size and estimated abundances separately for small and large groups of the same species. This is an artificial separation, but it reduces potential biases that are due to large variation in group size within a single species, such as common dolphins or Pacific white- sided dolphins. Within each stratum, correlations of perpendicular sighting distance with group size are weak and not significant at oc=0.05 (r=0.195 for small cetaceans in groups of 1—10 animals; r=0.169 for small cetaceans in groups of greater than 10 animals; and r=0.183 for whales in groups of all sizes). 6 Calambokidis, J., J. R. Evenson, J. C. Cubbage, P. J. Gearin, and S. D. Osmek. 1993. Development of a correction factor for aerial surveys of harbor porpoise. Draft Final Contract Report to the National Marine Mammal Laboratory, NMFS, NOAA, 7600 Sand Point Way NE, BIN C-15700, Seattle, WA 98115. 36 p. 7 Calambokidis, J., G. H. Steiger, J. C. Cubbage, K. C. Balcomb, and P. Bloedel. 1989. Biology of humpback whales in the Gulf of the Farallones. Final report for Contract CX-8000-6-0003 to Gulf of the Farallones National Marine Sanctuary, NOAA, Fort Mason Center, Bldg. 201, San Francisco, CA 94123, 93 p. In summary, we have attempted to correct for per- ception bias by estimating the fraction of animals missed during these surveys and have minimized potential upward bias with a poststratification by school-size range. However, species-specific availabil- ity bias cannot currently be estimated, and overall our abundance estimates are likely to be biased downward. Precision Estimation of variance for line-transect abundance calculations can be difficult. We have attempted to include most of the sources of sampling error in the bootstrap procedure, which reestimates n, s, and/10) (in Eq. 1) for each replicate. Our analysis revealed that the choice of segment length used for the boot- strap did not affect the resulting estimates of preci- sion within the range of appropriate segment lengths for this study (5-100 km; longer segments would not be appropriate because surveys extended only 100-150 km offshore). However, potential heterogeneity due to the pooling of different species and group sizes for esti- mation of /(0) andg(0) was not accounted for in preci- sion estimates. Furthermore, we did not include the variance ing(0) or in the estimation of group size for each school encountered (however, the variance in the estimated mean group size for the survey was included in the bootstrap procedure). Thus, the coefficients of variation for the abundance estimates (Table 3) are likely to be underestimated and the confidence inter- vals are likely to be too narrow. Considerations for future aerial surveys Two species of common dolphins, short-beaked and long-beaked, are recognized in California waters (Rosel, 1992; Dizon et al., 1994; Heyning and Perrin, 1994). Although clear differences in color pattern, size, and beak length exist between these two forms, it is not currently possible to differentiate them dur- ing aerial surveys; therefore the abundance estimate here is a combined estimate. Unless reliable means of identifying the two species from the air are devel- oped, aerial surveys will not be adequate for future assessments requiring separate estimates of short- beaked and long-beaked common dolphins. Similarly, it was difficult to distinguish between the smaller species of beaked whales during our aerial surveys. The estimates presented for the beaked whales as a group are therefore a combined estimate for Ziphius cavirostris and Mesoplodon spp. All unidentified beaked whale sightings could be narrowed down to these two genera. The only other beaked whale species known to occur in this region, Berardius bairdii, can be readily distinguished based Forney et al.: Abundance of cetaceans in California waters: aerial surveys 25 on its size and was not sighted during this survey. It is likely that the categorization of "small beaked whales" will be necessary on future aerial surveys. The survey grid used here was not designed for species which are restricted to a narrow coastal re- gion. Harbor porpoise are found primarily in waters inshore of the 50-fathom (92-m) isobath (Barlow, 1988). Two distinct populations of bottlenose dolphins are found in California; the inshore form is found only within about 1 km of shore (Hansen, 1990; NMFS 8 ). All of the bottlenose dolphins seen during this aerial survey were at least several miles from the main- land; therefore our estimate is assumed to represent the population of offshore animals. Precise estimates of abundance for harbor porpoise and inshore bottle- nose dolphins will require dedicated aerial surveys designed for those species. Work is currently in progress on both of these projects. 8 Acknowledgments Funding for this project was provided by the Office of Protected Species, U.S. Department of Commerce. The aircraft was provided by the NOAA Aircraft Operations Center. We express special thanks to the pilots: T O'Mara, J. Vance, P. Wehling, and M. White. We are grateful to the meteorological staff of the National Weather Service for their valuable assis- tance in planning flights. Observers were D. Ever- hart, S. Kruse, C. LeDuc, R. LeDuc, and M. Lycan (also J. B., J. V. O, and K. A. F). Survey design was improved by comments from D. Ainley, H. Braham, S. Buckland, K. P. Burnham, D. DeMaster, D. Goodman, T Gerrodette, L. Hansen, W Hoggard, D. Palka, and T Polacheck. Data recording software was developed by J. Cubbage (and J. B.). An earlier draft of this manuscript was reviewed by the participants of the Status of California Cetacean Stocks Work- shop in March- April 1993; we thank all for their ef- forts and reviews. The submitted manuscript was reviewed by J. Calambokidis, R. Hobbs, and an anonymous reviewer. Surveys were conducted under Marine Mammal Protection Act permit 748 and per- mits GFNMS-01-92 and CINMS-01-92 from the Na- tional Marine Sanctuary Program. Literature cited Anganuzzi, A., and S. Buckland. 1994. Relative abundance of dolphins associated with tuna in the eastern Pacific Ocean: analysis of 1992 data. Rep. Int. Whaling Comm. 44:361-366. 8 National Marine Fisheries Service, Southwest Fisheries Sci- ence Center, unpublished data. Baker, C. S., L. M. Herman, A. Perry, W. S. Lawton, J. M. Straley, A. A. Wol man. G. D. Kaufman, H. E. Winn, J. D. Hall, J. M. Reinke, and J. Ostman. 1986. Migratory movement and population structure of hump- back whales (Megaptera novaeangliae) in the central and eastern North Pacific. Mar. Ecol. Prog. Ser. 31:105-119. Barlow, J. 1988. Harbor porpoise, Phocoena phocoena, abundance es- timates in California, Oregon and Washington: I. Ship surveys. Fish. Bull. 86:417-432. 1995. The abundance of cetaceans in California waters. Part I: Ship surveys in summer and fall of 1991. Fish. Bull. 93:1-14. Barlow, J., and K. A. Forney. 1994. An assessment of the 1994 status of harbor porpoise in California. U.S. Dep. Commer., NOAA Tech. Memo. NOAA-TM-NMFS-SWFSC-205, 17 p. Barlow, J., C. Oliver, T. D. Jackson, and B. L. Taylor. 1988. Harbor porpoise, Phocoena phocoena, abundance es- timates in California, Oregon and Washington: II. Aerial surveys. Fish. Bull. 86:433-444. Barlow, J., R. W. Baird, J. E. Heyning, K. Wynne, A. M. Manville II, L. F. Lowry, D. Hanan, J. Sease, and V. N. Burkanov. In press. A review of cetacean and pinniped mortality in coastal fisheries along the west coast of the U.S. and Canada and the east coast of the USSR. Rep. Int. Whal- ing Comm. (Special issue.) Buckland, S. T. 1984. Monte Carlo confidence intervals. Biometrics 40:811-817. 1985. Perpendicular distance models for line transect sampling. Biometrics 41:177-195. Buckland, S. T., D. R. Anderson, K. P. Burnham, and J. L. Laake. 1993a. Distance sampling: estimating abundance of biologi- cal populations. Chapman and Hall, New York, 446 p. Buckland, S. T., J. M. Breiwick, K. L. Cattanach, and J. L. Laake. 1993b. Estimated population size of the California gray whale. Mar. Mamm. Sci. 9:235-249. Burnham, K. P., D. R. Anderson, and J. L. Laake. 1980. Estimation of density from line transect sampling of biological populations. Wildl. Monogr. 72, 202 p. Carretta, J. V., and K. A. Forney. 1993. Report of the two aerial surveys for marine mam- mals in California coastal waters utilizing a NOAA DeHavilland Twin Otter aircraft, March 9-April 7, 1991 and February 8-April 8, 1992. U.S. Dep. Commer, NOAA Tech. Memo. NOAA-TM-NMFS-SWFSC-185, 77 p. Dizon, A. E., W. F. Perrin, and P. A. Akin. 1994. Stocks of dolphins (Stenella spp. and Delphinus delphis) in the eastern tropical Pacific: a phylogeographic classification. U.S. Dep. Commer., NOAA Tech. Rep. NMFS 119, 20 p. Dohl, T. P., M. L. Bonnell, and R. G. Ford. 1986. Distribution and abundance of common dolphin, Del- phinus delphis, in the Southern California Bight: a quan- titative assessment based upon aerial transect data. Fish. Bull. 84:333-343. Drummer, T. D. 1985. Size-bias in line transect sampling. Ph.D. diss., Univ. Wyoming, Laramie, 143 p. Drummer, T. D., and L. L. McDonald. 1987. Size-bias in line transect sampling. Biometrics 43:13-21. 26 Fishery Bulletin 93(1), 1995 Forney, K. A., D. A. Hanan, and J. Barlow. 1991. Detecting trends in harbor porpoise abundance from aerial surveys using analysis of covariance. Fish. Bull. 89:367-377. Forney, K. A., and J. Barlow. 1993. Preliminary winter abundance estimates for ceta- ceans along the California coast based on a 1991 aerial survey. Rep. Int. Whaling Comm. 43:407-415. Hansen, L. J. 1990. California coastal bottlenose dolphins. In S. Leath- erwood and R. R. Reeves (eds.), The bottlenose dolphin, p. 403—420. Academic Press, San Diego. Heyning, J. E., and W. F. Perrin. 1994. Evidence for two species of common dolphins (genus Delphinus) from the eastern North Pacific. Contrib. Sci. (Los Angel.) 422. Holt, R. S., and J. Cologne. 1987. Factors affecting line transect estimates of dolphin school density. J. Wildl. Manage. 51:836-843. Holt, R. S., and S. N. Sexton. 1989. Monitoring trends in dolphin abundance in the east- ern tropical Pacific using research vessels over a long sam- pling period: analyses of 1986 data, the first year. Fish. Bull. 88:105-111. Leatherwood, S., and W. A. Walker. 1979. The northern right whale dolphin Lissodelphis bo- realis Peale in the eastern North Pacific. In H. E. Winn and B. L. Olla (eds.), Behavior of marine mammals: cur- rent perspectives in research. Vol. 3: Cetaceans, p. 85- 141. Plenum Press, New York-London. Marsh, H., and D. F. Sinclair. 1989. Correcting for visibility bias in strip transect aerial surveys of aquatic fauna. J. Wildl. Manage. 53:1017-1024. Quinn, T. J., II. 1985. Line transect estimators for schooling popula- tions. Fish. Res. 3:183-199. Reilly, S. B. 1984. Assessing gray whale abundance: a review. In M. L. Jones, S. L. Swartz, and J. S. Leatherwood (eds.), The gray whale, Eschrichtius robustus, p. 203-223. Academic Press, Orlando. Roenunich, D. 1992. Ocean warming and sea level rise along the south- west U.S. coast. Science 257:373-375. Roemmich, D. H., and J. A. McGowan. 1994. A long term decrease in zooplankton off California. Paper presented at the 1994 Ocean Sciences Meeting in San Diego, California, February 21-25, 1994. Abstract 0111-6 published in Supplement to EOS, Transactions, American Geophysical Union Vol. 75, No. 3, January 18, 1994. Rosel, P. E. 1992. Genetic population structure and systematic relation- ships of some small cetaceans inferred from mitochondrial DNA sequence variation. Ph.D. diss., Univ. California, San Diego, 191 p. U.S. Navy. 1977. U.S. Navy marine climatic atlas of the world. Vol. II: North Pacific Ocean. NAVAIR 50-1C-529. U.S. Govern- ment Printing Office, Washington, D.C. 20402. Abstract. The larval develop- ment of Sillaginodes punctata, Sillago bassensis, and Sillago schomburgkii is described based on both field-collected and laboratory- reared material. Larvae of the three species can be separated based on a combination of pigment and meristic characters, including extent and appearance of dorsal midline pigment, lateral pigment on the tail, presence or absence of pigment above the notochord tip, myomere number, extent and tim- ing of gut coiling, and size at flex- ion. The most useful meristic char- acter across the range of specimens was number of myomeres. Sillagi- nodes punctata with 42-45 myo- meres are easily distinguished from Sillago schomburgkii with 36-38, and from S. bassensis with 32-35. The timing of gut coiling and its subsequent effect on anus position differed both among the three species examined here and from that previously reported for sillaginid larvae in general. Timing of gut coiling and extent of anus migration are not useful characters for the identification of temperate Australian sillaginids at the fam- ily level but are useful on a specific level. Possible implications of the development of the gut to diet are discussed. Based on the presence of larvae, all three species spawn in South Australian waters. No larvae of a fourth sillaginid species, S. flin- dersi, were found during the study. South Australia is the western dis- tributional limit for S. flindersi and it does not appear to spawn in the area. Larval development of King George whiting, Sillaginodes punctata, school whiting, Sillago bassensis, and yellow fin whiting, Sillago schomburgkii (Percoidei: Sillaginidae), from South Australian waters Barry D. Bruce South Australian Department of Fisheries GPO Box 1625. Adelaide. South Australia 5001 Present address. CSIRO Division of Fisheries, GPO Box 1 538. Hobart. Tasmania. Australia 700 1 Manuscript accepted 15 June 1994. Fishery Bulletin 93:27-43 (1995). The perciform family Sillaginidae (whiting and sand smelts) consists of three genera, three subgenera, and thirty-one species of small to moderately sized fishes found pri- marily in shallow coastal waters of the Indo-Pacific (McKay, 1992). Sillaginids are highly valued food fishes in many tropical and temper- ate waters. The Sillaginidae are re- lated to the Percidae, Sciaenidae, and, to a lesser extent, the Haemu- lidae (McKay, 1985) although their sister group is yet to be determined (McKay, 1992). The most speciose of the three sillaginid genera (Sillago) includes twenty-nine species. The remaining two genera, Sillaginodes and Sillaginopsis, are monotypic. The taxonomy of the family is approach- ing stability; only a few species re- main undescribed (McKay, 1992). Two genera and thirteen species of sillaginids are found in Austra- lian waters. Four species inhabit the waters off South Australia: the King George or spotted whiting, Sillaginodes punctata; yellow fin whiting, Sillago schomburgkii; western school whiting, Sillago bassensis; and eastern school whit- ing, Sillago flindersii. The latter two species were, until recently, con- sidered subspecies of S. bassensis (McKay, 1992). All four species are widely distributed in southern Aus- tralia and form the basis for impor- tant commercial fisheries across their range (McKay, 1985; Kailola et al., 1993; May and Maxwell 1 ). The adult and juvenile biology of each of the four species has previ- ously been documented by several authors (Scott, 1954; Gilmour, 1969; Lennanton, 1969; Robertson, 1977; Weng, 1983, 1986; Burchmore et al., 1988; Jones 2 ; Jones et al. 3 ), but very little is known of their early life his- tory and neither the eggs nor the larvae of any of the four species have previously been described. In 1986, the South Australian Department of Fisheries began an ichthyoplankton program to inves- 1 May, J. L., and J. G. H. Maxwell. 1986. Field guide to trawl fish from temperate waters of Australia. CSIRO Division of Fisheries Res., Hobart, Tasmania, 492 p. 2 Jones, G. K. 1979. Biological investigations on the marine scale fishery in South Aus- tralia. South Australian Dep. Agric. and Fisheries Rep., 72 p. 3 Jones, G. K., D. A. Hall, K. L. Hill, and A. J. Stamford. 1989. The South Australian marine scale fishery: stock assessment, economics, management. South Australian Dep. Fisheries Green Paper, 186 p. 27 28 Fishery Bulletin 93(1), 1995 tigate the larval ecology of commercially important fishes of South Australian waters. An important pre- requisite of any such program is the ability to make an accurate identification of larvae to species. This paper details the development of Sillaginodes punctata, Sillago schomburgkii, and S. bassensis lar- vae collected during this study. Materials and methods Specimens were obtained from plankton and beach seine samples collected between March 1986 and March 1991 aboard the research vessel MRV Ngerin in coastal waters and at various inshore nursery ar- eas off South Australia. Details of sampling locations and procedures are described in Bruce (1989). Briefly, larvae were obtained from stepped oblique tows with 70-cm-diameter bongo nets fitted with 500-micron mesh. Postsettlement (refer to definition below) lar- vae and juveniles were captured with a fine mesh beach seine (7 m x 1.8 m, 2-mm mesh) as well as by dipnetting and diving. The field-collected series of Sillaginodes punctata was supplemented with lar- vae reared in the laboratory at West Beach, Adelaide. All field-collected specimens used for description were fixed in a 10% formalin-seawater solution buff- ered with sodium tetraborate (borax) and were later transferred to a 5% solution buffered with sodium B-glycerophosphate (0.5 g per 1,000 mL). Reared lar- vae were fixed immediately in the 5% solution. Reared S. punctata were used for illustration when possible because of their superior condition. Some pigment differences were apparent between reared and field-collected larvae largely as a result of ex- pansion or contraction of melanophores. Melano- phores of field-collected larvae were generally less expanded than reared specimens. Reared larvae were typically greater in length than similarly developed field-collected material owing to increased shrink- age in the latter. Similar shrinkage effects have been previously reported for a variety of species (Theilacker, 1980; Hay, 1981; Bruce, 1988). Unless specified, devel- opment at length refers to field-collected material. Representative series of S. punctata and Sillago bassensis are deposited with the I.S.R. Munro Fish Collection, CSIRO, Hobart Tasmania. Too few S. schomburgkii larvae were collected to allow a com- plete analysis and all are currently held in a collec- tion maintained by the author at CSIRO Division of Fisheries, Hobart, Tasmania. Developmental terminology and body measure- ments follow Leis and Trnski (1989). The term "postsettlement" is used to describe newly settled individuals prior to the acquisition of scales and ju- venile colour patterns, after which they are referred to as juveniles. Body length measurements (BL) are measured as notochord length, NL (i.e. from the snout tip to the end of the notochord), in preflexion and flexion larvae, and standard length, SL (i.e. from the snout tip to the posterior margin of the superior hypural elements), in postflexion larvae and juve- niles. Body depth is taken at two points. Body depth at pectoral (BDp) is equivalent to "body depth" as defined by Leis and Trnski ( 1989), that is, as "the vertical distance between body margins (exclusive of fins) through the anterior margin of the pectoral fin base." Body depth at anus (BDa) is defined as the vertical distance between body margins (exclusive of fins and, initially, the gut) through the midpoint of the anal opening. BDa includes the gut only after overlying musculature has developed. Sillaginodes punctata eggs were measured with a Zeiss photomi- croscope III fitted with an ITC 510 video camera and linked to an Apple Macintosh SE computer via an HEI 582A video coordinate digitizer. Egg dimensions are reported to the nearest micron. Larvae were measured to the nearest 0.1 mm with a dissecting microscope fitted with an ocular micrometer. Postsettlement larvae and juveniles were measured to the nearest 0.1 mm with vernier calipers. Meristic counts were made on S. punctata and Sillago bassensis specimens cleared and stained with alcian blue and alizarin red-S following Potthoff (1984). Insufficient specimens of S. schomburgkii were available for clearing and staining and therefore all meristics were taken from unstained material. Descriptions are based primarily on the detailed examination of a representative series of specimens; however, comments on pigment and meristic vari- ability stem from the routine examination of all lar- vae collected. The number of specimens examined in detail, the size range covered, and the museum ref- erence numbers (for lodged material) are provided under each species account. Results Identification Larvae were identified to family level from larval sillaginid characters reported in the literature. Silla- ginid larvae are elongate and have 30-^t4 myomeres (Johnson, 1984; Miskiewicz, 1987; Leis and Trnski, 1989). The gut typically reaches to greater than 55% body length in preflexion larvae. The anus is reported to migrate anteriorly during development (often dur- ing flexion) as a result of coiling of the anterior sec- tion of the gut, thus shortening the preanal length Bruce Larval development of Sillagmodes punctata. Sillago bassensis, and Sillago schomburgku 29 (Leis and Trnski, 1989). Sillaginids have a charac- teristic series of melanophores along the dorsal and ventral midlines (particularly prominent in small larvae) and generally have pigment located on the angle of the lower jaw. Three types of sillaginid larvae were found during this study. Specific identity of two of the types (S. schomburgkii and Sillaginodes punctata) was estab- lished by comparing vertebral counts and fin meristics of postflexion larvae to those of adult and juvenile specimens. Smaller larvae were linked by establishing a developmental series based on the extent and appearance of dorsal midline pigment, lateral pigment on the tail, presence or absence of pigment above the notochord tip, myomere number, extent and timing of gut coiling, and size at flexion. The identity of S. punctata was also confirmed by comparison to reared larvae. Though clearly separating Sillaginodes punctata from Sillago schomburgkii, fin meristics and verte- bral counts overlap in the other two South Austra- lian sillaginid species (S. bassensis and S. flindersi), thus making the specific separation of their larvae difficult. Sillaginid larvae from southern Tasmania (where only S. flindersi are found) and larvae be- lieved to be S. flindersi from New South Wales (NSW) coastal waters were compared to the third sillaginid larval type collected in South Australia in order to ascertain its identity. The NSW and Tasmanian (re- ferred to herein as eastern) specimens were highly similar but differed from the South Australian type with respect to two pigment characters. First, east- ern specimens had a single prominent, elongate mel- anophore located below the level of the pectoral fin base and overlying the cleithrum that was absent in South Australian material (Fig. 1). Second, eastern specimens developed external lateral midline pig- ment on the tail at an earlier size (7.2 mm) than did South Australian material (14.8 mm). Two sillaginids are known from Tasmanian waters: Sillaginodes punctata and Sillago flindersi (Lastetal., 1983). Only S. flindersi is known to spawn in Tasmanian waters. The eastern form was thus identified as S. flindersi and the South Australian specimens as S. bassensis. Insufficient material was available across the full size range to render an adequate description of the lar- val development of S. flindersii, and thus this spe- cies is not treated in further detail here. The most useful meristic character separating the three South Australian larval types was number of myomeres. Sillaginodes punctata with 42-45 myomeres are easily distinguished from Sillago schomburgkii with 36—38 and S. bassensis with 32— 35. Meristic details for these three species and S. flindersi are listed in Table 1. Descriptions King George whiting [Sillaginodes punctata Cuvier 1829), Figure 2 Material examined — 75 specimens, 2.0-30.5 mm BL (CSIRO L587-01, L587-02, L587-03, L587-04, L587-05, L587-06; L588-01; L589-01). Larval development — The pelagic eggs of S. punctata are spherical and have an unsegmented yolk and smooth chorion. Late stage eggs are 839- 935 microns in diameter (mean 880, n=25) and have a single oil droplet 246-263 microns in diameter (mean 255, n=25). Reared larvae hatched at 2.00- 2.15 mm (mean 2.07, re=24) at 16.5-18.7°C. The tim- ing of fertilization was not recorded as spawning oc- curred in brood stock tanks overnight. Estimates for incubation period are 48-60 hours. The temperature of the spawning tank was 16.5°C and fertilized eggs were transferred to a 90-liter tank held at 18.0-18.7°C for subsequent incubation, 24 hours prior to hatching. Newly hatched larvae have a posteriorly located oil droplet and adopt a head-down position in rear- ing containers. Yolk absorption was complete in reared larvae by 3.5 mm (8 days), although the small- Figure 1 Detail of head and trunk pigment of (A) Sillago bassensis and (B) Sillago flindersi. Myomeres have been omitted for clarity. Position of cleithrum is indicated by a dotted line. Arrow indicates characteristic melanophore overlying cleithrum in S. flindersi. 30 Fishery Bulletin 93(1), 1995 Table 1 Selected early life history features useful for identifying sillaginid larvae ( sizes are in mrr ). Size at Size at Completion first lat. first of Size at Size at midline dorsal Size at fin Number of Species gut coiling flexion pigment banding settlement formation 6 myomeres Dorsal fin Anal fin Pectoral fin Sillaginodes punctata' 21.0-24.0 5.7-7.0 8.0 6.5-7.0 15.0-18.0 C,P1,A,D2+D1,P2 42^5 XlI-XIII+I,25-27 11,21-24 13-15 Sillago bassensis' 4.1-7.5 4.8-6.5 14.0 12.0-13.0 12.0-13.0 C,P1,A,D1+D2,P2 32-35 X-XII+1, 16-19 11,18-20 15-16 Sillago schomburgkii' >5.1<10.1 7 4.8-? 2.7 <10.1 12.0-13.0 8 36-38 X-XJI+1, 19-22 11,17-20 15-16 Sillago nliata 2 ' 3 <5.0 4.0-5.6 5.3 6.5 15.5 CAD2,D1,P1,P2 30-34 XJ+1,16-18 11,15-17 15-17 Sillago maculata 2 8 4.6-6.5 3.3 10.6 8 C,PU,D2,D1,P2 33-36 XI-XII+1,19-21 11,19-20 15-17 Sillago sihama 4 5.9 5.9 5.9 9.0 8 8 33-34 XI+1,20-23 11,21-23 15-17 Sillago japonica 5 <7.6 <7.6 7.6 7.6 11.5 8 35-37 XI+1,21-23 11,22-24 15-17 ' This study. 2 Miskiewicz, L987. 3 Munro, 1945 4 Uchida et al. , 1958. 5 Mito, 1966 (as Sillago japonicus ); Kinoshita 1988. 6 Based on all elements present ar d ossified, C = caudal PI = pectoral, P2 = pelvic A = anal, Dl = first dorsal D2 = second dorsal. 7 No specimens between 5.1 and 10.1 mm were available. Coiling of the gut had not commenced in the 5.1-mm specimen but had been completed in the 10.1-mm specimen. * Data not available. est field-collected larvae (2.9 mm) had already com- pleted yolk absorption. Larvae are elongate (BDp=ll-16% BL) and have 42^45 myomeres (17-21 abdominal + 23-27 candal). Body depth at anus increases slightly from 7% to 9% BL during development. Other body proportions re- main relatively constant (Table 2). The gut is ini- tially straight and differentiates into defined fore, mid and hind gut sections by 3.7 mm. The gut exhib- its some convolution but does not coil during the lar- val phase. The midgut becomes rugose by approxi- mately 5.0 mm and remains so, although overlying musculature obscures this feature in postsettlement larvae larger than 21.0 mm. The gut begins to coil in postsettlement larvae of 21.0 -24.0 mm and is com- plete by 26.0 mm. Coiling of the gut proceeds with- out migration of the anus and is achieved by elonga- tion and anterior looping of the midgut. Conse- quently, body proportions do not show a significant change in preanal length which remains at 50—52% BL. The gas bladder is first visible in reared larvae by 3.5 mm (5 days) and is prominent and inflated in 86% of field-collected larvae (random subsample, n=50; all larvae collected at night) and all postsettlement lar- vae collected (all postsettlement larvae collected dur- ing day). The gas bladder has its origin at myomeres 2-5 in preflexion larvae but migrates posteriorly dur- ing development to myomeres 13-18 by 18.7 mm. The snout is initially slightly concave in profile, but after flexion, this gradually changes to straight or slightly convex. The eye is round. The mouth ini- tially reaches to below the eye, but is short of the eye in postflexion larvae. Six to eight small villiform teeth are present on the premaxilla by 5.8 mm. The num- ber of teeth increases to 10-12 by late flexion (6.5- 7.0 mm). There are no head spines. Scales are first present around the gut and lateral midline by approximately 27.5 mm. The development of fins in larval and juvenile S. punctata is summarized in Table 1. Completion of fin development occurs in the following sequence: caudal; pectoral; anal and second dorsal (almost si- multaneously); first dorsal; and pelvic. The rays of the caudal fin are present just prior to flexion in larvae of 5.6 mm. Flexion commences by 5.7-6.0 mm and is usually complete by 7.0 mm. Pec- toral fin buds are present in reared larvae as slight swellings on the body above the anterior margin of the oil droplet by 3.1 mm (2 days post hatch). Incipient rays are first visible by 7.5 mm and commence ossifi- cation by 8.5 mm. A full complement of 13-15 pectoral rays is present by 11.5 mm. Anal and second dorsal fin anlagen appear during flexion (5.8 mm). Distinct bases are present by 7.0 mm, incipient rays by 7.2 mm, and ossification commences by 8.0 mm. The anal and sec- ond dorsal fins complete development by 13.0 mm. The Bruce: Larval development of Sillagmodes punctata, Sillago bassensis. and Sillago schomburgku Figure 2 Development of Sillaginodes punctata. (A) 2.1 mm; (B) 2.9 mm; (C) 3.1 mm; (D) 3.5 mm; (E) 3.6 mm; (F) 4.2 mm; (G) 5.8 mm; (H) 6.5 mm; (I) 8.5 mm; (J) 12.0 mm; (K) 18.7 mm postsettlement; (L) 22.4 mmlpostsettlement: myomeres omitted for clarity). A-I are reared specimens, J-L are field-collected specimens. first dorsal fin anlage is present by 6.2 mm. Distinct bases are present by 7.6—8.6 mm and ossification of spines has commenced by 8.5—8.9 mm. The first dorsal fin completes development by 13.1 mm. Pelvic fins first appear as slight swellings on either side of the gut in 9.2-mm larvae. Well-developed buds are present by 13.0 mm, incipient rays form shortly thereafter. The pelvic fin does not complete development until 20.0-21.5 mm. Larval pigment — The oil droplet is well pigmented with large stellate melanophores from at least 24 32 Fishery Bulletin 93(1), 1995 hours prior to hatching until yolk exhaustion. Newly hatched larvae have melanophores scattered over the body. Melanophores appear on the ventral and ante- rior regions of the yolk sac by 2.8 mm and pigment also appears within the finfold (both dorsal and anal) between myomeres 25—32 in reared larvae (not appar- ent in field-collected larvae — probably owing to finfold damage). Finfold pigment disappears by 3.5 mm. Initially, melanophores are scattered over the snout but they disappear by 3.5 mm. Pigment appears at the angle of the lower jaw and is retained throughout the larval period. Melanophores are typically present on the lower jaw, ventrally on the gular membrane, and internally below the otic capsule. Further pigment does not form on the head until after settlement. The dorsal surface of both the gut and the gas bladder are covered with melanophores during development. A linear series of discrete melanophores is present on the ventral midline of the gut in preflexion and flexion lar- vae. Ventral melanophores disappear from the hindgut by 10.0 mm and this region then remains unpigmented. Concurrently, the remaining 5—8 melanophores be- tween the cleithral symphysis and the hindgut become elongate and are retained in postsettlement larvae. Bruce: Larval development of Sillagmodes punctata. Sillago bassensis, and Sillago schomburgkit 33 Figure 2 (continued) By 4.0 mm, pigment on the dorsal surface of the trunk and tail coalesce to form 11-18 discrete, evenly placed melanophores that extend in a linear series posteriorly from the nape to within about 4 or 5 myomeres from the notochord tip. The dorsal sur- face of the notochord tip has 0-3 melanophores (most commonly 1 or 2) and when present they are useful in separating preflexion Sillaginodes punctata from Sillago bassensis and S. schomburgkii, both of which lack pigment dorsally on the notochord tip. The dor- sal series of melanophores on the trunk and tail gradually disappears by the end of flexion (6.5-7.0 mm), excepting those between myomeres 31-40, which become prominent and may extend laterally over the body surface when expanded. Lateral mid- line pigment develops in this area during late flex- ion and is retained throughout the postflexion stage. Dorsal pigment gradually redevelops in postflexion larvae as a series of discrete bands, each comprising 3 or 4 pairs of stellate melanophores. Postsettlement lar- vae have 4—6 such bands which subsequently increase in number to 8-10 as juvenile pigmentation develops. Ventral pigment on the tail in newly hatched lar- vae is initially scattered but coalesces to form a se- 34 Fishery Bulletin 93(1). 1995 Table 2 Body proportions of larvae of Sillaginodes punctata ( expressed as a percentage of body length), d = damaged; g = gas bladder not visible; — = character not yet formed. Specimens between dotted lines were undergoing flexion. Pre -gas - Vent to Body length Pre-anal Pre-dorsal bladder Head Snout Eye anal fin Body depth Body depth (mm) length fin length length length length diameter length at pectoral at anus 3.1 51.6 37.1 22.5 6.4 9.7 12.9 8.1 3.2 53.1 — 23.4 18.7 3.1 6.2 — 10.9 6.2 3.3 51.5 — 28.8 24.2 6.1 9.1 — 15.1 9.1 3.6 51.3 — 22.2 19.4 4.1 8.3 — 11.1 5.5 3.7 51.3 — 24.3 21.6 4.1 8.1 — 12.2 6.8 4.1 47.5 — 24.4 19.5 3.7 7.3 — 12.2 6.1 4.2 50.0 — 23.8 19.0 2.3 7.1 — 11.9 7.1 4.3 55.8 — 32.5 23.2 4.6 9.3 — 16.2 9.3 4.7 51.1 — 34.0 23.4 4.2 8.5 — 14.9 8.5 5.0 50.0 — 30.0 24.0 5.0 8.0 — 13.0 8.0 5.3 52.8 — 32.1 22.6 3.7 7.5 — 13.2 8.5 5.4 50.0 — 29.6 20.4 1.8 7.4 — 13.0 7.4 5.7 47.3 — 31.6 22.8 5.3 7.0 — 12.3 7.9 5.9 45.8 — 28.8 18.6 5.1 6.8 — 11.9 6.8 6.0 48.3 60.0 31.6 23.3 6.7 6.7 — 13.3 8.3 6.2 50.0 31.4 21.0 4.0 6.4 6.4 12.1 8.1 6.3 47.6 50.8 33.3 23.8 6.3 6.3 4.2 11.1 7.9 6.4 51.6 46.9 32.0 20.3 6.2 6.2 — 12.5 7.8 6.5 47.7 49.2 33.1 23.8 6.1 d 6.9 12.3 7.7 6.6 47.0 — 30.3 22.7 5.3 6.1 6.6 10.6 7.5 6.8 50.0 48.5 30.9 20.6 5.9 6.6 — 12.5 8.1 7.0 51.4 52.3 34.3 21.4 d d — 11.4 10.0 7.2 54.1 50.0 37.5 23.6 5.7 7.6 0.7 11.1 8.3 7.6 52.6 53.9 34.2 22.3 5.3 7.2 2.6 11.8 7.9 8.4 52.3 40.4 40.4 21.4 5.9 7.1 0.0 12.5 10.7 9.3 52.3 30.1 39.7 21.5 6.4 6.4 1.6 10.7 9.1 10.3 52.4 31.1 40.8 21.3 5.8 6.8 0.5 11.1 9.7 12.0 50.0 27.5 39.2 21.7 6.7 5.0 0.6 10.0 9.2 13.1 49.6 27.5 40.4 19.8 5.3 5.3 0.7 9.2 8.4 15.7 50.9 27.4 40.8 19.1 5.7 d 0.0 10.2 11.5 16.1 50.9 26.7 41.0 19.2 5.0 5.6 0.0 9.9 9.9 18.2 51.1 27.5 40.6 20.3 6.0 6.0 0.5 9.9 10.4 18.7 49.2 25.7 38.0 19.8 5.3 5.9 1.1 9.6 9.1 ries of closely spaced melanophores extending to the notochord tip by 3.6 mm. Preflexion larvae have 2—4 melanophores ventrally on the notochord tip. Dur- ing flexion, melanophores between myomeres 23-38 become more prominent (similar to the dorsal series). The ventral series of melanophores on the tail be- comes gradually obscured by overlying musculature (excepting the prominent region between myomeres 32-38) in postflexion larvae. Paired external melano- phores develop ventrally on the tail in larvae greater than 8.5 mm and by settlement stage, approximately one pair per myomere is present. This ventral series forms a regular pattern of expanded and contracted melanophores in postsettlement specimens, match- ing the banding pattern of the dorsal series. School whiting [Sillago bassensis Cuvier, 1 829), Figure 3 Materials examined— 40 specimens, 2.3-17.2 mm BL (CSIRO L586-01— 10 specimens). Larval development — The smallest S. bassensis larva examined was 2.3 mm BL. At this size the mouth and gut are functional, the eyes are pig- mented, a gas bladder is present, and yolk absorp- tion is complete. Larvae are elongate (BDp= 13-20% BL) and have 32-35 myomeres ( 11-15+19-23). Body depth at anus increases slightly from 8-12% BL during develop- ment. Other body proportions remain relatively con- stant (Table 3). The gut forms a convoluted tube in the smallest specimen and is already differentiated Bruce Larval development of Sillaginodes punctata, Sillago bassensis, and Sillago schomburgkn 35 Figure 3 Development of Sillago bassensis. (A) 3.2 mm; (B) 4.4 mm; (C) 4.8 mm; (D) 5.9 mm; (E) 7.2 mm; (F) 11.2 mm; (G) 12.7 mm (postsettlement). into fore, mid, and hindgut regions. The midgut be- comes rugose by 3.0 mm and remains so, although overlying musculature obscures this feature prior to settlement. The gut begins to coil in preflexion lar- vae by 4.1 mm. Coiling proceeds without migration of the anus and is achieved by elongation and ante- rior looping of the midgut (Fig. 4). Consequently, body proportions do not show a significant change in preanal length which remains at 47—48% BL. Coil- ing of the gut is completed in postflexion larvae (7.0- 7.5 mm). The gas bladder has its origin at myomeres 2-8 in preflexion larvae but migrates posteriorly during development to myomeres 5-10 in postflexion larvae. The gas bladder is inflated and prominent in 90% of field-collected larvae (random subsample n=40; all larvae were collected at night). 36 Fishery Bulletin 93|1). 1995 The snout is initially slightly concave in profile, but after flexion, this gradually changes to straight or slightly convex. The eye is round. The mouth ini- tially reaches to below the center of the eye but ex- tends only to the anterior margin of the eye in postflexion larvae. Four to six small villiform teeth are present on the premaxilla by 4.7 mm. The num- ber of teeth increases to 7 or 8 during flexion (4.8- 6.5 mm). Head spination is only weakly developed. A single minute preopercular spine is present by 7.8 mm but is not visible after settlement (12.5 mm). A weak posttemporal ridge is present by 7.2 mm and is retained; however, no posttemporal spines develop. The single opercular spine is first visible by 12.7 mm and is retained in juveniles. Scales develop after settlement and are first vis- ible around the gut and lateral midline of the tail by approximately 16.0 mm. The development of fins in larval and juvenile S. bassensis is summarized in Table 1. Completion of fin development occurs in the following sequence: caudal; pectoral; anal, first dorsal and second dorsal fins (almost simultaneously); and pelvic. The rays of the caudal fin are present just prior to flexion in larvae of 4.4 mm. Flexion commences by 4.8-5.0 mm and is complete by 6.8 mm. Pectoral fin buds are present in the smallest specimen (2.3 mm), incipient rays form during flexion (5.8-6.0 mm), and a full complement of 15 or 16 rays is present by 10.0 mm. Anal-fin and second-dorsal-fin anlagen appear during flexion. Distinct bases are present by 6.5—7.0 mm, incipient rays by 6.8-7.1 mm, and ossification of posterior rays has regularly commenced by 7.2 mm. Ossification of dorsal and anal elements proceeds anteriorly and both fins complete development by 10.0-10.5 mm. The first dorsal fin anlage is present by 7.0 mm. Distinct bases are present by 7.5-8.0 mm and ossification of spines has commenced by 8.0-8.5 mm. Development of the first dorsal fin is complete by 10.0-10.5 mm. Pelvic fin buds are present in 7.0- 7.2 mm larvae below the pectoral fin bases. Develop- ment of the pelvic fin is complete by 12.5 mm. Larval pigment — S. bassensis larvae were the least pigmented of the three sillaginid species examined. Pigment on the head in preflexion larvae is lim- ited to the angle of the lower jaw and internally to Bruce: Larval development of Sillagmodes punctata. Sillago bassensis, and Sillago schomburgkri 37 Table 3 Body proportions of larvae of Sillago bassensis (expressed as a percentage of body len gth). d = i iamaged; g = gas bladder not visible; — = character not yet formed. Specimens between dotted lines were undergoing flexion. Pre-gas- Vent to Body-length Pre-anal Pre-dorsal bladder Head Snout Eye anal fin Body depth Body depth (mm) 2.3 length fin length length length length diameter length at pectoral at anus 56.5 _ g 23.9 4.3 8.6 17.4 6.5 3.1 48.4 — 27.4 24.2 d d — 16.1 8.1 3.4 44.1 — 23.5 19.1 5.9 7.3 — 14.7 5.9 3.7 51.3 — 28.4 d 4.1 8.1 — 16.2 8.1 3.8 47.4 — 25.0 22.4 3.9 9.2 — 17.1 6.6 4.1 51.2 — 29.3 26.8 6.1 8.5 — 18.3 8.5 4.2 52.4 — 29.8 26.2 7.1 8.3 — 19.0 10.7 4.3 46.5 — g 23.2 5.8 7.0 — 13.9 6.9 4.4 52.3 — 34.1 28.4 6.8 9.1 — 20.4 11.4 4.5 50.0 — g 24.4 4.4 7.7 — 15.5 8.9 4.6 44.6 — 28.2 23.9 6.5 8.7 — 14.1 7.6 4.7 44.7 — 29.8 22.3 6.4 7.4 — 12.8 6.4 4.8 54.2 36.4 29.2 6.2 8.3 2.1 18.7 12.5 4.9 44.9 — 29.6 22.4 5.1 8.2 — 13.3 8.2 5.3 47.2 — 33.0 26.4 7.5 7.5 — 15.1 8.5 5.5 50.9 38.1 g 30.9 9.1 9.1 0.0 20.9 12.7 5.7 50.9 — 31.6 29.8 8.8 8.8 0.0 17.5 10.5 5.8 44.8 56.9 56.9 25.9 6.9 7.7 0.6 13.8 7.7 5.9 49.1 55.9 g 27.1 8.5 8.5 2.5 18.6 11.0 6.3 46.0 47.6 33.3 26.2 6.3 7.9 0.8 14. 8.7 7.7 49.3 54.5 32.5 25.3 7.8 7.8 0.0 18.8 13.6 7.9 45.6 53.2 32.9 25.3 6.3 7.6 2.5 13.9 8.9 8.9 51.7 38.2 34.3 28.6 7.8 7.8 0.0 18.5 16.3 9.6 47.9 33.3 37.5 25.0 7.3 8.3 0.0 14.6 12.5 10.1 44.5 30.7 g 22.8 4.9 7.9 0.9 14.8 10.9 10.2 45.1 31.3 g 24.5 5.9 8.3 1.0 14.7 10.8 11.3 46.9 33.6 33.6 28.3 7.1 8.0 0.0 16.8 13.3 Figure 4 Morphology of the gut in Sillago bassensis (ventral view of pigment omitted). (A) 2.9 mm; (B) 4.2 mm; (C) 5.5 mm. 38 Fishery Bulletin 93(1), 1995 below the otic capsule. Melanophores are irregularly present ventrally on the gular membrane. Additional pigment on the head does not develop until after settlement. Melanophores then develop immediately anterior to and above the eye as well as on the snout and lower jaw. Larger specimens quickly develop a cap of melanophores over the mid and hindbrain. Pigment on the dorsal surface of the gut consists of 2-7 approximately evenly spaced melanophores in preflexion larvae. This reduces to 2 or 3 just prior to flexion. In postflexion larvae, internal pigment over the gut is restricted to above the gas bladder. Ventral pigment on the gut consists of a midline se- ries of 8-14 melanophores extending from just ante- rior to the cleithral symphysis to the anus in both preflexion and flexion larvae. One to two additional melanophores are usually present either side of this series below the level of the pectoral fin base (76% of larvae, random subsample «=25), forming a diamond pattern when viewed ventrally (Fig. 5). Preflexion larvae have 10-18 discrete, evenly placed melanophores that extend in a dorsal linear series on the trunk and tail to within 1-3 myomeres of the notochord tip. The dorsal surface of the noto- chord tip remains unpigmented throughout devel- opment. The dorsal series of melanophores gradu- ally disappears during flexion (4.9—6.5 mm). Postflexion larvae have 0-3 melanophores (most com- monly 0) below the bases of the second dorsal fin. Dorsal pigment redevelops after settlement as a se- ries of discrete bands each comprising 3-6 pairs of stellate melanophores. The first of these bands de- velops immediately below the posterior-most second dorsal fin rays, 5 or 6 additional bands subsequently Figure 5 Ventral pigment on the gut: (A) Sillaginodes punctata, 4.7 mm; Sillago schomburgkii, 4.4 mm; (C) Sillago bassensis, 4.1 mm. (B) develop anteriorly, and a single band developes pos- teriorly on the caudal peduncle by 20.0 mm. Lateral midline pigment on the tail does not form until after settlement, although some internal pigment may be present over vertebrae between myomeres 25-30 after 11.0 mm. A single row of 14—19 melanophores is present along the ventral midline of the tail in preflexion lar- vae. This ventral row is gradually obscured by over- lying musculature during flexion. Paired external melanophores subsequently develop ventrally on the tail in postflexion larvae, approximately one pair per myomere. After settlement, this ventral series forms a regular pattern of expanded and contracted mel- anophores producing a similar banding pattern to the dorsal series. One to two (most commonly 2) mel- anophores are present ventrally on the notochord tip in preflexion larvae. These are retained in postflexion larvae and, with additional melanophores, form a band of pigment over the caudal-fin ray bases. Yellow fin whiting [Sillago schomburgkii Peters 1865), Figure 6 Material examined — 16 specimens, 2.7-18.7 mm BL. Larval development — The smallest S. schomburg- kii examined was 2.7 mm. At this size the mouth and gut are functional, the eyes are pigmented, a gas blad- der is present, and yolk absorption is complete. Larvae are elongate (BDp= 14-18% BL) and have 36-38 myomeres (15-17+20-22). Body depth at anus increases from 8 to 16% BL during development. Other body proportions remain relatively constant (Table 4). The gut forms a convoluted tube in the smallest specimen and is already differenti- ated into fore, mid and hindgut regions. The midgut becomes rugose by 4.4 mm and re- mains so, although overlying musculature obscures this feature prior to settlement. The gut has not begun coiling in the largest flex- ion-stage larva available (5.1 mm). Coiling of the midgut has begun in the 10.1-mm larva and is well developed in all postsettlement larvae. Insufficient specimens were available to further document the timing of gut coil- ing. Coiling of the gut proceeds without mi- gration of the anus and is achieved by elon- gation and anterior looping of the midgut. Consequently, body proportions do not show a significant change in preanal length which remains at 51-53% BL. The gas bladder has its origin at myomeres 1-8 in preflexion lar- vae and is inflated and prominent in all larvae collected during night tows. The gas bladder is inconspicuous in larvae caught during the day. Bruce: Larval development of Sillaginodes punctata, Sillago bassensis, and Sillago schomburgkn 39 D Figure 6 Development of Sillago schomburgkii. (A) 2.7 mm; (B) 4.4 mm; (C) 5.0 mm; (D) 10.1 mm; (E) 13.0 mm (postsettlement). 40 Fishery Bulletin 93(1), 1995 The snout is initially slightly concave in profile, but after flexion this gradually changes to straight or slightly convex. The eye is round. The mouth ini- tially reaches below the eye but is short of the eye in postflexion larvae. Four to six small villiform teeth are present on the premaxilla by 4.4 mm. The num- ber of teeth increases from 10 to 12 during flexion (from 4.8 to greater than 5.1 mm). Head spination is only weakly developed. One to two preopercular spines are discernible in postsettlement larvae. A weak posttemporal ridge with 1 or 2 small spines is developed in the 10.1-mm postflexion larva and is present in all postsettlement larvae examined. The single opercular spine is not visible in the 10.1-mm larva but is present in postsettlement larvae and is retained in juveniles. Scales develop after settlement and are first vis- ible around the gut and lateral midline by 17.2 mm. Insufficient numbers of specimens were available to document the full sequence of fin development or the completion of flexion in S. schomburgkii. The rays of the caudal fin are present in flexion larvae of 4.8 mm. Flexion commences by 4.8 mm. Pectoral fin buds are present in the smallest speci- men (2.7 mm) and incipient rays form during flex- ion. Rays of the pectoral fin have commenced ossifi- cation in the 10.1-mm postflexion larva. A full comple- ment of 15 or 16 pectoral fin rays is present in the smallest postsettlement larva (12.7 mm). Anal-fin and second-dorsal-fin anlagen appear during flexion. Full complements (spines and rays) of the anal fin and both dorsal fins are present in the 10.1-mm speci- men. The pelvic fin has commenced development in the 10.1-mm larva and has completed development by 12.7 mm. Larval pigmentation — Pigment on the head in preflexion S. schomburgkii larvae is limited to the angle of the lower jaw and internally to the base of the otic capsule. One or two melanophores are also present ventrally on the gular membrane, increas- ing to three during flexion. Additional melanophores develop on the snout tip, scattered over the lateral surface of the head, and a cap of pigment forms over the mid and hindbrain in postflexion larvae. Pigment on the dorsal surface of the gut and gas blad- der consists of 8—10 approximately evenly spaced melanophores. Scattered internal melanophores gradu- ally spread over the lateral walls of the gut in post- flexion larvae. Ventral pigment on the gut consists of a midline series of 8-14 melanophores extending from just anterior of the cleithral symphysis to the anus (Fig. 5). Preflexion larvae have 15-22 discrete, evenly spaced melanophores that extend in a dorsal linear series from the nape to within 2-5 myomeres of the notochord tip. The number of dorsal melanophores decreases to 13 by 5.0 mm. A series of three discrete dorsal bands consisting of 3-5 paired stellate mel- anophores has replaced this dorsal series in the 10.1 mm postflexion larva. Lateral midline pigment in S. schomburgkii larvae is the most pronounced of all three species examined and is present on the tail in the smallest larva (2.7 mm) as 2 or 3 elongated mel- Table 4 Body proportions of larvae of Sillago schomburgkii (expressed as a percentage of body length), d = damaged; g = gas bladder not visible; — = character not yet formed. Specimens between dotted lines were undergoing flexion. Pre-gas- Vent to Body length Pre-anal Pre-dorsal bladder Head Snout Eye anal fin Body depth Body depth (mm) length fin length length length length diameter length at pectoral at anus 2.7 53.7 24.1 20.4 3.7 9.2 14.8 6.3 3.3 51.5 — 25.7 21.2 5.1 9.1 — 15.1 7.6 3.6 48.6 — g 25.0 6.1 8.3 — 13.9 8.3 3.7 50.0 — g 24.3 5.4 8.1 — 16.2 9.4 3.8 51.3 — 25.0 22.4 2.6 7.9 — 14.5 7.9 3.9 52.3 — 28.2 22.3 6.4 7.7 — 15.4 7.7 4.0 51.2 — g 25.0 7.5 7.5 — 17.5 9.0 4.3 52.3 — g 22.1 5.8 8.1 — 15.1 9.3 4.4 53.4 — 28.4 22.7 5.7 8.4 — 14.8 7.9 4.8 53.1 31.2 25.0 6.2 8.3 15.6 10.4 5.0 53.0 — 34.0 25.0 7.0 9.0 8.0 18.0 11.0 10.1 52.5 34.6 g 27.7 8.9 6.9 2.0 17.8 15.8 13.6 49.3 32.3 g 27.2 7.3 8.1 3.6 16.9 14.7 17.2 53.5 36.0 g 30.2 9.3 8.1 2.9 17.4 14.5 Bruce: Larval development of Sillagmodes punctata, Sillago bassensis, and Sillago schomburgkn 41 anophores in the vicinity of myomeres 24-26. Lat- eral midline pigment spreads both anteriorly and posteriorly as a linear series of elongated myomeres during development. By 10.1 mm, lateral midline pigment consists of 18 stellate and approximately evenly spaced melanophores extending from the pec- toral fin to the caudal peduncle. Internal pigment along the vertebrae is visible in the 10.1-mm post- flexion larva but is most pronounced in post- settlement larvae as clusters of melanophores located over every 2-5 vertebrae. A single row of 16-18 melanophores is present along the ventral midline of the tail in preflexion lar- vae. This ventral row is gradually obscured by over- lying musculature during flexion. Paired external melanophores (approximately one pair per myomere) subsequently develop ventrally on the tail in post- flexion larvae, approximately one per myomere. Two to three (most commonly three) melanophores are present ventrally on the notochord tip in preflexion larvae. These are retained in postflexion larvae and form a band of pigment over the caudal-fin ray bases. Discussion Egg or larval development, or both, have been de- scribed for only four other species of sillaginid lar- vae: Sillago japonica (Kamiya, 1925; Ueno and Fujita, 1954; Ueno et al., 1958; Mito, 1966 — as Sil- lago japonicus; Ikeda and Mito, 1988; Kinoshita, 1988; Oozeki et al., 1992); Sillago sihama (Gopinath, 1946; Uchida et al., 1958; Ikeda and Mito, 1988; Kino- shita, 1988); Sillago maculata (Miskiewicz, 1987; Kinoshita, 1988); and Sillago ciliata (Munro, 1945; Miskiewicz 1987; Tosh 4 ). In addition, Miskiewicz (1987, p. 62) reported a series of unidentified sillaginid larvae which, based on pigment on the lat- eral wall of the gut below the pectoral fin base, were almost certainly Sillago flindersi. Characters useful for the identification of tropical sillaginid larvae at the family level and similarity of sillaginid larvae to those from other families have been considered in detail by Leis and Trnski (1989) and Miskiewicz ( 1987). Although most of the charac- ters discussed by these authors also apply to the tem- perate species considered here, an exception was the timing of gut coiling. Leis and Trnski ( 1989) reported that the gut of tropical sillaginid larvae commenced coiling during notochord flexion and was accompa- nied by the anterior migration of the anus. In the South Australian species, coiling of the gut com- menced prior to flexion in S. bassensis, after settle- ment in Sillaginodes punctata, and had not yet com- menced in the largest flexion larva available for Sillago schomburgkii (although coiling of the gut was present in a 10. 1-mm postflexion larva ). In all cases, coiling of the gut proceeded without migration of the anus and was achieved by anterior looping of the midgut. The implications of these variations are un- clear but suggest that, although useful on a specific level, the timing of gut coiling and migration of the anus are not useful characters for the identification of temperate sillaginids at the family level. The significance of gut coiling may relate to shifts in diet. Robertson (1977) reported a dietary shift in postsettlement Sillaginodes punctatus (-punctata) in Westernport Bay (Victoria) between November and December, a shift from harpacticoid copepods, gammarid amphipods, and mysids to larvae of the ghost prawn Callianassa australiensis, polychaetes, and juvenile crabs. Robertson correlated this dietary shift with increasing body size and mouth gape as well as with the availability of C. australiensis lar- vae. However, from his length-frequency data, this period also corresponds to the size range during which postsettlement S. punctata undergo gut coil- ing. Alternatively, because evacuation rates are be- lieved to decrease after gut coiling (Arthur, 1976, and references within; Young 5 ), perceived changes in diet may be confounded by increased food retention times. Stomach contents were not analyzed during this study; they provide a valuable topic for further re- search. Despite seasonal sampling over five years, larvae of only three of the four sillaginid species with adult distributions extending to South Australia were lo- cated during this study. The lack of Sillago flindersi larvae suggests either that this species does not spawn in South Australian waters, that sampling frequency was too course to detect the presence of larvae of this species, or that S. flindersi larvae be- have differently from other sillaginid species and are less prone to capture (e.g. epibenthic and neustonic). Sillago flindersi larvae are frequently encountered in similar sampling regimes in coastal waters of east- ern Australia 6 and in Tasmanian waters (author's pers. observ.) and thus it seems unlikely that a lack of their larvae in South Australian samples repre- sents an artifact of sampling or that their behavior is fundamentally different from other sillaginid larvae. 4 Tosh, J. R. 1903. Notes on the habits, development etc. of the common food fishes of Moreton Bay. Queensland Marine Dep.: Marine Biologist's Report. 5 Young, J. W. CSIRO Div. Fisheries, GPO Box 1538 Hobart, Tas- mania, Australia 7001. Personal commun., 1993. 6 Miskiewicz, A. G. Sydney Water Board, PO Box A53, Sydney South, NSW, Australia 2000. Personal commun., 1993. 42 Fishery Bulletin 93(1), 1995 South Australian waters represent the western distributional limit of S. flindersi in southern Aus- tralia (McKay, 1992; Gomon et al., 1994; Kailola et al., 1993). Spawning times for S. flindersi vary throughout its range; a summer spawning is recorded for Victorian populations (Hobday and Wankowski 7 ). No data are available on either the reproductive con- dition of S. flindersi or on the presence or absence of juveniles in South Australian waters. However, on the basis of a lack of larvae, I suggest that spawning does not occur in South Australia and that the west- ern limit of S. flindersi comprises fish recruited from eastern populations. Acknowlegments I would like to thank G. K. Jones, S. A. Shepherd, A Miskiewicz, J. M. Leis, and A. J. Butler for their help- ful comments on the manuscript. Thanks are also due to A. R. Knight, R. Hudson, R. Moehring, and D. A. Short for their help in collecting and processing plankton samples. Literature cited Arthur, D. K. 1976. Food and feeding of larvae of three fishes occurring in the California Current, Sardinops sagax, Engraulis mordax, and Trachurus symmetricus . Fish. Bull. 74:517-529. Bruce, B. D. 1988. Larval development of blue grenadier, Macruronus novaezelandiae (Hector), in Tasmanian waters. Fish. Bull. 86:119-128. 1989. Studying larval fish ecology: an aid to predict future catches. SAFISH 13(4):4-9. Burchmore, J. J., D. A. Pollard, M. J. Middleton, J. D. Bell, and B. C. Pease. 1988. Biology of four species of whiting (Pisces: Sillaginidae) in Botany Bay, New South Wales. Aust. J. Mar. Fresh- water Res. 39:709-727. Gilmour, A. J. 1969. The ecology of King George whiting Sillaginodes punctatus (Cuvier and Valenciennes) in Westernport Bay, Victoria. Ph.D. thesis, Monash Univ., Australia. Gopinath, K. 1946. Notes on the larval and post-larval stages of fishes found along the Trivandrum coast. Proc. Indian Natl. Sci. Acad. 12(1):7-21. Gomon M. F, C. J. M. Glover, and R. H. Kuiter. 1994. The fishes of Australia's south coast. State Print, Adelaide, Australia, 992 p. Hay, D. E. 1981. Effects of capture and fixation on gut contents and body size of Pacific herring larvae. Rapp. P.-V. Reun. Cons. Int. Explor. Mer 178:395-400. 7 Hobday, D. K., and J. W. J. Wankowski. 1987. School whiting Sillago bassensis flindersi: reproduction and fecundity in east- ern Bass Strait, Australia. Victorian Dep. Conserv., Forests and Lands, Fisheries Div. Int. Rep. 153, 24 p. Ikeda, T., and S. Mito. 1988. Pelagic fish eggs. In M. Okiyama (ed.), An atlas of the early stage fishes in Japan, p. 999-1083. Tokai Univ. Press, Tokyo. Johnson, G. D. 1984. Percoidei: development and relationships. In H. G. Moser, W. J. Richards, D. M. Cohen, M. F. Fahay, A. W. Kendall Jr. , and S. L. Richardson ( eds. ), Ontogeny and sys- tematics of fishes, p. 464-498. Am. Soc. Ichthyol. Herpetol., Spec. Publ. 1. Jones, G. K. 1980. Research on the biology of the spotted ( King George ) whiting in South Australian waters. SAFIC 4:3-7. Kailola, P. J., M. J. Williams, P. C. Stewart, R. E. Reichelt, A. McNee, and C. Grieve. 1993. Australian fisheries resources. Bureau of Rural Sciences, Fisheries Res. and Develop. Corp., Canberra, Australia, 422 p. Kamiya, N. 1925. Description of pelagic fish eggs and their larvae in Tate- yama Bay. J. Imperial Fish. Inst. 21: 71-85. [In Japanese.] Kinoshita, I. 1988. Sillaginidae. In M. Okiyama (ed.), An atlas of the early stage fishes in Japan, p. 449-452. Tokai Univ. Press, Tokyo. Last, P. R., E. O. G. Scott, and F. Talbot. 1983. Fishes of Tasmania. Tasmanian Fisheries Develop- ment Authority, Hobart, Australia, 563 p. Leis, J. M., and T. Trnski. 1989. The larvae of Indo-Pacific shore fishes. Univ. New South Wales Press, 371 p. Lennanton, R. C. J. 1969. Whiting fishery — Shark Bay. Fishing Industry News Service. W. Aust. Dep. Fish. Wildl. 2(1):4-11. McKay, R. J. 1985. A revision of the fishes of the family Sillaginidae. Mem. Queensl. Mus. 22: 1-73. 1992. FAO species catalogue. Vol. 14: Sillaginid fishes of the world. FAO, Rome., 87 p. Miskiewicz, A. G. 1987. Taxonomy and ecology of fish larvae in Lake Macquarie and New South Wales coastal waters. Ph.D. thesis, Univ. New South Wales. Mito, S. 1966. Fish eggs and larvae. In S. Motoda (ed.), Illustra- tions of the marine plankton of Japan, Vol. 7. Soyosha, Tokyo, 74 p. [In Japanese.] Munro, I. S. R. 1945. Postlarval stages of Australian fishes — No. 1. Mem. Queensl. Mus. 12:136-153. Oozeki, Y., P. Hwang, and R. Hirano. 1992. Larval development of the Japanese whiting, Sillago japonica. Jpn. J. Ichthyol. 39:59-66. Potthoff, T. 1984. Clearing and staining techniques. In H. G. Moser, W. J. Richards, D. M. Cohen, M. F. Fahay, A. W Kendall Jr., and S. L. Richardson (eds.), Ontogeny and systematics of fishes, p. 35-37. Am. Soc. Ichthyol. Herpetol., Spec. Publ. 1. Robertson, A. I. 1 977. Ecology of juvenile King George whiting Sillaginodes punc- tatus (Cuvier and Valenciennes) (Pisces: Perciformes) in West- ern Port, Victoria. Aust. J. Mar. Freshwater Res. 28:35-43. Scott, T. D. 1954. The life history of the spotted whiting, Sillaginodes punctatus (Cuvier and Valenciennes) in South Australia. M.Sc. thesis, Univ. Adelaide, Australia. Bruce: Larval development of Sillaginodes punctata, Sillago bassensis, and Sillago schomburgkn 43 Theilacker, G. H. 1980. Changes in body measurements of larval northern anchovy, Engrauhs mordax, and other fishes due to han- dling and preservation. Fish. Bull. 78:685-692. Uchida, K., S. Imai, S. Mito, S. Fujita, M. Ueno, Y. Shojima, T. Senta, M. Tahaku, and Y. Dotu. 1958. Studies on the eggs, larvae and juveniles of Japanese fishes. Series 1: Second laboratory offish biology. Fish. Dep. Fac. Agric, Kyushu Univ., Fukuoka, Japan. [In Japanese.] Ueno, M., and S. Fujita. 1954. On the development of the egg of Sillago sihama (Ferskal). Jpn. J. Ichthyol. 3:118-120. Ueno, M., T. Senta, and S. Fujita. 1958. Sillago sihama (Ferskal). In Kyushu University eds., Second laboratory of fisheries biology: studies on the eggs, larvae and juveniles of Japanese fishes. Shyuk- ousha, Fukuoka. [In Japanese.] Weng, H. T. 1983. Identification, habitats and seasonal occurrence of juvenile whiting (Sillaginidae) in Moreton Bay, Queens- land. J. Fish Biol. 23:195-200. 1986. Temporal distribution of whiting (Sillaginidae) in Moreton Bay, Queensland. J. Fish Biol. 29:755-764. Abstract. Female and sublegal-size male Tanner crabs, Chionoecetes bairdi, are often caught incidentally in the males- only fishery for this species. Effects of low air temperature during the winter fishery on juvenile and fe- male adult crabs and on the devel- oping eggs brooded by the females were simulated in the laboratory by exposing crabs to cold air (-20 to +5°C) up to 32 minutes; controls were not exposed. Exposure was expressed as degree-hours (°h), the product of temperature (°C) and time (hours). Severe exposure caused death: median lethal expo- sure stabilized at -3.3 + 0.8°h for juveniles and —4.3 ± 0.5°h for adults after 16 days. Exposure also re- duced vigor (measured by righting ability), caused pereiopod auto- tomy, and depressed adult feeding rates and juvenile growth. Expo- sures causing one-half the crabs to cease righting were —1.2 ± 0.3°h for juveniles and -2.1 ± 0.3°h for adults (measured immediately af- ter exposure). Mean pereiopod au- totomy ranged up to 44% for juve- niles exposed to -2°h, and up to 10% for adults exposed to -10.6°h. Ecdysis of juveniles was not af- fected, but exposed juveniles fre- quently shed additional pereiopods with the molt. Prompt return of incidentally caught Tanner crabs to the sea when temperatures are be- low freezing should reduce adverse effects of cold aerial exposure. Responses of Tanner crabs, Chionoecetes bairdi, exposed to cold air Mark G. Carls Charles E. O'Clair Auke Bay Laboratory, Alaska Fisheries Science Center National Marine Fisheries Service, NOAA 1 1305 Glacier Highway Juneau, Alaska 99801-8626 Manuscript accepted 23 May 1994. Fishery Bulletin 93:44-56 (1995). Tanner crabs, Chionoecetes bairdi Rathbun, 1893, are the target of a large commercial pot fishery and are an important commercial spe- cies in Alaskan waters (Otto, 1989). Landings of C. bairdi rose to a peak of 57,923 metric tons (t) in 1978, then declined to 5,390 t in 1987; landings increased to 23,507 t in 1990. 1 Current Alaska fishing regula- tions require release of small (<139- mm carapace width) male and all female C. bairdi. Commercial fish- ery openings in recent years have generally ranged from November through April, 2 when minimum daily air temperatures can drop to -21°C. 3 The amount of time inciden- tally captured crabs remain on deck varies, ranging from a few minutes during pot fishing to hours in some trawling operations (Stevens, 1990). Exposure to cold air during fishing operations may be detrimental to individual crabs (Carls and O'Clair, 1990), exposed egg clutches, and possibly — with sufficient fishing pressure — to the population. Regu- lations also require that Tanner crabs caught incidentally by multi- species trawling operations in the eastern Bering Sea be returned to the sea, but these regulations may be ineffective because of poor survival (22 + 3.6% for C. bairdi) of the culled crabs (Stevens, 1990). Here we report the responses of juvenile and adult female Tanner crabs and their offspring exposed to cold air. Our objectives were to determine the effects (immediate 1 Kruse, G. Alaska Dep. Fish and Game, Div. Commer. Fish., Juneau, AK 99802. Pers. commun., July 1992. 2 ADF&G (Alaska Department of Fish and Game). 1989a. Report to the Alaska Board of Fish- eries. Southeast Alaska and Yakutat (Re- gion 1) 1988/89 shellfish fisheries. Regional Information Rep. No. 1J89-01. ADF&G, Div. Commercial Fisheries, Juneau, AK. 1989b. Westward region shellfish report to the Alaska Board of Fisheries. ADF&G Regional Information Rep. No. 4K89-3. ADF&G, Div. Commercial Fisheries, Westward Regional Office, 211 Mission Rd., Kodiak, AK 99615, 325 p. 1989c. Prince William Sound management area shellfish report to the Alaska Board of Fisheries. ADF&G Regional Informa- tion Rep. No. 2C89-03. ADF&G, Div. Commercial Fisheries, Central Region, 333 Raspberry Rd., Anchorage, AK 99581, 55 p. 1989d. Cook Inlet area shellfish manage- ment report to the Alaska Board of Fish- eries, 1988-89. Regional Information Rep. No. 2H89-03. ADF&G, Div. Com- mercial Fisheries, 333 Raspberry Rd., Anchorage, AK 99581, 75 p. 1989e. Synopsis of the Montague Strait ex- perimental harvest area 1985-1988. ADF&G Regional Information Rep. No. 2C89-04. ADF&G, Div. Commercial Fish- eries, Central Region, 333 Raspberry Rd., Anchorage, AK 99581, 21 p. 1989f. Report to the Board of Fisheries Norton Sound red king crab fishery (sum- mer fishery only). ADF&G Regional In- formation Rep. No. 3N89-05. ADF&G, Div. Commercial Fisheries, Central Re- gion, Juneau, AK, 14 p. 3 NOAA. 1987. Local climatological data, monthly and annual summaries with com- parative data. U.S. Dep. Commer., Na- tional Climatic Data Center, Asheville, NC 28801. 44 Carls and O'Clair: Responses of Chionoecetes bairdi to cold air 45 and long-term) of exposure to cold air on 1) survival; 2) sublethal responses, including righting response, limb autotomy, feeding rate, ecdysis (juveniles), and growth; and 3) reproductive responses including egg survival, zoeal production, zoeal viability, and subse- quent egg extrusion and viability of the extruded clutch. Methods Experimental crabs were collected with crab pots. Juvenile crabs (both sexes) were collected in Auke Bay, Alaska (lat. 58°21'N, long. 134°41'W) on 14 and 19 January 1988. Ovigerous females were captured near Eagle River (lat. 58°31'N, long. 134°48'W) and Lena Point (lat. 58°24'N, long. 134°47'W) in Favorite Channel, Alaska, on 11 February 1988. In the laboratory, carapace length (distance from the posterior margin of the right ocular orbit to the midpoint of the posterior margin of the cara- pace) was measured to the nearest millime- ter. Carapace width was subsequently esti- mated by regressing carapace widths and lengths of Tanner crabs measured at a later date. 4 Live weight was measured to the near- est 0.1 g. Juvenile crab weights ranged from 26 to 229 g (* = 109 ±14 g), and carapace lengths ranged from 35 to 64 mm (3c=49 ±2.3 mm) (Fig. 1). Estimated juvenile cara- pace widths (for both sexes) ranged from 46 to 74 mm (width=-0.237 + 1.318 x length, r 2 =0.994, rc=145). The immature condition of males was determined solely by body size. Adult female crab weights ranged from 182 to 553 g ( x = 329 ± 8 g), and carapace lengths ranged from 65 to 96 mm (x=80 ±1.0 mm) (Fig. 1). Estimated female carapace widths ranged from 85 to 124 mm (width=1.746 x 1.274 x length, r 2 =0.995, n=70). Crabs were maintained in 500-L tanks at ambient seawater temperatures (6.0-6.9°C for juveniles, 5.3-6.0°C for adults) until ex- posure to test air temperatures; after expo- sure they were returned to the same tanks for 32-35 days of observation (4.7-6.7°C for juveniles, 4.7-5. 2°C for adults). A subset of 40 female crabs was retained for an addi- tional three months of observation. Crabs were exposed in a modified chest freezer divided by a vertical baffle into two compartments of unequal size (Carls and O'Clair, 1990). Infrared heat lamps were placed in the smaller compartment for temperature control. To ensure uniform temperatures, a small fan (in the center bottom of the baffle) drew air from the exposure chamber into the small chamber at 45 ± 5 cm/sec. Return air circulated over the baffle into the exposure chamber. Temperatures were measured with a thermistor located in the exposure area near the fan and were regulated manually by switching the heat lamps on or off. Temperatures were con- trolled to ±0. 1°C after the chamber had cooled to the desired temperature. Crabs were exposed to cold air on the plywood bottom of the exposure chamber. Juvenile crabs were randomly placed in six groups with 10 crabs per group and were exposed to cold air on 21 and 25 January (about one week after capture). Exposure temperatures ranged from -5.0 to -20.0°C; exposure durations were 0, 12, 16, or 24 minutes to yield 0, -1.0, -1.5, -2.1, -4.0, and -8.0°h exposures (Table 1). The lengths (F 5 54 =0.06, P>0.99) and 25 r ~n ~\ 20 T 200 260 320 380 Wet weight (grams) Ik _ r _r 500 40- 30- 10- Adult females Juveniles dcuxi 30 17/ Tilm rl i i 50 60 70 Carapace length (mm) n Figure 1 Chionoecetes bairdi length and weight frequencies. Adult female frequencies may not be directly comparable to juvenile frequencies because they were taken from a different locality. 4 r^O.99. Stone, R. NMFS Auke Bay Lab., Juneau, AK 99801-8626. Unpubl. data, May 1992. 46 Fishery Bulletin 93(1), 1995 Table 1 Temperature and duration of exposure of Chionoecetes bairdi to cold air. The number of crabs exposed (n) is also indicated. Controls were not exposed to air. SE = standard error. Air temperature Exposure (Celcius) time mean SE (minutes) Degree-hours n Juveniles — — 0.00 10 -5.0 0.02 12 -0.99 10 -7.5 0.05 12 -1.50 10 -10.2 0.24 12 -2.05 10 -15.0 0.03 16 -4.00 10 -20.0 0.07 24 -8.02 10 Adults 5.1 0.12 8 0.683 7 5.0 0.01 32 2.672 7 — — 0.000 31 -3.2 0.21 4 -0.211 8 -3.1 0.04 8 -0.411 8 -3.1 0.06 16 -0.813 8 -3.0 0.03 32 -1.621 8 -8.2 0.19 4 -0.544 8 -8.1 0.11 8 -1.075 8 -8.1 0.06 16 -2.149 8 -8.1 0.03 32 -4.299 7 -13.1 0.18 4 -0.875 8 -12.9 0.08 8 -1.720 8 -13.0 0.03 16 -3.472 7 -13.0 0.02 32 -6.933 8 -20.3 0.34 4 -1.353 8 -20.1 0.15 8 -2.676 8 -18.4 0.08 16 -4.899 8 -19.9 0.04 32 -10.597 8 weights (F 554 =0.02, P>0.99) of the crabs did not dif- fer significantly between treatments. Change in ju- venile crab body weight was estimated from initial and final measurements (32 d). Female crabs were randomly placed in 20 groups (including controls) in a complete 4 (temperature) by 5 (length of exposure) design, with 7 to 8 crabs per group. Treatment temperatures ranged from -3.1 to -20.3°C and exposure duration ranged from (controls) to 32 minutes (Table 1). Two additional groups were tested at 5°C for 8 and 32 minutes (Table 1). The crabs did not differ significantly in length (F 21U9 =1.13, P=0.324) or weight (P. 21 149 =1.36, P=0.149) between treatments. Exposure took place 16 and 17 February (about six days after capture). Observation continued through 22 June. Mortality and limb autotomy were monitored daily. Crabs were judged dead when scaphognathite move- ment stopped. Generally, dead crabs were rechecked the following day before they were removed from test tanks. The number of legs missing on each crab was counted and autotomized legs were removed from the tanks. Righting response (the time it took a crab to right itself when placed on its back underwater), which we considered to be a measure of vigor, was timed to the nearest 0.01 second immediately after aerial ex- posure and 1, 2, 4, 8, 16, 24, and 32 days thereafter. Crabs that could not right themselves after 2 min- utes were recorded as "not righting" and were placed upright in the tank. A subset of 40 female crabs randomly selected from the entire exposure range was used for reproductive observations. The crabs were isolated 32 days after exposure in covered 70-L tanks that overflowed into 19-L buckets containing conical 363-u mesh nets de- signed to trap zoeae. Flow rates were approximately 1.5 L/minute; 95% turnover time was 2.3 hours and water temperatures ranged from 5.2 to 5.9°C during this period (23 March-11 May). Feeding rates were measured before and after the zoeal hatch while the 40 ovigerous females were in- dividually isolated. Mussels, Mytilus trossulus, were fed ad libitum to crabs during each feeding period. Live mussels were cut in half and drained tissue- side down on paper towels for five minutes, weighed, then placed in the tanks. Twenty-four hours later the remaining food was removed, drained, and weighed as before. At each feeding, four food portions were placed as controls in tanks without crabs. Con- sumption was corrected for the mean weight changes in the control portions. Feeding observations were repeated every 1 to 3 days, from 41 to 60 and from 85 to 98 days after exposure. Zoeae were collected daily, rinsed from the nets, concentrated in a known volume, and subsampled with a 5- or 10-mL Hensen-Stemple pipette (Carls and O'Clair, 1990). Subsamples, which contained a minimum of 200 zoeae, were preserved in 5% forma- lin and counted later; the occasional large subsample was divided with a Folsom plankton splitter before being counted. After zoeal hatching, all debris from each tank bottom was preserved to determine the number of dead eggs and zoeae. Responses of the crabs were related to aerial ex- posure, expressed as the product of air temperature (°C) and length of time in air (hours), i.e. degree-hours (°h). In a similar experiment, Carls and O'Clair ( 1990) demonstrated the usefulness of this technique for interpreting responses to aerial exposure in adult king crabs, Paralithodes camtschaticus. Because the responses of the Tanner crabs to exposure (in °h) were similar in form to those of the king crabs over identi- Carls and O'Clair: Responses of Chionoecetes bairdi to cold air 47 cal treatment ranges (0-32 minutes, -20 to +5°C; see Results section) and could be described by the same types of simple linear or nonlinear models, we used the same technique here. Regression techniques and logit analysis were used to relate response variables to exposure (Berkson, 1957; BMDP, 1983). We compared median lethal re- sponses with log-likelihood ratio tests (Fujioka, 1986). Multiple regression was used to test for dif- ferences in the slopes of regression lines and to ad- just for covariates (Kleinbaum and Kupper, 1983). The relation of selected response variables to one another was tested with parametric correlation. Af- ter one-way analysis of variance, comparisons of treatment means were made with Tukey's or Dunnett's a posteriori multiple comparison tests and judged significantly different if P<0.05. Proportional data were arcsine transformed. Reported error ranges are ±95% confidence limits. Results Mortality Below -1 to -3 degree hours, exposure to cold air killed crabs. Almost all mortality occurred 1-2 days after exposure; in groups where more than half the crabs died, mortality always reached 50% within 2 days. Mortality was inversely related to exposure and increased rapidly below -l°h for juveniles and below -3°h for adults (logistic regressions [large P- values indicate good fits], P Juvenile =0.959, P adul =0.882; Fig. 2). Nearly all deaths occurred within 8 days af- ter exposure; no crabs died after day 16. For juve- niles, calculated median lethal exposures rose from -7.7 ± 3.4°h 1 day after exposure to -3.3 ± 0.8°h 16 days after exposure, and for adults from -7.2 ± 1.6°h to -4.3 ± 0.5°h over the same time period (Table 2). Righting response The speed with which crabs righted themselves when placed on their backs was inversely related to expo- sure (Fig. 3A). The response was most clearly de- scribed by the percentage of crabs not righting within two minutes (logistic regressions, P=0.799 [n=6] for juveniles; P=0.978 [ra=22] for adults; Fig. 3B). Per- centages of crabs not righting increased sharply be- low — 1.0°h for juveniles and below -2.2°h for adults, and crabs ceased righting entirely after exposure to <-4.0°h for juveniles and <-6.9°h for adults (Fig. 3B). Median exposures causing one-half the crabs to cease righting (EC50) were -1.2 ± 0.3°h for juveniles and -2.1 ± 0.3°h for adults, measured immediately after exposure; values declined to —1.6 ± 0.3°h for juve- niles and -3.8 ± 0.5°h for adults measured 32 days after exposure (Table 3). The percentage of crabs unable to right themselves immediately after expo- sure was significantly correlated with cumulative mortality (P Juvenile =0.003, r' venile = 0.91, n=6; P . „<0.001,r^7,=0.67,/i=22) and, therefore, could adult ' adult > serve as a predictor of death. Righting times tended to improve (decrease) dur- ing the first eight days after exposure, but this re- covery was generally not statistically significant. ^k *"^ N juveniles mortality o o \ \ \o \ Percent o \ ° \ ° \ 20- \ X ^ D adults \. □ x "s$2| 0- 1 ' 1 ' 1 ' 1 1 ' 1 -10 -8 -6 -4 -2 Degree- hours Figure 2 Cumulative percent mortality (P) of juvenile and adult female Chionoecetes bairdi, observed 32 days after emersion, as a function of exposure (°h): P /llMnifcj =100 / (1 + e< 3 74 + x 14x ° h) ), -P adu „=100 / (1 + e <6 42 + 1.48x°h)) 48 Fishery Bulletin 93(1), 1995 Righting times of juvenile crabs from all exposures tended to decrease over time (Fig. 4). The righting times of adult crabs exposed to <-2.2°h generally showed little evidence of recovery. Median exposures causing one-half the crabs to cease righting also gen- erally declined, but 95% confidence bars overlapped. Pereiopod autotomy Exposure to cold air caused pereiopod autotomy. Ju- venile pereiopod losses increased from to -2°h but declined towards the most severe exposure (-8°h), possibly because early mortality precluded autotomy (Fig. 5A). Juvenile crabs often dropped legs or chela during aerial exposure, but losses also continued af- ter exposure (Fig. 5B), often during ecdysis (Fig. 6). Adult crabs autotomized fewer pereiopods than ju- veniles; as with juveniles, loss was most frequent immediately after exposure. Loss of pereiopods in adults was directly related to severity of exposure (P<0.001, r 2 =0.85, n=19; Fig. 5A). Autotomy was cor- related with mortality in adult crabs (P<0.001, r 2 =0.81, n=19) but not in juveniles (P=0.621, r 2 =0.07, n=6). Autotomy was also correlated with the percent- age of adult crabs not righting as measured immedi- ately after exposure (P<0.001, r 2 =0.81, n=22). Ecdysis Juvenile crabs began molting 22 January and con- tinued through 21 February. Molt timing was not correlated with exposure (r 2 =0.09). Juveniles exposed 100- 80- — W-ii- \ juveniles \ B A 60 -I o\ o fa I 40- i i i \ 20- adults \ X I I V \ o- odcrofflso o o I 1 1 1 1 1 1 ' 1 ' 1 1 1 ' -10 8 Degree-hours Figure 3 Righting times of juvenile and adult female Chionoecetes bairdi capable of righting (A), and percentage not righting (B) observed 32 days after emersion as functions of exposure (°h). Percentages not righting were 100/(1 + e' 6235 + > 651 * ° h >) for adults and 100/(1 -h> (4701 * 2858 * ° h) ) for juveniles. Error bars are ±1 standard error. The ability of the single surviving -4.9°h adult crab improved over time; its righting time 32 days after exposure was similar to that of controls. Carls and O'Clair Responses of Chionoecetes bairdi to cold air 49 Table 2 Degree-hours caus ng death (LC) in Chionoecetes bairdi exposed to cold air, estimated with logit analysis. The LC number indicates the percentage of crabs affected e.g. LC50 is the median lethal degree-hours. The error term (CI) is the estimated 95% confidence interval. Day LC10 LC30 LC50 LC70 LC90 CI Juveniles 1 -0.9 -5.1 -7.7 -10.4 -14.6 3.4 2 -1.0 -4.6 -6.8 -9.0 -12.6 2.6 4 -1.3 -3.9 -5.5 -7.1 -9.7 1.7 8 -1.3 -2.9 -3.9 -4.8 -6.4 1.1 16 -1.3 -2.5 -3.3 -4.0 -5.2 0.8 32 -1.3 -2.5 -3.3 -4.0 -5.2 0.8 Adults 1 -3.1 -5.6 -7.2 -8.8 -11.3 1.6 2 -2.8 -5.2 -6.7 -8.2 -10.6 1.5 4 -2.6 -4.8 -6.2 -7.5 -9.7 1.3 8 -3.0 -4.0 -4.6 -5.1 -6.1 0.6 16 -3.2 -3.9 -4.3 -4.8 -5.5 0.5 32 -2.8 -3.8 -4.3 -4.9 -5.8 0.6 to cold air frequently lost pereiopods during ecdysis; losses increased from to — 4°h. The only crab ex- posed to -8°h that attempted to molt lost no limbs, but died during ecdysis (Fig. 6). Feeding rates Feeding rates of adult female Tanner crabs were sig- nificantly depressed by exposure to cold air (P ANOVA <0.001). In general, adult females exposed to <— 2.7°h (62% of the median lethal exposure) ate sig- nificantly less than did controls (Tukey test). Feed- ing rates measured shortly before zoeal hatching (41 to 60 days after exposure) were significantly less (P<0.05) for all crabs than feeding rates after zoeal hatching (85-98 days after exposure), but the slopes (feeding rate/exposure) before and after hatching did not differ (multivariate regression, P>0.50; Fig. 7). The frequency of feeding also increased significantly after zoeal hatching (P<0.001) and was significantly related to aerial exposure before and after larval hatching (P /mrar <0.001). The most severely treated crabs (-4.9°h) did not eat before zoeal release but ate 57% of the time after release. Weight change Change in weight of juvenile crabs was reduced by exposure to cold air. Wet weights of juvenile crabs that did not molt declined with increasing exposure severity (P=0.002, r 2 =0.42, n=20; Fig. 8). The weight Table 3 Effective degree-hours causing cessation of i -ighting (EC) in Chionoecetes bairdi exposed to cole air, estimated with logit analysis. The EC number indicates the percentage of crabs affected; EC50 is the median effective degree-hours. The error term (CI) is the estimated 95% confidence interval. Day EC10 EC30 EC50 EC70 EC90 CI Juveniles -0.2 -0.8 -1.2 -1.6 -2.2 0.3 1 -0.7 -1.2 -1.5 -1.7 -2.2 0.3 2 -0.6 -1.1 -1.5 -1.8 -2.3 0.3 4 -0.5 -1.1 -1.4 -1.7 -2.2 0.3 8 -1.1 -1.4 -1.7 -1.9 -2.3 0.3 16 -0.9 -1.3 -1.6 -1.9 -2.4 0.3 24 -0.8 -1.4 -1.7 -2.1 -2.6 0.3 32 -0.9 -1.3 -1.6 -1.9 -2.4 0.3 Adults -1.3 -1.8 -2.1 -2.5 -3.0 0.3 1 -2.0 -2.7 -3.1 -3.5 -4.1 0.4 2 -1.8 -2.4 -2.8 -3.2 -3.8 0.4 4 -2.3 -2.8 -3.1 -3.4 -3.9 0.4 8 -2.1 -2.7 -3.0 -3.4 -4.0 0.4 16 -2.2 -2.7 -3.1 -3.5 -4.0 0.4 24 -2.2 -2.9 -3.4 -3.8 -4.6 0.5 32 -2.4 -3.3 -3.8 -4.3 -5.1 0.5 increment of juvenile crabs that molted also declined with decreasing exposure (Fig. 8). This trend was not significant until an outlier at -2.0°h was removed (P=0.021, r 2 =0.56, n=9). Pereiopod autotomy prob- ably influenced these weight outcomes. The weight changes of juvenile crabs that did not molt were cor- related with righting response measured immedi- ately after exposure (P=0.018, r 2 =0.88, «=5, Y=a + bx 3 ). Changes in weight of adult crabs were not cor- related with exposure (P>0.07, r 2 =0.08, rc=44). Reproduction Exposure of ovigerous female crabs to cold air gen- erally did not affect the eggs or subsequently released zoeae unless the female died; all eggs died if the fe- male died. Timing of initial zoeal release (20 April ± 1 day), duration of release (11+1 day), and median release date (26 April ± 1 day) did not vary with ex- posure (r 2 =0.04, n=44; Fig. 9). Zoeae placed in sepa- rate containers for two days were not significantly affected by exposure prior to hatching (P=0.425, r 2 =0.02, «=43), and 87 ±3% continued swimming through the test period. Larval mortality, measured as the percentage of zoeae that sank to tank bottoms and died (0.4 ±0.2%), did not vary with exposure (^=0.03, n=44). Zoeal mortality (2 ±2%) during swim- ming tests was not correlated with exposure (r 2 =0.09). 50 Fishery Bulletin 93(1), 1995 The percentage of eggs that hatched may have been slightly affected by exposure, but our results were inconclusive (P„„ M „„„_ „„ =0.036, but P, . , regression:arcsin lack of ^•cO.OlO, and ^=0.10). The percentage of eggs hatch- ing in the -5.3°h treatment differed significantly from the control (Dunnett's test), but the difference was minor (99.1% versus 99.8% hatching). Egg extrusion may have been influenced by expo- sure, but the data were inconsistent. Elapsed time between larval hatching and subsequent egg extru- sion tended to be prolonged by exposure, but the re- sponse was variable (P Hnea =0.005, P lack O ^,=0.719, r 2 =0.19, rc=41). Egg extrusion generally occurred two days (median) after zoeal release but ranged from to 18 days; only crabs in the two most severe treat- ments (<—4.3°h) exceeded nine days. The date of ex- Juveniles Adults 60 50- 40- 30- 20 10 60 control Ji BDQ Q - T ^ I ' I ' I ' I - control I ' I I ' ' I ' 1 i ' i ' r 50 40 j§ 30- 20 10-1 60 -1.5 °h I ' I I ' I ' I I ' I ' I ' I ' I I ' I -2.0 °h 24 32 Days after exposure Figure 4 Righting times of juvenile and adult Chionoecetes bairdi as a function of time in days after emersion. Error bars are ±1 standard error. trusion (4 May ±7 days) may also have been changed by exposure, but again the statistical results were incon- elusive (P^ ar =0.011, P*^ ^=0.700, r^O.16, n=41). Exposure did not affect the percentage of Tanner crabs extruding eggs (93%, P linea =0.730, r^O.03, ra=6). Discussion Extreme exposure to cold air was lethal to Tanner crabs. It is also possible that thermal shock caused when the crabs were returned to water following expo- sure was also damaging. Following sublethal exposure, crabs exhibited a slowed righting response, autotomy of pereiopods, depressed feeding rates (adults), and weight loss or reduced weight gain (juveniles). Temperature and duration of treat- ment were both critical factors in de- termining how aerial exposure affected Tanner crabs. In a similar experiment with king crabs, the response of crabs to exposure was clearly observed when exposure was defined as the product of temperature and the length of exposure time (Carls and O'Clair, 1990). The use of this composite variable worked well with the current data set. However, our approach may not be generally appli- cable (for discussion see Carls and O'Clair, [1990]). Design of this experiment precluded independent analysis of temperature and time factors. However, either fac- tor may be predicted as a function of the other. For example, at -10°C, 10% of juvenile crabs may be killed by an 8- minute exposure, and 50% may be killed by a 20-minute exposure. Similarly, a 10-minute exposure would impair right- ing in 50% of juvenile crab at -7°C. Pre- dicted times and temperatures were calculated from degree-hours causing death (LC) or from effective degree-hours causing cessation of righting (EC) esti- mates (Tables 2 and 3); temperature multiplied by time (units are Celcius and hours) matched the LC or EC esti- mates. Predictions of adult and juvenile Tanner crab response are summarized in Figure 10 and Appendices. In our ex- ample (Fig. 10), short-term effects are predicted by ability to right immedi- ately after exposure; impaired crabs may be subject to increased predation at this time. Long-term effects are pre- -1.6 "h -2.2 "h Carls and O'Clair: Responses of Chionoecetes bairdi to cold air 51 &U- : A 40 -_ ,11 " Juveniles / 30 ~ / 20 ~ i 1 t 1 1 1 1 1 1 1 1 1 { ii 10 -j < i t i Adults \ 0- 1 ' 1 "" 1 i i B juveniles only -10 -8 -6 -4 Degree-hours -2 -2.0 °h -4.0 °h -1.5 °h -10 °h I ' I 24 Days after exposure 50 40 30 ■20 = -10 control l -1 — T 32 Figure 5 Percent of total pereiopod loss by juvenile and adult female Tanner crabs as a function of exposure I A) and as a function of time for juveniles (B). Error bars are ±1 standard error. dieted by mortality after exposure-induced death ceased. Mortality of adult Tanner crabs was significantly greater below -3°h and vigor was reduced below -2°h compared with control crabs. Exposures that are this severe probably occur infrequently on the fishing grounds except during winter in the north- ern Gulf of Alaska and the Bering Sea. Data are lacking on the time incidentally captured crabs remain on deck before being released, but dura- tion probably varies widely. Larger vessels employ- ing assembly-line techniques may process crabs more rapidly than do smaller vessels. Poor handling of culls combined with prolonged exposure may fur- ther reduce survival of incidentally caught crabs. Crabs captured incidentally during trawling are probably stressed more than those caught in pots. Stevens ( 1990) reported trawl tows ranging up to 6.4 hours and retention times of Tanner crabs up to 17 hours; the median lethal holding time for Tanner crabs was 8.3 hours. Net type influenced survival, and injuries were present in a greater pro- portion of dead than of live crabs (Stevens, 1990). 100- -e -4 Degree- hours Figure 6 Limb loss by juvenile Chionoecetes bairdi at ecdysis as a func- tion of exposure: percent loss=-8.856 + 4,756.960 e"° 629 * (0h * 10) . Error bars are ±1 standard error. Numbers molting in each group were 4, 4, 2, 6, 1, and 1 for controls through -8°h, re- spectively. 52 Fishery Bulletin 93(1). 1995 -2- T" -5 -4 ~ i ' r~ -3 -2 Degree hours Figure 7 Feeding rates (milligram food/gram crab weight/day) of adult female Chionoecetes bairdi before (F =4.556 + 1.071 pre x °h) and after (F pos ,=12.161 + 1.255 x °h) zoeal hatching as a functions of exposure (°h). Error bars indicate 95% CI. 100- 80- 60- S 40- 20 0- -20- did not molt -3 -2 Degree- hours Figure 8 Changes in wet weight of juvenile Chionoecetes bairdi as a function of exposure. Weights of crabs that molted versus those that did not were treated separately. Error bars are ±1 standard error. Mortality and injury due to aerial exposure have been reported for other commercially harvested de- capod crustaceans. For example, king crabs were af- fected by exposure to cold air, but were less sensitive than Tanner crabs (Carls and O'Clair, 1990). The western rock lobster, Panulirus cygnus, was signifi- cantly affected by >15 minutes exposure to warm air (27-35°C); recapture rates were lower than for un- exposed controls, and the probability of mortality due to predation rose (Brown and Caputi, 1983). We do not know what physiological mechanism(s) caused the abnormal events during ecdysis that of- ten resulted in death. O'Brien et al. (1986) induced apolysis (the separation of integumentary tissues from the exoskeleton during proecdysis) in several species of brachyurans by packing crabs in ice. Apolysis occurred within one hour in most cases and was not caused by death (O'Brien et al., 1986). O'Brien et al. (1986) did not observe ecdysis in their experimental crabs; therefore, the effect of apolysis on the timing, duration, and success of ecdysis in crabs is not known. In the present experiment, al- though mortality occurred during ecdysis in juvenile crabs, the timing of ecdysis was not affected. Evaporative water loss during exposure probably did not contribute significantly to the effects we ob- served. The fact that warmer exposures, such as the 32-minute exposure at +5°C, caused little or no ef- fect supports this supposition. Similar observations were made for king crab (Carls and O'Clair, 1990). In a study by Taylor and Whiteley (1989), the lob- ster Homarus gammarus vulgaris, which rarely comes in contact with air in its natural environment, was exposed to air at 15°C for up to 14 hours. Water loss, inferred from the constancy of most hemolymph ion concentrations, was minimal (Taylor and Whiteley, 1989). Oxygen delivered to H. gammarus tissues was substantially reduced, and C0 2 accumu- lated, but levels returned rapidly to normal after a 14-hour exposure. Lactate levels increased, but el- evation of bicarbonate ions increased the buffering capacity of the hemolymph. Because exposures did not exceed 32 minutes, it is unlikely that reduced oxygen directly caused Tanner crab mortality in our experiment. However, at low air temperatures, gills may have been damaged by frost, thus impairing respiratory gas, metabolite, and ion exchange after the crabs were returned to the water. The ability of crabs to right themselves proved to be a sensitive measure of crab viability. Righting response data collected immediately after exposure correlated strongly with less-immediate responses such as mor- tality and growth. Pereiopod loss also impaired righting. Pereiopod autotomy in adult crabs was a function of exposure. Mortality may have influenced the au- totomy response curve for juvenile crabs: during se- vere exposure, crabs apparently died before autotomy could take place. Aerial exposure reduced weight gain in juvenile crabs and caused weight loss in juveniles that did not molt. However, wet weights of the adult crabs (all anecdysial) did not vary with exposure. This ab- Carls and O'Clair: Responses of Chionoecetes bairdi to cold air 53 control 80- O 60- °to 40- \ O 20- cy* ° a* o - g^Nd 0- O 09B0 i i i i l i i 100- 80- 60- 40- 20- 100- 80- 60- 40- 20- o o o o -3.5 "h CK %°v o \ i i i I | i , , , 1 . i i I i i -I — I — I — r- -2.1 °h o - earoao BO T — I — I — I — I — I — I — I — I — I — I — I — I — I — I — I — T 100 ~r 110 r 120 T 130 100 1 I ' ' 110 T" 1 " 120 Julian day -4.3 "h -4.9 °h 130 Figure 9 Zoeal production (number of zoeae per gram female Chionoecetes bairdi) as a function of time. Curves were fit with smoothing techniques (4253HI (Velleman and Hoaglin, 1981). Units are in °h. sence of weight changes in the adults is puzzling because feeding rates were significantly depressed by exposure. Growth of adult western rock lobsters was reduced by exposure (Brown and Caputi, 1985). Body size, shape, and volume may be important factors in predicting crab response to cold-air expo- sure. Results of the present experiment support this hypothesis: smaller crabs (juveniles) were more sen- sitive to exposure than were larger crabs (adults). Additionally, adult Tanner crabs were more sensi- tive to exposure than were larger king crabs (Carls and O'Clair, 1990), but unknown interspecific fac- tors may have influenced this difference. An experi- ment involving a broad size range of conspecific in- dividuals is needed to test whether sensitivity to ex- posure is size-dependent in crabs. Surprisingly, aerial exposure did not measurably af- fect the developing larvae of exposed females unless the female died. Surviving crabs produced normal zoeae. Moreover, the timing of larval release, larval swimming ability, and viability were not affected by exposure. Longer-term larval responses, such as sur- vival past the first molt and zoeal growth, were not examined. Exposure may have reduced hatching suc- cess (by <1%) of the Tanner crab larvae and possibly may have affected the timing of egg extrusion, but these responses did not vary strongly. Schlieder (1980) re- ported a 13% reduction in hatching success in the stone crab, Menippe mercenaria, compared with controls when the crabs were exposed to air at 27-33°C for two hours. Hatching success was reduced further by a five- hour exposure and by autospasy (Schlieder, 1980). 54 Fishery Bulletin 93(1), 1995 In summary, although environmental conditions as severe as those tested are uncommon on the fish- ing grounds during fishing operations (except in the central and northern Bering Sea), low-temperature aerial exposure during fishing operations can ad- versely affect incidentally captured crabs. Exposure to cold air reduced crab vigor and feeding rates, caused limb autotomy, and killed the crabs in severe situations. Progeny died if exposure to cold air killed females brooding them, otherwise larvae were not measurably affected. Prompt return of incidentally caught Tanner crabs to the sea, especially during ex- tremely cold weather, should reduce adverse effects of exposure to cold air. Adults, Death ////I 50- II 40- / 30 ~. JJIJ 20 ~ yyy/J 90^^^/ 10- =*5?io-^'^ 'I""" 1 "! -30 -20 -10 -30 -20 -10 Temperature (Celcius) Temperature (Celcius) Figure 1 Predicted time in minutes required to cause death or impair righting of juvenile and ovigerous female Chionoeeetes bairdi following expo- sure to cold air. Mortality predictions are based on cumulative mor- tality through day 16; no deaths were observed in the ensuing 16 days. Righting predictions are based on responses immediately after exposure; there was a tendancy for righting times to improve after exposure, but improvements were generally not statistically significant. Acknowledgments We thank Tyrus Brouillette for his technical assistance during this experiment and the reviewers who im- proved this manuscript with their helpful suggestions. Literature cited Berkson, J. 1957. Tables for the maximum likelihood estimate of the logistic function. Biometrics 13:28-34. BMDP. 1983. Statistical software [1983 printing with additions], W. E. Dixon (ed.). Univ. Calif. Press, Berkeley, 735 p. Brown, R. S., and N. Caputi. 1983. Factors affecting the recapture of undersize western rock lobster Panulirus cygnus George returned by fish- ermen to the sea. Fish. Res. (Amst.) 2:103-128. 1985. Factors affecting the growth of undersize western rock lobster, Panulirus cygnus George, returned by fishermen to the sea. Fish. Bull. 83:567-574. Carls, M. G., and C. E. O'Clair. 1990. Influence of cold air exposures on ovigerous red king crabs (Paralithodes camtschatica) and Tanner crabs (Chionoeeetes bairdi) and their offspring. In Proc. int. symp. king and Tanner crabs, Nov. 1989, Anchorage, Alaska, p. 329- 343. Alaska Sea Grant College Program, Univ. Alaska, Fairbanks, AK 99775-5040. Fujioka, J. T. 1986 Log-likelihood ratio tests for comparing dose-response data fitted to the logistic function. U.S. Dep. Commer., NOAA Tech. Memo. NMFS F/NWC-96, 25 p. Kleinbaum, D. ('•., and L. L. Kupper. 1983. Applied regression analysis and other multivariable methods. Duxbury Press, Bos- ton, MA, 556 p. O'Brien, J. J., D. L. Mykles, and D. M. Skinner. 1986. Cold-induced apolysis in anecdysial brach- yurans. Biol. Bull. 171:450-460. Otto, Robert S. 1989. An overview of eastern Bering Sea king and Tanner crab fisheries. In Proc. int. symp. king and Tanner crabs, Nov. 1989, Anchorage, Alaska, p. 9-26. Alaska Sea Grant College Program, Univ. Alaska, Fairbanks AK 99775- 5040. Schlieder, R. A. 1980. Effects of desiccation and autospasy on egg hatching success in stone crab, Menippe mercenaria. Fish. Bull. 77:695-700. Stevens, B. G. 1990. Survival of king and Tanner crabs cap- tured by commercial sole trawls. Fish. Bull. 88:731-744. Taylor, E. W., and N. M. Whiteley. 1989. Oxygen transport and acid-base balance in the haemolymph of the lobster, Homarus gammarus, during aerial exposure and resubmersion. J. Exper. Biol. 144:417-436. Wilt-man, P. F., and D. C. Hoaglin. 1981. Applications, basics, and computing of exploratory data analysis. Duxbury Press, Boston, MA, 354 p. Carls and O'Clair: Responses of Chionoecetes bairdi to cold air 55 Appendix Table 1 Predicted time in minutes required to cause death of the listed percentage of adult Chionoecetes bairdi at indicated temperatures (°C). Calculations are based lethal responses (LC10, LC30, . . . LC90) estimated on day 16. Temperature -1.0 10% 189 30% 50% 233 260 70% 90% 288 332 Temperature 10% 30% 50% 70% 90% -16.0 12 15 16 18 21 -2.0 95 116 130 144 166 -17.0 11.1 13.7 15.3 16.9 19.5 -3.0 63 78 87 96 111 -18.0 10.5 12.9 14.5 16.0 18.4 -4.0 47 58 65 72 83 -19.0 9.9 12.3 13.7 15.2 17.5 -5.0 38 47 52 58 66 -20.0 9.5 11.6 13.0 14.4 16.6 -6.0 32 39 43 48 55 -21.0 9.0 11.1 12.4 13.7 15.8 -7.0 27 33 37 41 47 -22.0 8.6 10.6 11.8 13.1 15.1 -8.0 24 29 33 36 41 -23.0 8.2 10.1 11.3 12.5 14.4 -9.0 21 26 29 32 37 -24.0 7.9 9.7 10.9 12.0 13.8 -10.0 19 23 26 29 33 -25.0 7.6 9.3 10.4 11.5 13.3 -11.0 17 21 24 26 30 -26.0 7.3 9.0 10.0 11.1 12.8 -12.0 16 19 22 24 28 -27.0 7.0 8.6 9.6 10.7 12.3 -13.0 15 18 20 22 26 -28.0 6.8 8.3 9.3 10.3 11.9 -14.0 14 17 19 21 24 -29.0 6.5 8.0 9.0 9.9 11.4 -15.0 13 16 17 19 22 -30.0 6.3 7.8 8.7 9.6 11.1 Appendix Table 2 Predicted time in minutes required to cause death of the listed percentage of juvenile Chionoecetes baird i at indicated tempera- tures (°C). Calculations are based lethal responses (LC10, LC30 , . . . LC90) estimated on day 16. Temperature 10% 30% 50% 70% 90% Temperature 10% 30% 50% 70% 90% -1.0 81 152 196 241 311 -16.0 5.1 9.5 12.3 15.0 19.5 -2.0 41 76 98 120 156 -17.0 4.8 8.9 11.5 14.2 18.3 -3.0 27 51 65 80 104 -18.0 4.5 8.4 10.9 13.4 17.3 -4.0 20 38 49 60 78 -19.0 4.3 8.0 10.3 12.7 16.4 -5.0 16 30 39 48 62 -20.0 4.1 7.6 9.8 12.0 15.6 -6.0 14 25 33 40 52 -21.0 3.9 7.2 9.3 11.5 14.8 -7.0 12 22 28 34 44 -22.0 3.7 6.9 8.9 10.9 14.2 -8.0 10 19 25 30 39 -23.0 3.5 6.6 8.5 10.5 13.5 -9.0 9 17 22 27 35 -24.0 3.4 6.3 8.2 10.0 13.0 -10.0 8 15 20 24 31 -25.0 3.2 6.1 7.8 9.6 12.5 -11.0 7.4 13.8 17.8 21.9 28.3 -26.0 3.1 5.8 7.5 9.3 12.0 -12.0 6.8 12.7 16.4 20.1 26.0 -27.0 3.0 5.6 7.3 8.9 11.5 -13.0 6.2 11.7 15.1 18.5 24.0 -28.0 2.9 5.4 7.0 8.6 11.1 -14.0 5.8 10.8 14.0 17.2 22.2 -29.0 2.8 5.2 6.8 8.3 10.7 -15.0 5.4 10.1 13.1 16.0 20.8 -30.0 2.7 5.1 6.5 8.0 10.4 56 Fishery Bulletin 93(1). 1995 Appendix Table 3 Predicted time in minutes required to impair righting response of the listed percentage of adult Chionoecetes bairdi at indicated temperatures (°C). Calculations are based on righting responses (EC 10, EC30, . . . EC90) estimated immediately after exposure. Temperature 10% 30% 50% 70% 90% Temperature 10% 30% 50% 70% 90% -1.0 79 109 129 148 179 -16.0 4.9 6.8 8.0 9.3 11.2 -2.0 39 55 64 74 89 -17.0 4.6 6.4 7.6 8.7 10.5 -3.0 26 36 43 49 60 -18.0 4.4 6.1 7.2 8.2 9.9 -1.0 20 27 32 37 45 -19.0 4.1 5.8 6.8 7.8 9.4 -5.0 16 22 26 30 36 -20.0 3.9 5.5 6.4 7.4 8.9 -6.0 13 18 21 25 30 -21.0 3.7 5.2 6.1 7.0 8.5 -7.0 11 16 18 21 26 -22.0 3.6 5.0 5.9 6.7 8.1 -8.0 10 14 16 19 22 -23.0 3.4 4.8 5.6 6.4 7.8 -9.0 9 12 14 16 20 -24.0 3.3 4.6 5.4 6.2 7.5 -10.0 8 11 13 15 18 -25.0 3.1 4.4 5.1 5.9 7.2 -11.0 7.1 9.9 11.7 13.5 16.3 -26.0 3.0 4.2 5.0 5.7 6.9 -12.0 6.5 9.1 10.7 12.3 14.9 -27.0 2.9 4.0 4.8 5.5 6.6 -13.0 6.0 8.4 9.9 11.4 13.8 -28.0 2.8 3.9 4.6 5.3 6.4 -14.0 5.6 7.8 9.2 10.6 12.8 -29.0 2.7 3.8 4.4 5.1 6.2 -15.0 5.2 7.3 8.6 9.9 11.9 -30.0 2.6 3.6 4.3 4.9 6.0 Appendix Table 4 Predicted time in minutes required to impair righting response of the listed percentage of juvenile Chionoecetes bairdi at indi- cated temperatures (°C). Calculations are based on righting responses (EC 10, EC30, . . EC90) estimated immediately after exposure. Temperature 10% 30% 50% 70% 90% Temperature 10% 30% 50% 70% 90% -1.0 13 49 71 93 129 -16.0 0.83 3.05 4.45 5.84 8.07 -2.0 7 24 36 47 65 -17.0 0.78 2.87 4.19 5.50 7.59 -3.0 4 16 24 31 43 -18.0 0.74 2.71 3.95 5.19 7.17 -4.0 3.3 12.2 17.8 23.4 32.3 -19.0 0.70 2.57 3.75 4.92 6.79 -5.0 2.7 9.8 14.2 18.7 25.8 -20.0 0.66 2.44 3.56 4.67 6.45 -6.0 2.2 8.1 11.9 15.6 21.5 -21.0 0.63 2.33 3.39 4.45 6.15 -7.0 1.9 7.0 10.2 13.4 18.4 -22.0 0.60 2.22 3.23 4.25 5.87 -8.0 1.7 6.1 8.9 11.7 16.1 -23.0 0.58 2.12 3.09 4.06 5.61 -9.0 1.5 5.4 7.9 10.4 14.3 -24.0 0.55 2.04 2.97 3.90 5.38 -10.0 1.3 4.9 7.1 9.3 12.9 -25.0 0.53 1.95 2.85 3.74 5.16 -11.0 1.2 4.4 6.5 8.5 11.7 -26.0 0.51 1.88 2.74 3.60 4.96 -12.0 1.1 4.1 5.9 7.8 10.8 -27.0 0.49 1.81 2.64 3.46 4.78 -13.0 1.0 3.8 5.5 7.2 9.9 -28.0 0.47 1.74 2.54 3.34 4.61 -14.0 0.9 3.5 5.1 6.7 9.2 -29.0 0.46 1.68 2.45 3.22 4.45 -15.0 0.88 3.26 4.74 6.23 8.60 -30.0 0.44 1.63 2.37 3.12 4.30 Abstract. The Atlantic sharpnose shark, Rhizoprionodon terraenovae, is a small coastal spe- cies caught in recreational fisher- ies and as bycatch in the shrimp trawl and longline fisheries in the Gulf of Mexico. Demographic analyses incorporating the best available information on validated age and growth, age at maturity (t mat ), maximum age (t max ), repro- ductive habits, and age-specific natural mortality and fecundity were performed. An initial set of three life history tables based on input parameters t ma =4, t max =10, constant age 1+ survivorship (S=0.657), and varying first year survivorship (S o =0.432, scenario 1; S o =0.512, scenario 2; S o =0.657, sce- nario 3 or best case scenario) yielded net reproductive rates (i? ) ranging from 0.844 to 1.284, a gen- eration length (G) of 5.8 years, and instantaneous rates of population change (r) ranging from -0.029 to 0.044. Further simulations were performed to test the sensitivity of the computed demographic param- eter values to modifications in vari- ous input biological parameter val- ues (scenarios 4 through 14). Over- all, manipulations of biological pa- rameters m x , t maV and t max caused large variations in demographic parameters r, < x2 , and R , while G remained relatively stable. All the demographic parameters proved more sensitive to changes in S than to changes in S . The initial set of analyses (scenarios 1 through 3) was then rerun with the estimated mean fishing mortality from 1986 to 1989 (F=0.428) added to natu- ral mortality. Age 6+ sharks can enter the fishery under the best case scenario only to allow the population to replace itself. Ages at first capture (A rep ) with F=0.428 that would allow full population replacement were also calculated for scenarios 4 through 14. This study indicates that management of R. terraenovae under the Federal Management Plan (FMP) for sharks of the Atlantic Ocean is based on unrealistic biological characteristics for this species. Demographic analysis of the Atlantic sharpnose shark, Rhizoprionodon terraenovae, in the Gulf of Mexico Enric Cortes Center for Shark Research Mote Marine Laboratory 1600 Thompson Parkway, Sarasota. Florida 34236 Manuscript accepted 31 May 1994. Fishery Bulletin 93:57-66 (1995). The Atlantic sharpnose shark, Rhi- zoprionodon terraenovae, is an abundant coastal carcharhinid spe- cies found in shelf waters of the western North Atlantic and Gulf of Mexico (Compagno, 1984), reported to reach a maximum size of approxi- mately 110 cm total length (Com- pagno, 1984 1. Although not targeted by any U.S. commercial fisheries, in the Gulf of Mexico it is caught in recreational fisheries and discarded as bycatch in the shrimp trawl fish- ery (NMFS, 1993) and shark and reef fish longline fisheries (person, obs. ). However, age at first entry in the various fisheries is unknown. R. terraenovae is grouped under the "small coastal" species category in the Federal Management Plan (FMP) for sharks of the Atlantic Ocean, which determined that this species group was not overfished, based on a stock assessment resulting in an estimate of finite rate of population increase (e r ) of 1.91. Thus, no quotas or size limits exist for this species despite its importance in several fisheries. Biological and life history charac- teristics of R. terraenovae in the Gulf of Mexico are now well docu- mented (Parsons, 1983, 1985; Branstetter, 1986, 1987). However, this information has not yet been applied to analyses of the popula- tion dynamics of this species, nor have the results of such analyses been published. Furthermore, as is the case with most shark species, sufficient information necessary for stock assessment is lacking (Hoff, 1990). Because long-term records of catch and effort or the age composi- tion by species are not available, traditional surplus production mod- els or more elaborate age-structured methods of stock assessment have seldom been used for sharks. Ow- ing to the paucity of fisheries data, several investigators have used de- mographic analysis to gain insight into the population dynamics and exploitation rates of shark re- sources. This type of analysis has been utilized to construct life his- tory tables or Leslie matrices (Caughley, 1977; Krebs, 1985), which are summaries of age-specific mortality and fertility rates operat- ing on a population with the as- sumption of a stable age distribu- tion. This technique allows estima- tion of parameters important to the dynamics of any given population. Thus, Hoenig and Gruber (1990), Cailliet (1992), and Cailliet et al. ( 1992) produced estimates of popula- tion dynamics by applying a demo- graphic analysis of the lemon shark, Negaprion brevirostris, the leopard shark, Triakis semifasciata, and the angel shark, Squat ina californica, respectively. Hoff ( 1990), in addition, estimated maximum sustainable yield for the sandbar shark, Car- charhinus plumbeus, in a modified stock production model incorporat- ing life history information. 57 58 Fishery Bulletin 93(1), 1995 This study was prompted by the existence of vali- dated age and growth data (Branstetter and McEachran, 1986) and reproductive information (Parsons, 1983) on R. terraenovae, which provided several important parameters needed for construc- tion of a life history table, i.e. lifespan, fecundity, and age at maturity. The purpose of this study was 1) to produce, using the life history table approach and the best biologi- cal information available, reliable estimates of de- mographic parameters fori?, terraenovae in the Gulf of Mexico, 2) to assess the sensitivity of the computed demographic parameters of the population to a vari- ety of biological (input) parameter manipulations and harvest scenarios, and 3) to compare the resultant rates of population increase with that calculated for the "small coastal" shark group in the FMP for sharks of the Atlantic Ocean and to evaluate the biological basis of the stock assessment on which present man- agement measures are based. The instantaneous natural mortality rate (M) was calculated from Hoenig's (1983) equation relating maximum age to total mortality rate, derived from data pertaining to unexploited or lightly exploited stocks. A value of 0.42 for Z (instantaneous total mortality rate) was derived from the regression equa- tion ln(Z) = 1.46 - 1.01 in(t max ), where t max is longev- ity in years. Assuming that maximum age was de- termined from a time when there was no fishing di- rected at this species, Z can be approximated to M. The proportion of survivors at the start of each age interval (x) was l x = N (e~ Mx ), where 7V o is the num- ber of individuals at time 0. Demographic parameters were computed follow- ing methodology by Krebs ( 1985 ) and included R o (net reproductive rate per generation), G (generation length in years), and r (intrinsic rate of population change). All the values of r reported in this study were refined by using the Euler equation (Wilson and Bossert, 1971; Krebs, 1985): l r m r = 1. Materials and methods Life history tables incorporating the best biological information available on R. terraenovae in the Gulf of Mexico were constructed. Maximum age (lifespan or longevity; t max ) has been estimated to be 8 to 10 years (Branstetter, 1987), and age at maturity (t .) for females has been estimated at 4 years (Bran- stetter, 1987), and from 2.4 to 3.9 years (Parsons, 1985). For this study, it was assumed that all females reproduced after reaching maturity. Parsons (1983) reported that parturition was annual, gestation pe- riod was 10 to 11 months, and sex ratios at birth were 1:1. He also found a significant relationship between total length of gravid females and number of offspring produced. Fecundity at size was calcu- lated from the regression equation Y = -8.4109 + 0.1396X (r=0.50,P<0.001,n=78; Parsons 1 ), where X is female total length and Y is number of offspring. Female length at age was obtained from the von Bertalanffy growth function for both sexes combined derived by Branstetter ( 1987): L t =Lj 1-e -*«-*>>), where #=0.359, L x =108, and f o =-0.985. Number of offspring was further divided by two, because the natality func- tion (m x ) at age represents the number of female off- spring per female parent and sex ratios at birth are 1:1 and parturition is annual (Parsons, 1983). Reports of unusually large litter sizes in tropical populations of R. terraenovae were also incorporated in some of the analyses that follow by doubling fecundity at age (m ). *=o The finite or annual rate of change (e r ) was then calculated from the refined values of r. In addition, the theoretical population doubling or halving time in years « x2 ) assuming a stable age distribution was com- puted as (In 2)/r or (In 0.5)/r, respectively (Krebs, 1985). The initial set of analyses, consisting of three differ- ent scenarios, was run by using the most reliable input biological parameters: t =10, t mat =A, m r =baseline age- specific natality, and S=0.657. In scenario 1, first year natural mortality was arbitrarily doubled (M=0.42 x 2=0.84) or S o =0.432. In scenario 2, a value of S o =0.512 was obtained from the Leslie matrix algorithm by as- suming an equilibrium (or stationary) population (Vaughan and Saila, 1976). Thus, the following equa- tion was solved for S o after assuming r=0: i-i i=i ("•*!«■*) ll S J 7 = 1 1 Parsons, G. Univ. Mississippi, MI 38677. Personal commun.. 1993. where m is fecundity at age, I is the oldest age group in the population ( 10 years), and S ; is survival from age j to y+l. In scenario 3, (referred to as the best case scenario), S was assumed to be equal to survivor- ship in the following years (S o =S=0.657=e-° 42 ). For this best case scenario, the stable age distribution (C^) was calculated according to Krebs ( 1985) and plotted. In a second set of analyses, the input biological or life history parameters (t .,t ,m,S,S) were var- J r mat 1 max 1 x 1 ' o ied to test the sensitivity of the resultant demographic parameters (R , G, r, and t K2 ). These sensitivity analy- ses measured the percentage change of the output de- Cortes: Demographic analysis of Rhizoprionodon terraenovae 59 mographic parameter of interest relative to the best case scenario. In the case of ^ x2 , sensitivity was assessed by calculating a multiplication factor that measures the number of times the population doubling time changes relative to the best case scenario (example: if ^=15.7 in the best case scenario and 4.1 in the altered state, then the multiplication factor [mf]=15. 7/4. 1=3.8, i.e. t^ has been shortened 3.8 times in the altered state). Based on the results from the initial set of analy- ses (scenarios 1 through 3), the existing knowledge of life history traits in R. terraenovae, and the re- sults from the FMP (e r =1.91), input parameter val- ues were manipulated in the direction that would be favorable to population increase and should thus be regarded as optimistic scenarios. The following varia- tions, relative to the best case scenario, were applied: doubling m x (m x =2; scenario 4); reducing t nmt by 1 year (t mat =3; scenario 5) and by 2 years (t mat =2; sce- nario 6); reducing t mat by 1 year and doubling m x (t mat =3, m x =2; scenario 7); reducing t mat by 2 years and doubling m x (t mat -2, m x =2; scenario 8); increas- ing S by 10% (S o =0.723; scenario 9) and by up to 50% (°S o =0.985; scenario 10); increasing S by 10% (S=0.72°3; scenario 11) and by up to 50% (S=0.985; scenario 12); doubling t fuax (t max =20 [note that S and S will also vary, since they depend on t max \; scenario 13); and an extreme manipulation that was under- taken to approximate the FMP value of e r =1.91 (equivalent to an r of 0.647), where t mat was reduced by 1 year, m x was doubled, and S and S o set at 95% (t ,=3, m =2, S=S =0.95; scenario 14). mat ' x ' o ' A third set of simulations was run incorporating the estimated mean instantaneous fishing mortal- ity rate from 1986 to 1989 (F=0A28), as used in the stock assessment of small coastal species (Parrack 2 ) on which the FMP for sharks of the Atlantic Ocean is based, to demonstrate the effect of exploitation and various age-at-first-entry scenarios. Fishing mortal- ity (F) was added to natural mortality (M) in the survivorship function l x = N Q (e~ [M+F]x ), with F initially starting at age 0, then sequentially up to age 9. A rep , the minimum age at which individuals can first enter the fishery and still allow the population to replace it- self (r>0) was calculated by noting the age at which the intrinsic rate of increase (r) becomes zero or positive. These simulations were run first under scenarios 1 through 3, and then under scenarios 4 through 14. Results The initial set of life history tables yielded net re- productive rates per generation (R ), ranging from 0.844 to 1.284, a generation length (G) of 5.8 years, and intrinsic rates of population change (r), ranging from -0.029 to 0.044 (Table 1 ) depending on the value of first year survivorship (S ) used. In scenario 1 (S =0.432), the results indicated that the population would decrease at a rate of 2.9% per year and would halve about every 24 years. Halving times are indi- cated by negative values in the t x2 column. In sce- nario 2 (S =0.512), r is equal to by definition. Un- der the best case scenario (scenario 3; S =0.657), the 2 Parrack, M. L. 1990. A preliminary study of shark exploi- tation during 1986-1989 in the U.S. FCZ. Contrib. MIA- 90-493, NOAA, NMFS, SEFC, Miami, FL 33149, 23 p. Table 1 Simulations of the Gulf of Mexico population of the Atlantic sharpnose shark, Rhizoprionodon terraenovae, under three scenarios that use input parameter values representing the best biological information available. Only natural mortality is included in these analyses. First year survival rates (S ) were obtained as follows: S o =0.432 (scenario 1 ) was obtained by doubling the natural mortality value computed from Hoenig's ( 1983) relationship between mortality rate and maximum age; S o =0.512 (scenario 2) was computed from the Leslie matrix algorithm (see text) assuming an equilibrium population (Vaughan and Saila, 1976). The third line (in italics) represents the best case scenario (scenario 3; S o =S=0.657). Input parameter values' Computed parameter values 2 Scenario 'mat t max m x s s a Ro G r e r **2 1 4 10 \ 3 0.657 0.432 0.844 5.762 -0.029 0.971 -23.9 2 4 10 1 0.657 0.512 1.000 5.762 0. 1.000 — 3 4 10 1 0.657 0.657 1.284 5.762 0.044 1.045 15.7 1 'ma; =a e e at maturity; f mal =maximum age; m .^age-specific natality; S=survivorship after the first year of life; S o =survivorship for the first year of life. 2 fl =net reproductive rate per generation; G=generation length, in years; r=intrinsic rate of population change refined through the Euler equation (see text); e r =finite rate of population change; ^^theoretical doubling (positive values) or halving ( negative values) time in years assuming a stable age distribution. 3 "1" indicates baseline age-specific natality. 60 Fishery Bulletin 93(1), 1995 population increased at 4.5% per year and doubled about every 16 years. The predicted stable age distribution (Cj for the best case scenario (Fig. 1) suggested that about 80% of the population was composed of immature indi- viduals. Because of the lack of data on sizes and ages at first capture in the recreational and commercial 2 3 4 5 6 7 8 Age Class ( years ) Figure 1 Predicted stable age distribution of the Atlantic sharpnose shark, Rhizoprionodon terraenovae , under the best case scenario presented in Table 1, assuming geometric growth (with r=0.044) and constant age-specific mortality and fer- tility rates. fisheries, the actual proportion of the population sub- ject to fishing is unknown. Likewise, no size or age com- position of this population is available from surveys, precluding any comparisons with the theoretical C . Results of the sensitivity analyses indicated that doubling age-specific natality, m x , had a distinct ef- fect (a 286% increase) on the population's rate of in- crease, r (scenario 4), and would allow the popula- tion to double in only 4.1 years or 3.8 times faster than in the best case scenario (Table 2). Generation length, G, remained the same, while net reproductive rate per generation, R o , increased 100% (Table 3). Decreasing age at maturity, t mat , by one year (sce- nario 5) produced a smaller change in r, t x2 , and R o (Tables 2 and 3) than doubling m x , but decreased G by 12% (Table 3). Further decreasing t mat by another year (scenario 6) produced almost the same values of r and t x2 as those obtained in scenario 4 (Table 2), although R o increased only 5% and G decreased by 20%. The combined effect of decreasing t mat and dou- bling m x together (scenarios 7 and 8) produced in- creases in r up to near 700% and t x2 values up to 8 times shorter than in the best case scenario (Table 2). Under scenarios 7 and 8, R o also increased by up to more than 200%, while G decreased by up to 20%. Increasing first year survivorship, S o , by 10% (sce- nario 9) yielded a value of r 39% higher and a value of t x2 1.4 times shorter than in the best case scenario (Table 2), affected R o very little (a 10% increase only), and had no effect on G (Table 3). A further increase Table 2 Simulations of the Gulf of Mexico population of Rhizoprionodon terraenovae to test the sensitivity of computed population rate of increase and doubling time to input biological parameter values. Input val jes were manipulated in scenarios 4 through 14; the best case scenario (BC; top row) is shown in italics to facilitate comparison All other symbols are as defined in Table 1. Scenario Input parameter values Computed parameter values t mal t max m x S So r % change of r 1 «x2 mP BC 4 10 1 0.657 0.657 0.044 15.7 4 4 10 2 3 0.657 0.657 0.170 286 4.1 3.8 5 3 10 1 0.657 0.657 0.111 152 6.2 2.5 6 2 10 1 0.657 0.657 0.168 282 4.1 3.8 7 3 10 2 0.657 0.657 0.265 502 2.6 6.0 8 2 10 2 0.657 0.657 0.356 709 1.9 8.3 9 4 10 1 0.657 0.723 0.061 39 11.4 1.4 10 4 10 1 0.657 0.985 0.117 166 5.9 2.7 11 4 10 1 0.723 0.657 0.123 179 5.6 2.8 12 4 10 1 0.985 0.657 0.378 759 1.8 8.7 13 4 20 1 0.811 0.658 0.228 418 3.0 5.2 14 3 10 2 0.950 0.950 0.634 1,341 1.1 14.3 ; % change of r relative to the best case scenario 2 Multiplication factor indicating the number of times t^ has been shortened relative to the best case scenario 3 "2" indicates baseline age -specific natality values have been doubled. Cortes: Demographic analysis of Rhizopnonodon terraenovae 61 Table 3 Simulations of the Gulf of Mexico population of Rh zoprionodon terraenovae to test the sensitivity of computed net reproductive rate per generation and generat on len gth to input biological parameter values Input values were manipulated in scenarios 4 through 14 the best case scenario (BC top row) is shown in italics to facilitate comparison. All other symbols are as defined in Table 1. Scenario Input parameter values Computed parameter values *mul t max m , S So «o % change of R o ' G % change of G' BC 4 10 1 0.657 0.657 1.28 5.76 — 4 4 10 2 2 0.657 0.657 2.57 100 5.76 5 3 10 1 0.657 0.657 1.72 34 5.06 -12 6 2 10 1 0.657 0.657 1.34 5 4.58 -20 7 3 10 2 0.657 0.657 3.43 168 5.06 -12 8 2 10 2 0.657 0.657 4.08 219 4.58 -20 9 4 10 1 0.657 0.723 1.41 10 5.76 10 4 10 1 0.657 0.985 1.92 50 5.76 11 4 10 1 0.723 0.657 2.05 60 6.06 5 12 4 10 1 0.985 0.657 11.66 809 7.20 25 13 4 20 1 0.811 0.658 4.99 290 8.30 44 14 3 10 2 0.950 0.950 29.6 2,212 6.7 16.3 ' % change of R and G relative to the best case scenario. 2 "2" indicates baseline age-spec fie natality values have been doubled. in S up to 50% (scenario 10) had a more distinct effect on r (166% increase), t x2 (2.7 times shorter), and R (50% increase), but did not affect G (Tables 2 and 3). Increasing age 1+ survivorship (S) by 10% (scenario 11) had a similar effect on all the demo- graphic parameters to increasing S o by 50% (scenario 10; Tables 2 and 3), whereas increasing S by 50% (scenario 12) had a very profound effect on all the demographic parameters, increasing r by 759%, shortening t x2 by almost 9 times (similar to scenario 8), increasing R o by over 800% and lengthening G by 25% (Tables 2 and 3). Doubling longevity (t max ) to 20 years (scenario 13) also markedly affected r (418% increase), t x2 (5 times shorter), and R o (290% increase), and produced the largest value of G (8.3 or a 44% increase) in all sce- narios (Tables 2 and 3). Finally, the extreme manipulations of scenario 14 (reducing t mat to 3 years, doubling m x , increasing S and S o to 95%, with a t max of 10 years) produced a 13- fold increase in r, a value of t x2 more than 14 times shorter, a 22-fold increase in R o and only a 16.3% increase in G (Tables 2 and 3). For all simulations, population doubling time (t x2 ) was lessened and generation length (G) was the de- mographic parameter less sensitive to changes in input biological parameter values. With the estimated mean fishing mortality from 1986 to 1989 (F=0.428) added to natural mortality starting at each age interval from 9 to 0, R Q and r were progressively reduced as F was progressively started closer to age-0 (Table 4). In scenarios 1 (S o =0.432) and 2 (S o =0.512), r was always negative and became increasingly so as simulated fishing started earlier in the life of R. terraenovae. Only by using best case scenario (scenario 3) values could the population be made to replace itself or grow by ma- nipulating age at first capture. When fishing pres- sure was applied between 6 and 5 years of age or about 97 cm total length (TL) the population was able to replace itself. Generation length remained the same under the three scenarios but progressively decreased as fishing mortality included progressively earlier ages. Theoretical halving time also progres- sively shortened as fishing started at younger ages, whereas in the best case scenario doubling time in- creased as age at first capture dropped from 9 to 6 years. The effect of added fishing mortality on survivor- ship can be identified as a progressive decrease in percentage survival as fishing starts progressively earlier in the lifespan of the shark (Fig. 2). Age-spe- cific reproduction also decreases significantly as fish- ing mortality is applied at progressively earlier ages (Fig. 3). When the estimated mean fishing mortality from 1986 to 1989 (F=0.428) was added to natural mor- tality in scenarios 4 through 14 (Table 5), A , the earliest age at which sharks can first be captured to 62 Fishery Bulletin 93(1), 1995 3 4 5 6 7 Age Class ( years ) Figure 2 Survivorship curves for Rhizoprionodon terraenovae un- der the survival conditions presented in Table 1 for the best case scenario (S=S =0.657) and fishing mortality as in Table 4 (F=0.428), starting at three different ages (1, 5, and 8 years). 3 4 5 6 7 Age Class ( years ) Figure 3 Age-specific reproduction for Rhizoprionodon terraenovae under the survival conditions presented in Table 1 for the best case scenario (S=S o =0.657) and fishing mortality as in Table 4 (F=0A28), starting at three different ages (1, 5, and 8 years). Table 4 Simulations of the Gulf of Mexico population of Rhizoprionodon terraenovae under the three same scenarios as in Table 1 but with estimatec mean fishing mortality from 1986 to 1989 (F=0.428 [Parrack 2 ]) added to natural mortality starting at different ages. All symbols are as defined in Table 1. Computations based on the following first year survival rates: scenario 1 (S =0.432); scenario 2 (S = 0.512); and scenario 3 (best case S o =0.657) Age at first capture Demographic parameter 9 8 7 6 5 4 3 2 1 Scenario 1 R 0.83 0.81 0.77 0.71 0.62 0.49 0.32 0.21 0.14 0.09 G 5.70 5.60 5.45 5.27 5.06 4.86 4.86 4.86 4.86 4.86 r -0.03 -0.04 -0.05 -0.07 -0.09 -0.14 -0.23 -0.31 -0.38 -0.46 e r 0.97 0.96 0.95 0.94 0.91 0.87 0.80 0.74 0.68 0.63 'x2 -21.7 -18.2 -14.4 -10.7 -7.4 -4.9 -3.1 -2.3 -1.8 -1.5 Scenario 2 R 0.99 0.96 0.91 0.84 0.73 0.58 0.38 0.25 0.16 0.10 G 5.71 5.60 5.45 5.27 5.06 4.86 4.86 4.86 4.86 4.86 r -0.00 -0.01 -0.02 -0.03 -0.06 -0.11 -0.19 -0.27 -0.35 -0.43 e r 1.00 0.99 0.98 0.97 0.94 0.90 0.82 0.76 0.70 0.65 0). 2 "2" indicates baseline age-specific natality values have been doubled. allow for full population replacement (r >0) given the fishing mortality, became progressively smaller as the value of r increased (see Table 2 for reference). Increasing S by 10% (scenario 9) allowed for an age at first capture of 5 years, while doubling m x (sce- nario 4), reducing t t to 3 years of age (scenario 5), increasing S by 50% (scenario 10), or increasing S by 10% (scenario 11) all had the same effect of allow- ing for an age at first capture of 4 years (90 cm TL) compared with 6 years (99 cm TL) under the best case scenario. Reducing t by 2 years (scenario 6) or increasing £ to 20 years (scenario 13) both al- lowed for an A of 3 years (82 cm TL), while reduc- ing t mat by 1 year and doubling m x (scenario 7) al- lowed an A of 2 years. Under the most extreme manipulations, which included reducing t mat by 2 years and doubling m x (scenario 8), increasing S by 50% (scenario 12), and reducing t mat to 3 years, dou- bling m x , and setting S and S o at 95% (scenario 14), an age at first capture of 1 year (55 cm TL; scenarios 8 and 12) and of years (32 cm TL) could be applied in a given year. Discussion These demographic analyses using the best available information indicate that the Gulf of Mexico popula- tion ofR. terraenovae may be very vulnerable to fish- ing pressure. Results showed that, based on known life history parameters, the population's intrinsic rate of increase was, at best, only r=0.044, equating to a finite rate of e r =1.045, which is much lower than the rate estimated for "small coastal" species in the stock assessment used to develop the FMP for sharks of the Atlantic Ocean (e r =1.91). Furthermore, compa- rable rates to the FMP values were only obtained after extreme manipulations of the input life history parameters, which diverged too widely from observed life history parameters to be realistic. For example, one of the possible scenarios that would yield an es- timate of e r of 1.91 implies that age at maturity has to be decreased from 4 to 3 years, fertility doubled, and survivorship increased by almost 50% relative to the most optimistic initial scenario, i.e. the best case scenario, resulting in estimates of 29.6 for R o , 6.7 for G, and 1.1 for t x2 . This means that, in the absence of fishing, the population would almost double every year. Rhizoprionodon terraenovae is the main species caught in the Texas recreational shark fishery and is also caught by the headboat and other recreational fisheries in the Gulf of Mexico. More importantly, it represents a significant bycatch in the shrimp trawl fishery operating in the Gulf of Mexico and to a lesser extent in the longline reef fish and shark fisheries, and in the gillnet fishery in the same area. The lack of data on the age and size at which individuals of R. 64 Fishery Bulletin 93(1). 1995 terraenovae first enter these fisheries, as well as the relative proportions of each age and size group rep- resented, preclude a more detailed analysis at this time. However, the demographic analysis represent- ing the best case scenario indicated that under the present fishing level R. terraenovae should not enter the fishery until individuals reach about 97 cm TL or almost 6 years of age if the population was managed to just replace itself. There is evidence that smaller ani- mals are being caught in the various fisheries, but the proportions of each age class are unknown. The biological parameters incorporated in sce- narios 1 through 3 represent the best, most reliable information available. Data on age and growth were taken from a tetracycline-validated laboratory study (Branstetter, 1987) which indicated that females mature entering their fifth year of life (age-4) and that maximum age is between 8 and 10 years. In another study (Parsons, 1985), female maturity was estimated at between 2.4 to 3.9 years. However, this study used only males and mean lengths for age classes, which, as pointed out by Branstetter (1987), affected the von Bertalanffy parameters. The possi- bility of earlier female age at maturity and even longer lifespan was incorporated in several of the demographic analyses (scenarios 5, 6, 7, 8, 13, and 14), which evidently yielded more liberal results on which more risk-prone management decisions could be based. The unpublished information on fertility at age was derived from a study on the reproductive biology of R. terraenovae (Parsons, 1983) and relates female to- tal length to number of uterine eggs or embryos for 78 specimens. Parsons ( 1983) also noted that tropical popu- lations of R. terraenovae had been reported to have as many as 12 embryos. This possibility was taken into account by doubling fertility at age in several analyses (scenarios 4, 7, 8, and 14), which again produced more optimistic estimates of population parameters. The age, growth, and reproduction information used in this study was based on animals collected in the northern central and western Gulf of Mexico. The extent to which this information is applicable to the entire population or whether there are different stocks in the Gulf with different age, growth, and reproductive capabilities is not known. For example, I recently examined an 82-cm-TL pregnant female with 3 embryos, measurements which fit nicely the regression equation of Parsons (1983), but which would result in a back-calculated age of 3 years with the von Bertalanffy growth function, although the female could have been older, e.g. age 4, owing to variability in size at age, which is not uncommon in sharks (Kusher et al., 1992, and references therein). The most important and also the most difficult parameter to estimate is natural mortality (M). The value of M used in this study was taken from Hoenig's ( 1983) relationship between longevity and total mor- tality for virgin or lightly exploited stocks. The as- sumption that Z could be approximated to M, or that no fishing mortality occurred during the period for which growth parameters for this species were de- rived, may have been violated. However, the possi- bility of lower natural mortality values was incorpo- rated in several analyses (scenarios 9 through 14). While Hoenig's equation represents a shortcut and obvious simplification of reality, the lack of catch and effort data, or age or size composition for stocks of this species precludes calculation of any other esti- mates of M at this time. Lack or inappropriateness of both fishery and biological data may explain why several other researchers have used the same ap- proach to estimate natural mortality in shark popu- lation studies. Except for age-0 Negaprion brevir- ostris (Manire and Gruber, 1993), no actual age-spe- cific estimates of natural mortality are available for any shark species. The value derived for M (0.42) in this study is equivalent to an annual survivorship of 0.66, which is low when compared with survival estimates for other species of sharks. Values derived from Hoenig's (1983) regression equation include 0.82 for the an- gel shark, Squatina californica, (Cailliet et al., 1992); 0.85 for N. brevirostris (Hoenig and Gruber, 1990); 0.87 for Triakis semifasciata (Smith and Abramson, 1990; Cailliet, 1992); and 0.90 for Carcharhinus plumbeus (Hoff, 1990). Grant et al. (1979) derived a value of 0.90 for the Australian school shark, Galeorhinus australis, using cohort analysis, and Walker ( 1992) used a value of 0.82 in a dynamic pool fishery simulation model of the gummy shark, Mustelus antarcticus, which was also obtained through cohort analysis. The lower survivorship value for R. terraenovae may be due to the smaller size of this species which would make it more sus- ceptible to predation by other sharks, especially at early ages, since pups are born at about only 30 cm TL in coastal waters about 10 m deep (Castro, 1993). The very high estimate of F (0.428) used in this study was derived from a shark stock assessment that is the basis for the recently implemented (26 April 1993) FMP for sharks of the Atlantic Ocean. However, the accuracy of this estimate, based on a 4-year catch-and-effort time series, is uncertain, and the demographic analyses undertaken in this study indicate that R. terraenovae is vulnerable to high removal levels in the early years of life. It is also possible that the age, growth, and repro- ductive data used in this study are only representa- tive of the population at a time when fishing pres- sure was not as high as it is at present. Potential Cortes: Demographic analysis of Rhizopnonodon terraenovae 65 Table 6 Life history parameters for severa species of sharks compared to the best case scenario for Rhizoprionodon terraenovae in the Gulf of Mexico. Species R G r e r 100 m separating adjacent stations, successive video deployments were likely indepen- dent, because the greatest distance offish attraction to the bait was only 48 to 90 m. This estimate was based on average maximum bottom current speeds of 0.1 to 0.2 m/s respectively (Bathen, 1978), a soak time of 10 minutes, and a swimming speed for opakapaka of 0.6 m/s (or approximately 3 body lengths (BL) per second, where one BL=20 cm; Videler, 1993). Depths of all video and longline sets were determined by depth sounders aboard the re- search vessels, and positions were determined by GPS (Global Positioning System) or sighting com- pass, as Loran-C capabilities were unavailable. Longlines were deployed approximately perpen- dicular to depth contours. Bottom longline operations used modified Kali longlines, 6 each with 30 individu- 6 Shiota, P. M. 1987. A comparison of bottom longline and deep- sea handline for sampling bottom fishes in the Hawaiian Ar- chipelago. Honolulu Lab., Southwest Fish. Sci. Cent., Natl. Mar. Fish. Serv., NOAA, Honolulu, HI 96822-2396. Southwest Fish. Cent. Admin. Rep. H-87-5, 18 p. Ellis and DeMartmi. Video camera sampling of Pristipomoides filamentosus abundance 69 21.6 21.5 Figure 1 Area of operations off Kaneohe Bay, Oahu, for video and longline sur- veys for opakapaka, Pristipomoides filamentosus. Stations for video and longline in 1992 are midpoints identified by solid circles. Area of video coverage in 1993 is enclosed within the dotted lines and stations are midpoints identified by hollow circles. ally weighted and buoyed 3-m PVC droppers. Drop- pers were attached along the main line about 18 m apart. A 9.07-kg test, hard monofilament branch leader and a 3.63-kg test, hard monofilament hook leader were used. Each dropper had five leaders with size-12 Izuo circle hooks (AH style), for a total of 150 hooks per longline set. Stripped squid was used as bait. The standard soak time was 30 minutes, and three to four sets were completed each day. Two separate, 8-mm video camera assemblies were used for the video operations. Each video camera was equipped with a No. 1 diopter magnification lens and a wide angle zoom lens with a red filter for underwa- ter correction. Camera focus, sensitivity, and white balance were manually adjusted, but an automatic aperture setting was used. The focus distance for both video cameras was fixed at 2.13 m, and the focal length of the lens was set at 11 mm. Each video cam- era was enclosed in an underwater housing and se- cured in a weighted frame (Fig. 2). A single, 15-cm long bait container was positioned 60 cm in front of the camera lens and mounted on a PVC rod. The bait container held a single (=0.5-kg) mackerel (Scomber sp.) and one whole squid (Loligo sp.) tie-wrapped to the outside, both of which were changed after each deployment. The camera assemblies were manually 70 Fishery Bulletin 93(1). 1995 Figure 2 Baited video camera assembly with bait container positioned 60 cm in front of the camera lens. for each video sequence, three indices of abundance were scored for each spe- cies taped: maximum number (MAXNO); time to first appearance (TFAP); and total duration in sequence (TOTTM). The MAXNO index was de- termined as the peak number of a spe- cies visible at any one time (maximum interval one second) during a deploy- ment. Fork length (FL) to the nearest 0.1 centimeter (cm) was recorded for fish caught on the longline. The FL of opakapaka observed on video was esti- mated and rounded to the nearest 5 cm by comparing fish swimming in the plane of the bait container with the known size of the container. Statistics An average maximum number offish re- corded for data collected in 1992 was cal- culated for each of nine sequences (three video stations) by using a mean weighted by the duration of each occurrence: lowered to the bottom and marked by a buoy; later they were raised to the surface by outboard engine power. Cameras were allowed to rest on the bottom for a standard interval of 10 minutes before retrieval. The duration and number of video camera deploy- ments to be used on the ship cruise were estimated on the basis of three earlier pilot deployments of the video assembly from small craft. These prior tests indicated that about 10 minutes were required to deploy and retrieve the camera assembly. The time to first appearance (TFAP) of opakapaka from the three pilot stations was 227 ± 300 sec (mean ± 1 stan- dard deviation of the data [SD]) after bottom con- tact. A bottom time of 10 minutes was chosen to ac- commodate likely extremes and also to allow 6 deploy- ments per 2-h tape (20 min per deployment x 6 deploy- ments). With two cameras, 12 deployments per day could be made without changing tapes. The maximum number of longline sets was limited to four per day, based on three camera deployments per longline set. Types of data Species presence, total number of individuals per species, and the number of hooks lost were recorded for each longline set. Species presence and duration of squid bait attachment to the bait container (BTM) were recorded for each video sequence. In addition, £*„ N h A w (1) N where X w =the weighted average maximum num- ber of fish, rc=total number of occurrences, X h = maxi- mum number of fish seen in the h th occurrence, N /i =duration (s) of the h th occurrence, and N=YN h = 600 s. Video indexes were calculated as means (of up to 3 deployments) to standardize for multiple deploy- ments per station. Video indices were derived in two logarithmic forms — mean of logs (ML), ]Tln(x,+l) ML = -^ (2) and log of means (LM), LM = In + 1 (3) where ac- = individual datum for a variable (i.e., the value for the variable MAXNO, TFAP, or TOTTM for each deployment at a station) and /i=number of de- ployments per station. The longline index consisted of log-transformed individual set data [In (catch + Ellis and DeMartmi. Video camera sampling of Pristipomoides filamentosus abundance 71 1)]. The number of stations where each species was caught or seen was also tallied for each gear type. For nonzero mean data collected in 1993, the best form of the video index (LM\ see Results section), was calculated as follows: (4) 7 \" LM' = ln x*. .=1 n V /_ where x - individual datum for MAXNO and rc=number of deployments per station. A matrix of Pearson's correlation coefficients was calculated for 1992 data (SAS, 1987) with the log- transformed variables to detect interrelationships among all the video and longline indices. Spearman's rank correlations were also calculated and compared. Multiple linear regression (SAS, 1987) was used to estimate the effect of competition between opakapaka and puffers for longline hooks on the basis of the fol- lowing model: Y = p 1 X 1 + p 2 X 2 +e, (5) where F=ln (opakapaka video MAXNO), Xj=ln (no. hooks lost + no. puffers caught), andX 2 =ln (number of opakapaka caught). The model was run as a for- ward regression without an intercept and with an entry level for significance equal to P<0.10. The pre- cision (repeatability) of video and longline was de- scribed by the coefficient of variation (V, Sokal and Rohlf, 1981; Zar, 1984): V = f-^-|xl I mean , (6) where SD is the standard deviation. Longshore station and relative depth effects for 1993 data were analyzed by using standard para- metric and nonparametric procedures (SAS, 1987). Sample size and power analysis We evaluated video and longline data in a power analysis for the £-test of means. Specifically, we esti- mated the sample sizes required to detect a twofold change in abundance by using either sampling method. Skalski and McKenzie (1982) set a prece- dent for use of the criterion of twofold change in en- vironmental monitoring studies; annual variations much larger than this are typical for marine fishes (Hennemuth et al., 1980; Francis, 1993). The effect size (ES) was calculated as follows: ES = 0.693 SD (7) where 0.693= I ± twofold difference in x I for the natu- ral log ( x ) and SD is the standard deviation. Cohen (Tables 2.3.4 and 2.4.1, 1988) was consulted for the requisite sample sizes. The ES for each gear was evaluated at 13=0.20, power (1-J3)=0.8, and a 2 =0.05. For the 1993 data, ES was also evaluated at a 2 =0.1. Results and discussion Sample composition The mean time to first appearance (TFAP) of opakapaka for 1992 video tapes with opakapaka present (all islands included) was 203 ±165 (SD) sec- onds. The total time (TOTTM) of opakapaka during a deployment averaged 122 ± 133 seconds. The maxi- mum number (MAXNO) of opakapaka appeared on tape at approximately 354 (±153) s, based on the nine video sequences for which the weighted average MAXNO ( X w ) was calculated. These data confirm our initial choice of a 10-min bottom time. In 1992, only windward Oahu data were used for comparisons and statistical analyses, because the opakapaka measures from Maui and Kauai included large percentages (92% and 67%) of "double-zeros" (zero longline catch, zero fish recorded). Catches of P. filamentosus also were greatest for the windward Oahu site; 54 of the 58 juvenile opakapaka were longlined off windward Oahu. Puffers were preva- lent at windward Oahu and at Maui. Both longlined and video-recorded opakapaka were juvenile size (13 to 21 cm FL, and 15 to 25 cm FL, respectively; Kikkawa, 1984; Moffitt and Parrish 4 ). Frequency of occurrence data and total number of species differed between longline catches and video records (Fig. 3). Puffers ranked first in abundance and opakapaka second in both the longline and video data. Video cameras recorded the presence of opakapaka and puffers more often than did the longlines (Fig. 3). Video tapes also recorded a greater diversity of species (Table 1), suggesting greater ac- curacy of the video system. Fish that were not caught by the longline but were seen on video included reef- associated species (e.g. pennant butterflyfish, Heniochus diphreutes, and whitesaddle goatfish, Parupeneus porphyreus, sharks {Carcharhinus sp.), and rays (Dasyatis sp.). Longlines also undersampled the lizardfish, Trachinocephalus myops (Fig. 3), a major component of this deep-water, soft-bottom fish assemblage. 5 No major differences in species compo- sition occurred in video surveys from 1992 and 1993. 1 992 video-longline relations The MAXNO index for opakapaka and puffers was highly correlated with the total duration on film 72 Fishery Bulletin 93(1), 1995 15 O a 0} Ih S-, o o O I G o -t-> CB -♦-> 6 2 10 TORQ = FILA = PORP SHRK DASY TRAC SCOU SERI HENI KASM | video V/A longline Torq-uiganer florealis Pristipomoides filamsntosus = Parupeneus porphyreus = Carcharhinus ap. = Dasyatis sp. Trachinocepfialus myops = unidentified Scombndae Soriola dume-iiii = Hemochus diphreutes = Lutjanus kasmira J I Liu TORQ FILA PORP SHRK DASY TRAC SCOM SERI HENI KASM SPECIES Figure 3 Frequency of occurrence of ten common species on video camera deployments and longline sets conducted during 1992 off windward Oahu (re = 15 stations). Refer to Table 1 for common names. Table 1 Total numbers of fish seen ar d caught at 15 video and longline stations located off windward Oahu during 1992. Total number for a fish taxon for video stations is the sum of the maximum numbers seen on 38 films. Total number for longline stations is the number of fish caught. Species Common names Video Longline Torquigener florealis Bleeker's balloonfish 221 80 Pristipomoides filamentosus Pink snapper (opakapaka) 94 54 Heniochus diphreutes Pennant butterflyfish 25 — Parupeneus porphyreus Whitesaddle goatfish 10 — unidentified Scombridae Tuna or mackeral 6 — Trachinocephalus myops Lizardfish 5 — Carcharhinus sp. Shark 4 — Sphyrna sp. Hammerhead shark 4 — Seriola dumerilii Amberjack 3 — Dasyatis sp. Stingray 3 — Chaetodon miliaris Milletseed butterflyfish 3 — unidentified teleosts Bony fish 2 — Parupeneus pleurostigma Sidespot goatfish 1 — Sufflamen fraenatus Bridle triggerfish 1 — Canthigaster rivulata Maze toby 1 — Parupeneus sp. Goatfish 1 — Lutjanus kasmira Bluestripe snapper •3 Ellis and DeMartini: Video camera sampling of Pristipomoides filamentosus abundance 73 (TOTTM) and time to first appearance (TFAP) of the respective species (Table 2, LM form). The duration of squid bait (BTM index) was significantly corre- lated with the MAXNO index and the other video indices for opakapaka but was more strongly corre- lated with the MAXNO index for puffers (Table 2). Videos indicated that puffers were usually respon- sible for the removal of the squid bait; a direct rela- tionship between puffer numbers and the rate of bait disappearance was evident. Spearman's rank corre- lations mirrored the parametric correlations. After log-transformation, the data pairs were ap- proximately bivariate normal. Among all the video indices, MAXNO was best correlated with InCPUE (LLNO) for opakapaka (Table 2). The ML and LM forms of the MAXNO video index were compared separately with the longline CPUE, and the LM form provided a slight but consistently better Pearson's correlation than did the ML form for both opakapaka and puffers. Therefore, the LM form of the MAXNO index was used for all further parametric compari- sons and analyses. The MAXNO-CPUE relationship was approxi- mately linear (Fig. 4A), and its residual plot showed Table 2 Correlation between log-transformed mean video indices (LM) and log-transformed longline catch per unit of effort (InCPUE) from the 1992 windward Oahu site (n=15 sta- tions). Pearson correlation coefficients (r) are displayed above their respective P- values (Prob> \R\ , H o . Rho=0) for Pristipomoides filamentosus and Torquigener florealis. MAXNO = maximum number seen on tape; TOTTM=total duration of a species an tape; TFAP=time to first appear- ance of a species; BTM=duration of external squid bait; and LLNO=longline CPUE. TOTTM TFAP BTM LLNO Pristipomoides filamentosus MAXNO 0.9665 -0.9143 -0.5748 0.7855 0.0001 0.0001 0.0250 0.0005 TOTTM -0.8500 -0.5681 0.7285 0.0001 0.0271 0.0021 TFAP 0.5729 -0.6467 0.0256 0.0092 BTM -0.2982 0.2803 Torquigener florealis MAXNO 0.9465 -0.5770 -0.6654 0.5365 0.0001 0.0243 0.0068 0.0392 TOTTM -0.6030 -0.5902 0.5932 0.0173 0.0205 0.0198 TFAP 0.5141 -0.1143 0.0499 0.6851 BTM -0.5193 0.0473 neither discernible pattern nor slope (P=1.0, Fig. 4B). If all double-zero data are deleted, the correlation between video MAXNO and longline CPUE loses sig- nificance (r=0.55, P=0.08, n = ll). However, the double-zero data were retained in subsequent analy- ses because there was no a priori reason to believe they did not represent real absences. The observed magnitude of hook loss ( x =32%) in- dicates that longline CPUE is fundamentally inac- curate and biased for sampling this habitat and spe- cies assemblage. Apparently, most hook loss occurred when puffers bit through the leader above the hook. Hook competition is often a problem with longlines when hooked fish begin to saturate available hooks (Rothschild, 1967). Removal of hooks has a similar effect. A multiple linear regression with two descrip- tive variables, a puffer factor (Xj) equal to the num- ber of hooks lost plus puffer catch and opakapaka catch (X 2 ), was run to determine the effect of puffers on the relation between longline CPUE and the video MAXNO index for opakapaka. X : and X 2 were first determined to be uncorrected (r 2 =0.02, P=0.62). The model (Eqn. 5) for the multiple regression was forced through the origin, because neither sampling device could record the presence offish in its absence. The total variation in the opakapaka video index ex- plained by the model was 87% (i? 2 =0.87, P<0.001). Opakapaka longline CPUE explained 83% of the varia- tion (^=0.83, P<0. 001), and the puffer factor explained an additional 4% of the variation (^=0.04, P=0.07). The latter observation suggests that the puffer factor might strongly influence video-longline relations for opakapaka at times of relatively high puffer abundance. Precision for longline and video cameras was sepa- rately examined. For both opakapaka and puffers, cameras had nominally but consistently better pre- cision (V=81% and 48%) than did longline CPUE (V=91% and 71%). 1 993 video statistics The MAXNO video index did not differ between shal- low and deep positions (Student's r=0.27, P=0.79; Kruskal-Wallis x 2 =0.09, P=0.76) in May 1993 (Fig. 5). The mean MAXNO data lack a monotone trend over stations (P=0.5), even though raw MAXNO values were atypically large at several stations 20 - o 15 - O 9 1 O 10 - i 1 ii CI p p o O i I 5 - ? ( I p II • II • O • 8 ( ) c > II • • o 1 » • • 5 10 15 20 Station Figure 5 Scatterplot of maximum number of opakapaka observed (MAXNO) for shallow and deep positions and their mean by stations for data collected during May 1993. Stations are ordered in geographic sequence from farthest southeast (sta. 1) to farthest northwest (sta. 18). Means with component data hidden represent coincident shallow and deep values. 1992) observed that, although time of arrival of the first fish (TFAP) was strongly related to estimated fish densities, the maximum number offish seen at a station (MAXNO) either was unrelated or inversely related to densities. Our observation that MAXNO was highly correlated with an abundance estimate (CPUE ) may at first seem contradictory to these prior findings. However, there are important differences between our methods and those of previous studies: previous deep-sea work operated in unproductive depths >2,000 m and cameras recorded data for at least 11 hours per station, whereas our study was limited to productive depths <100 m for which a rela- tively short soak time ( 10 min) was sufficient. In the deep-sea studies, all bait was open to consumption. The partly internal bait of our system created a res- ervoir of odor that persisted for the soak duration in most cases; puffers removed all bait in only 3 out of 75 deployments. Differences in rates of bait consump- tion between the two deep-sea stations and result- ing variations in bait attractiveness may have con- tributed to the disparity between MAXNO and fish density in the deep-sea studies. The MAXNO and TFAP indices in our study were highly correlated (Table 2). This correlation suggests that the greater the density, the faster the fish ar- rive at the bait. These data agree with the observa- tions of Priede et al. ( 1990), where fish arrived at the camera faster at the station with presumed higher densities. Since the MAXNO and TFAP indi- ces were both significantly correlated with CPUE in our study (Table 2), the MAXNO index was chosen as the best index of abundance because it had the better correlation. A persistent bait source and short soak time may have contributed to this stronger cor- relation. In the future, the use of MAXNO as an in- dex of abundance should be reevaluated separately for each species and application. Conclusions Video cameras provide an accurate tool for sampling juvenile opakapaka, and the video MAXNO variable provides a relatively precise and accurate index of abundance. Based on 1993 data for a series of two camera deployments per station, minima of 17 to 22 pairs of deployments (34-44 sets) per study area would be necessary to detect a twofold change in ju- venile opakapaka numbers (at TRICHIURIDAE SCOMBRIDAE } - SCOMBRIDAE XIPHHDAE ISTIOPHORIDAE Scombrini Gasterochisma Grammatorcynus Scomberomorus + Acanthocybium V Sardini Thunnini Figure 1 Two phylogenetic hypotheses for the scombroid fishes based on morphological evidence. The studies of (A) Johnson (1986) and (B) Collette et al. (1984) are examples of the scombrid- subgroup and the scombrid-sister group hypotheses of billfish (Istiophoridae and Xiphiidae) relationships. Johnson ( 1986) considered billfishes a subgroup of the family Scombridae most closely related to the wahoo, Acanthocybium solandri. Collette et al. ( 1984 ) placed the billfishes as a sister group to the Scombridae. Both hypotheses propose that billfishes and scombrids share a common ancestor to the exclusion of other scombroids. An alternative hypothesis for billfish relationships is that billfishes are not scombroids. This hypothesis has never been depicted explicitly in the form of a cladogram (Gosline, 1968; Nakamura, 1983; Potthoff et al., 1980; Potthoff et al., 1986). al. (1984) study and several additional characters (Fig. 1). Like Collette et al., Johnson proposed that billfishes and scombrids compose a monophyletic group, but he regarded billfishes as a subgroup of the Scombridae. A critical piece of evidence support- ing this hypothesis that billfishes are a derived group within scombrids is the presence of cartilaginous in- terconnections between gill filaments in billfishes and the scombrid Acanthocybium solandri. Based largely on this proposed synapomorphy, Johnson placed Istiophoridae and Xiphiidae as derived scombrids and Acanthocybium as their sister group. This association has been suggested by others (Lutken, 1880; Fraser-Brunner, 1950). However the position of billfishes in Johnson's study was only weakly supported because of homoplasy. For ex- ample, five of the ten character-state transitions that support billfish monophyly on Johnson's cladogram are reversals. We will refer to the Johnson hypoth- esis as the scombrid subgroup hypothesis. Other workers have proposed that billfishes are not scombroids. In 1986, Potthoff et al. published a study of bone development in scombroids in which they discussed scombroid phylogeny They concluded that billfishes are not scombroids because of their lack of resemblance to other scombroids in vertebral number and osteological development. They sug- gested that these characters indicate billfish affini- ties to the percoids. This hypothesis has been sug- gested in previous studies (Potthoff et al., 1980; Nakamura, 1983). We will refer to this hypothesis as the nonscombroid hypothesis. It is evident from the morphological studies that there has been a great deal of homoplasious mor- phological evolution in billfishes. Therefore, it is dif- ficult to reconstruct the evolutionary relationships of this group based on morphology alone. In an at- tempt to derive additional, independent data on scombroid intrarelationships and, in particular, to address the position of billfishes, we compiled a mo- 80 Fishery Bulletin 93(1), 1995 lecular data set that consists of DNA sequences from the mitochondrial gene cytochrome b. This gene codes for a functionally conserved protein that should fa- cilitate sequence alignment over ancient divergences. Additionally, it has been used to examine both in- traspecific genealogy (Finnerty and Block, 1992) and much deeper phylogenetic questions such as the ori- gin of the mammalian orders (Irwin et al., 1991). The initial scombroid radiation probably occurred in the Paleocene epoch (Bannikov, 1985; Carroll, 1988). Therefore, cytochrome b sequence should be phylo- genetically informative about divergences within the suborder. The analysis presented in this paper builds on our earlier molecular study (Block et al., 1993). However, we have improved on the previous study in several ways which allow us to directly test the competing hypotheses of billfish relationships. First, we have obtained sequences from additional outgroups. The inclusion of presumably more distant outgroups per- mits us to address the question of scombroid mono- phyly. This is important because the nonscombroid hypothesis of billfish relationships argues that the Scombroidei is not a monophyletic group. Second, we include sequence information from the scombrid Acanthocybium, a taxon which is integral to the scombrid subgroup hypothesis. Third, we utilize sta- tistical tests to directly compare different hypoth- eses of billfish relationships. Finally, we emphasize character-state changes that accrue relatively slowly in order to minimize the effects of phylogenetic noise. Materials and methods Samples Partial cytochrome 6 sequences (590 base pairs) were obtained from 75 individuals representing 34 spe- cies of perciform fishes: 30 scombroid species and four putative outgroup taxa (Sphyraena, Coryphaena, Mycteroperca, and Morone; Table 1). We included Sphyraena based on the placement by Johnson ( 1986) of this taxon as the most primitive member of the Scombroidei. Several percoid taxa (Coryphaena, Mycteroperca, and Morone) were included because of the suggestion by some authors that billfishes are percoids (Gosline, 1968; Potthoff et al., 1980; Nakamura, 1983; Potthoff et al., 1986). Published cytochrome b sequences from two cypriniform fishes obtained from Genbank were used to root the phylo- genetic analysis (Crossostoma lacustre [Tzeng et al., 1990] and Cyprinus carpio [Chang, 1994]). We veri- fied the outgroup status of the cyprinids by first con- ducting a phylogenetic analysis using published se- quence from the sturgeon Acipenser transmontanus, a holostean, to root a parsimony analysis. We at- tempted but were unable to obtain full length se- quences (590 base pairs) from two fixed and preserved specimens of Scombrolabrax heterolepis possibly be- cause of DNA degradation in these specimens. DNA extraction DNA was obtained from frozen tissue samples of the mitochondria-rich "heater tissue" (found in Istio- phoridae, Xiphiidae, and Gasterochisma melampus; Block, 1986), red muscle, white muscle, or liver. Di- gestion of 0.1-0.6 g tissue was performed in ten vol- umes of extraction buffer containing 100 mM Tris CI (pH 8.0), 10 mM EDTA, 100 mM NaCl, 0.1% SDS, 50 mM DTT, and 0.7 mg/mL proteinase K. Digestion proceeded for 2-4 hours at 41°C. The homogenate was extracted twice with equal volumes of phenol (pH 8.0), once with 1:1 phenol/chloroform, and once with chloroform. The final extract was precipitated with 1/9 volume of 3M sodium acetate (pH 5.2) and 2.5 volumes of 100% ethanol. DNA amplification and sequencing The polymerase chain reaction (PCR) was used to am- plify a 700 base pair region of cytochrome b. A 305 base pair segment (not including primers) was generated by using published oligonucleotide sequences (Kocher et al., 1989). We amplified an overlapping, 425-bp region farther downstream with primers L15079 (5- GAGGCCTCTACTATGGCTCTTACC-3') or L15080 (5- CGAGGCCTTTACTACGGCTCTTACCT-3) and H15497 (5'-GCTAGGGTATAATT GTCTGGGTCGCC- 3). Double stranded amplification was performed in a 100-uL volume containing 50 mM KC1, 10 mM Tris- HC1 (pH 8.3), 1.5-3.0 mM MgCl, 200 ^M of each dNTP, each primer at 1 mM, 1 |j,g of template DNA, and 2 units of Amplitaq DNA polymerase (Perkin- Elmer/Cetus). Most templates were amplified through thirty cycles of PCR [1 minute denaturation (92-95°C), 1 minute annealing (40-50°C), and 3 min- utes extension (72°C)] on an Ericomp thermal cycler. Alternatively, PCR was performed on a DNA Ther- mal Cycler 480 (Perkin-Elmer) with the following temperature cycling regime: 5 cycles of 1 minute de- naturation at 95°C, 1 minute primer annealing at 40°C, 1:30 ramp to 72°C, and one minute extension at 72°C, followed by 25-35 cycles with an annealing temperature of 45°C. An 18-pL aliquot of the double stranded product was run by means of electrophore- sis through a IX TBE 1% agarose gel (Sea Plaque, FMC) at 5 V/cm for 45 minutes. A single stranded template was produced by asymmetric PCR (Gyl- Finnerty and Block: Evolution of cytochrome b in the Scombroldei 81 Table 1 Partial cytochrome b sequences (590 base pairs) were obtained from 34 perciform fishes, including 30 scombroid species. Pub- lished cytochrome b sequences were also obtained from Genbank for two cypriniform fishes. Order and suborder' Family and species Common name n Locales 2 Perciformes:Scombroidei Istiophoridae Istiophorus platypterus sailfish 2 A,P Makaira indica black marlin 2 I Makaira nigricans blue marlin 8 A,P Tetrapturus albidus white marlin 2 A Tetrapturus angustirostris shortbill spearfish 2 P Tetrapturus audax striped marlin 3 P Tetrapturus belone Mediterranean spearfish 2 M Tetrapturus pfluegeri longbill spearfish 1 A Xiphiidae Xiphias gladius broadbill swordfish 6 A,P Scombridae Acanthocybium solandri wahoo 3 A Scomberomorus cavalla king mackerel 1 A Scomberomorus maculata Spanish mackerel 2 A Gasterochisma melampus butterfly mackerel 3 T Auxis thazard frigate mackerel 2 P Euthynnus affinis kawakawa 2 P Euthynnus alletteratus little tunny 2 A Katsuwonus pelamis skipjack tuna 2 P Thunnus alalunga albacore tuna 2 P Thunnus albacares yellowfin tuna 2 P Thunnus maccoyii southern bluefin tuna 2 T Thunnus obesus bigeye tuna 2 P Thunnus thynnus northern bluefin tuna 2 A Sarda chiliensis eastern Pacific bonito 1 P Sarda sarda Atlantic bonito 2 A Scomber scombrus Boston mackerel 2 A Scomber japonicus chub mackerel 2 P Gempylidae Gempylus serpens snake mackerel 2 P Lepidocybium ftavobrunneum escolar 2 P Ruvettus pretiosus oilfish 2 A Trichiuridae Trichiurus lepturus scabbard fish 3 A Perciformes:Percoidei Coryphaenidae Coryphaena equiselis pompano dolphin 2 P Serranidae Mycteroperca interstitialis yellowmouth grouper 1 A Percichthyidae Morone saxatilis striped bass 1 P Perciformes:Sphyraenoidei Sphyraenidae Sphyraena sphyraena Atlantic barracuda 1 A Cypriniformes Balitoridae Crossostoma lacustre hillstream loach Tzeng et al., 1992 Cyprinidae Cyprinus carpio carp Chang et al., 1994 ' Eschmeyer, 1990. 2 A=Atlantic ocean; P=Pacific Dcean; I=Indian ocean; T= Tasman sea; M=Mediterranean Sea. 82 Fishery Bulletin 93[1), 1995 lensten and Erlich, 1988) carried out in a 100-uL volume containing the same reactants as the initial PCR but using 10 uL of the dissolved gel band and reducing one primer concentration 100-fold. The product was washed by centrifugal dialysis with ster- ile water in Centricon microconcentrators (Amicon) to remove excess dNTP's. Sequencing was performed with the Sequenase kit (United States Biochemical, Cleveland, Ohio) by using the limiting primer from the asymmetric PCR reaction. Data from eight spe- cies were obtained by directly sequencing double- stranded PCR products. The template was purified prior to sequencing (either directly from the PCR reaction mix or following excision of the appropriate band from low-melt agarose) with Magic PCR Preps (Promega). Sequencing was performed with the Sequenase kit according to the specifications of Casanova et al. ( 1991 ). Sequences from Mycteroperca and Morone was obtained after first cloning the PCR products in pGEM t- vector (Promega) according to the manufacturer's instructions. Transformation was carried out by using XL-1 blue cells. Two positive clones were selected for each PCR product. Double- stranded sequencing (Sequenase 2.0) was performed following alkaline denaturation as recommended by the manufacturer. Sequence was obtained from both strands of the amplified fragment for all individuals. Analysis Sequences were aligned by using the Mac Vector pro- gram (IBI Biotechnologies). Maximum parsimony analysis was performed with PAUP 3.1. (Swofford, 1991). Neighbor-joining (Saitou and Nei, 1987) and UPGMA dendograms were constructed with Phylip 3.5 (Felsenstein, 1993). The strength of support for various nodes was assessed by using the bootstrap analysis (Felsenstein, 1985). Specific conditions for each analysis are contained in the figure legends. Competing phylogenetic hypotheses were com- pared by using the "enforce topological constraints" option of PAUP 3.1. This option allowed us to deter- mine the length difference between the most parsi- monious trees that support each hypothesis. The cla- distic permutation test for monophyly and nonmonophyly (Faith, 1991) was then used to ascer- tain whether the more parsimonious hypothesis is significantly better than the competing hypothesis according to the criterion of parsimony. The test was performed as follows. The actual length difference between trees supporting the two opposing hypoth- eses was obtained. Then 99 permuted data sets were constructed from the original data set by randomly shuffling the character states for each character. We then obtained the length difference between trees supporting the two opposing hypotheses for each permuted data set. If the actual length difference was matched or exceeded fewer than 5 times in all 100 data sets (the original data set plus 99 permuted data sets), then the more parsimonious hypothesis was considered to be significantly better than the less parsimonious hypothesis. This corresponds to a to- pology-dependent permutation tail probability, or T- PTP, of less than or equal to 0.05. The effects of character weighting on parsimony analysis were assessed by EOR weighting (Thomas and Beckenbach, 1989; Knight and Mindell, 1993): each type of nucleotide substitution was weighted according to the ratio of its expected number of oc- currences divided by its observed number of occur- rences, or EOR. There are six types of nucleotide substitutions if we disregard the direction of change: A«G, CoT, G<=>T, G<=>C, A»T, and A<=>C. The ob- served number of each substitution type was obtained through pairwise sequence comparisons. Pairwise comparisons were performed between sets of sister species (sister species were identified through an initial unweighted phylogenetic analysis; see Fig. 2). Sister-species comparisons were used for two reasons. First, within a clade, sister species will tend to rep- resent relatively recent speciation events. This recency lessens the chance that multiple substitu- tions have occurred at the same site and that more recent substitutions obscure older ones. Second, all comparisons between pairs of sister species are mu- tually independent. Therefore, if we restrict our com- parisons to sister species, we cannot count the same base substitution twice. We modified the method of Knight and Mindell ( 1993) to derive the expected number of substitutions in each class. This method accounts for differences in the frequencies of the four nucleotides that greatly influence the expected frequency of each substitu- tion type. For instance, if guanine residues are very rare, then substitutions of other nucleotides for gua- nine will also be rare. The L-strand base composi- tion of cytochrome b in scombroid fishes is strongly skewed (Table 2), as it is in other groups examined (for example, Irwin et al., 1991). Cytosines and thy- midines each compose nearly 30% of the total nucle- otide population whereas guanines compose less than 16%. In order to incorporate knowledge of the base composition into our derivation of the expected num- ber of each substitution type, we proceeded as fol- lows. First, the average frequency of each nucleotide (/) was obtained for all species used in the pairwise sequence comparisons. Second, the observed num- ber of each substitution type (S 0(i -j), where i and./ represent two different nucleotides, was obtained by summing the results from all pairwise comparisons of Finnerty and Block: Evolution of cytochrome b in the Scombroidei 83 hliophorus platyplerus Makaira nigricans Tetrapturus albidus Tetrapturus audax Tetrapturus angustirosrns Tetrapturus pfluegeri Tetrapturus belone Makaira indica Xiphias gladius Thunnus alalunga Thunnus albacares Thunnus maccoyii Thunnus thynnus Thunnus obesus Katsuwonus pelamis Euthynnus affinis Euthynnus alletleratus Auxis thazard Sarda chiliensis Sarda sarda Scomberomorus cavalla Scomberomorus maculata Acanthocybium solandri Scomber japon icus Scomber scombrus Gasterochisma melampus Gempylus serpens Ruvettus pretiosus Lci'idticxhmm flavohrunneum Trichiurus lepturus Istiophoridae Xiphiidae Scombridae Gempylidae Tnchiuridae Cor\phaena equiselis Mycteroperca interstitialis Morone saxatilis Sphyraena sphyraena Crossostoma lacustre Cyprinus carpio Figure 2 Phytogeny of the Scombroidei based on an unweighted analysis of 248 phylogenetically informa- tive nucleotide sites. The cladogram depicted is a strict consensus of four equally parsimonious trees identified by using a heuristic search procedure on the program PAUP 3.1. (Swofford, 1991): TBR (tree bissection and reconnection) branch swapping was performed on 10 starting trees generated through random stepwise addition of taxa. Crossostoma and Carpio were specified as the outgroup. Length, consistency index, and retention index are the following: L=1595, CI=0.317, RI=0.539. Circled numbers at nodes indicated the percentage of trials in which a given partition between taxa is supported in 1,000 replications of the bootstrap analysis (Felsenstein, 1985). Only nodes supported in >50% of bootstrap replications are indicated. sister species. The expected number of each of the six substitution types (S^ -|)was then derived as follows: i E[i^j -Ifi fj)( S 0[total])/3- We divide by three because three types of base sub- stitutions are possible for each base, and we are in- terested in obtaining an expectation for one of them. For example, the expected number of A<=>T substitu- tions equals the average frequency of A's (0.23) plus 84 Fishery Bulletin 93(1), 1995 Table 2 Nucleotide substitutions by type determined through where i and./ represent two different nucleotides, were taxa. The expected substitutions for each type, S EUolal] , and f- are the frequency of nucleotides i andy. Average C=0.32. pairwise alignments. The observed substitutions for each type, calculated by summing the results from 8 pairwise comparisons were calculated according to the formula S £(Ma;| =(/)+/')(S , Ma; |)/3, >ase frequencies for the 16 species are as follows: G=0.16, A=0.23, of sister where f T=0.29i TRANSVERSIONS Pairwise comparison Substitution Types TRANSITIONS A»G CoT GoT GoC AoT \»C Total Tetrapturus audax vs. Tetrapturus albidus 1 1 2 Tetrapturus angustirostris vs. Tetrapturus pfluegeri 7 1 8 Makaira nigricans vs. Istiophorus platypterus 1 21 1 23 Euthynnus affinis vs. Euthynnus alletteratus 5 27 3 3 38 Thunnus thynnus vs. Thunnus maccoyii 4 3 1 8 Scomberomorus maculata vs. Scomberomorus cavalla 13 38 1 1 8 11 72 Sarda sarda vs. Sarda chiliensis 6 15 3 2 26 Scomber japonicus vs. Scomber scombrus 25 35 2 5 6 6 79 Total observed substitutions 61 140 3 10 20 22 256 Expected substitutions (see Methods section) 33.28 52.05 38.40 40.96 44.37 46.92 256 Expected/observed ratio (EOR) 0.55 0.37 12.80 4.10 2.22 2.13 the average frequency of T's (0.29) multiplied by the total number of substitutions (256) divided by three, or 44.37 (Table 2). The weights used for each substitution type (Table 2) are the ratios of expected substitutions divided by observed substitutions for that substitution type, rounded to the nearest integer (expected divided by observed ratios, or EOR's). All EOR's less than one were rounded to one. Weights were entered into PAUP 3.1. (Swofford, 1991) in the form of a step matrix. Results Sequence evolution and interfamilial relationships Molecular data sets, such as the cytochrome b se- quences presented in this study, are known to encom- pass subsets of characters that evolve at different rates. Subsets of data that differ in their evolution- ary rates will also differ in their phylogenetic utility. Character state changes that accrue very rapidly should permit resolution of very recent divergences. However, these rapid character state changes can provide false inferences about distant relationships because of homoplasy The likelihood of reversals and independent acquisitions is high if a particular site is evolving rapidly because there are only four pos- sible character states (G, A, T, and C) and only six possible types of character state change (A<=>G, CoT, GoT, GoC, AoT, and AoC). Therefore, in order to make an accurate reconstruction of the earliest branching events in scombroid history, we should emphasize slowly evolving character state changes. In an effort to best utilize the phylogenetic infor- mation from both slowly and rapidly evolving char- acter state changes, our phylogenetic analysis pro- ceeds in several discrete steps. We begin with an unweighted analysis of all informative nucleotide sites. This analysis is strongly influenced by nucle- otide substitutions that accrue rapidly and should be most informative concerning recent speciation events. We then attempt to improve our resolution of more ancient divergences by giving greater weight to less frequent types of nucleotide substitutions. We conclude with a phylogenetic analysis based on the inferred amino acid sequences. The amino acid se- quences evolve very slowly and should provide our most reliable estimates of the earliest splits between lineages. In each instance, the phylogenetic analy- sis is preceded by a discussion of the evolutionary varia- tion in the character subset under consideration. Unweighted nucleotide analysis A 590-base pair fragment of the cytochrome b gene, representing positions 134 through 723 of the hu- man cytochrome b sequence, was aligned across all Finnerty and Block: Evolution of cytochrome b in the Scombroidei 85 1 Istiophorus platypterus 2 Makaira nigricans 3 Makaira indica 4 Tetrapturus albidus 5 Tetrapturus audax 6 Tetrapturus angustirostris 7 Tetrapturus belane 8 Tetrapturus pfluegeri 9 Xiphias gladius 10 Acanthocybiun solandri 11 Sccmberamorus cavalla 12 Sccnteranorus maculata 13 Gasterochisma melampus 14 Auxis thazard 15 Euthynnus affinis 16 Euthynnus alletteratus 17 Katswonus pelamis 18 Thunnus alalunga 19 Thunnus albacares 20 Thunnus maccoyii 21 Thunnus obesus 22 Thunnus thynnus 23 Sarda chiliensis 24 Sarda sarda 25 Scomber japonicus 26 Scomber scombrus 27 Gempylus serpens 28 Lepidccybium flavobrunneum 29 Ruvettus pretiosus 30 Trichiurus lepturus 31 Sphyraena sphyraena 32 Coryphaena equiselis 33 Morane saxatilis 34 Myctoperca interstitialis 20 40 60 80 100 120 TCCTTACACoc rmTLi ' ia xTATGCACTACACCTCAGACATCCc^^ A Y T A R .A..T. .A..T. A. .A. .A. .T..A .T. ..C.T. ..G. .R. .A.T. .. .A.T.G. .T .TG... ..G.C. .C C G. .A. ... AT. A T. .A. .A. -T. .C... .C.T. . .G. ..A.T.G. ..G.. .AGT... .TG. ..A.T... .TG.C. . .G.T. . .G.T. A. .C. A. . . A. X .A. .T. C. .T..T. ..T..A. ,T. . .G. .C T. .T. .T .A .A .A. .T. .C. .C.T. .C..C.T. G.RC T.X. .A. .A. .A. .A. .A. .C.C. .C.T. TG.. .A.T. TG...A.T. .G.A.A.T. .G.C. .G.C. .G.C. .C.T. .C.T. .A.T. .A.T. .TG.C. ..G.C. T. .T. .T. .A..C.TT .A. .C.T. ..T. A. .C.T. ..A. C. .T..C. CC .T..CC CC .A..T..A .A T C C.C. .CC. .CC.( .T X. .T. .A. .T. .A. .T. C C.C. .A. .A. .A. .A. .C.T. .C.T. TG.. .A.T. YG...A.T. A.T. .G.C. .G.C. .G.C. .C.T. .C. C .T. .C G..CC G..CC C.C. C.C. .T..C A.. .A. .A. .T..T. .A. .A ..C.T. .GC.C. .TG...A.T. .TG.T.AGT. . A. A. .C. C .T. .A. .T. CC • R..CC C.C .A. C.C .A. A. .C.T. ..A A. .C.T. . .A A. .C.T. . .A C. .C.T. ..T C.T. .TG. . .A.T G.C. .A C.T A. .T. .C .C.T. . .T C T. ..T C.CT...T. A A A .T. .T. . .C.T. .TG. . .A.T G.C. .A. .C C. .T G T T A. .C CCC. .C .A T T A. .C.T... A A. .C.T. ..A T. .C.T. . .T A. .C.T. . .A A. .TG.T. .T C A A. .C.T. . .A T. .C CC C.C.T..G T..C.T A. .C.T. .A .C -T. .C. .T. .G.C .GAC .GC.C . .G. . .A.T A AC. .A. .C T. .T. .A. -C .A. .C .CC< .CC( .C A. .C... .A. .T. .T..A. .A .C.C .C... TG.T. A.T. .G.7.A.T. .TG.C .TG.C .A. .C. .A..C. .C. • A. .C. C. .T..CC .C.C. A. G. .C.A. .A. X. C. T..CCI CC' .A T.X... -A A.. C.A ..C.T. .QG. .. .G.T.A.T.T. . .CA.A.T... T..T G. .A AC. .T..TGAC. .T...C.T. .T.X. X.A. C A A T..C..A. .T..T .G..A. .T..T. .T.G .T.A. X. X..C CC G..C G .G..A. -AA.C .A. X .A. .A. .A. .T.X. .. ..T.C.T. T. .T C. -T A. -T. . . .T. .A. X A. .T. .A T C. .CCC X. . . AA.T. .T. X. . .AC . .A. .T. .ACA T. X. .T.X T. 240 260 280 CCGCCTTajICGaCT3uT3raCICOCCTGAGGACAAAT TT X CG C X C r . .TCA. T X C . .TCA. T X c T ■3 1 i; Figure 3 Alignment of partial cytochrome b sequence (590 base pairs) across 34 species of perciform fishes and two species of Cypriniformes. Nucleotide position 1 is equivalent to position 134 of the human cytochrome b gene. Intraspecific polymorphism is indicated as follows: R=A/G, Y=C/T, M=A/C, S=C/G, K=G/T, W=A/T, H=A/T/C, D=A/G/T. Ambiguities are indicated by '?' thirty-six species included in the analysis (Fig. 3). No deletions or insertions were detected. Overall, 293 nucleotide positions are variable; 248 were poten- tially phylogenetically informative. As expected for a protein coding sequence, the degree of nucleotide variability differs according to codon position (Table 3). The third position is most variable and the sec- ond position is least variable. Differences in nucle- otide variability at the three codon positions are due to the fact that many third position substitutions are silent, whereas many second position substitutions result in nonconservative amino acid replacements. The differences in substitution rates between codon positions becomes more apparent when we compare 86 Fishery Bulletin 93(1), 1995 1 RT ..T.. c ..T.. ..T.. A. ..T. . ..T.. .A. ..T. . .A. T G..C.C. ..T. . A r T . .c. . .T.. . .C. A A T T 11 G. A T .C r T .T. A A A A ..G ..T.. ..C. A A T T T r. .A CT.C .CG. .. CC 12 A. A T G r .c. A A G r .T. A ..G C A T A A r CT.C. .CG.C. C ..G r. A A r O AT.C. A .CG. .. 17 G. .A. ..A. .T. .C .c. .c. .T. .A. .A. .A. .A. A. -A.CT .CC.C. ..G .T .A. .A. .c. .T. ..c. .A AT.C. .CG.C. .C. 18 G. ..A. .T. .c .T. .c. .A. .A. .A. .T. .T. .A.cr .CC.C. .TO ..G. .T .A. .A. .c. .T. .T. .T. ..c. .A AT.C. .A. .CG.C. .C. 20 G. T A T .c T .c. A r. A A .T. .A.cr ..C.C. .TO T A A r T ..c. .A AT.C. A .CG.C. r 21 G. .T. . .A. .T. .c .T. .c. .T. .A. .A. .A. .T. .A.cr .CC.C. .TG .T. .A. .A. .c. .T. .G.. ..c. .A AT.C. .A. .CG.C. .c. 23 G. r. T .c r .c. r A A r A .A.cr .CC.C. ..G ..G. .T. .A. .c. .T. CT.C. .A. .03... ..T 24 r. T .c c .c. r A A A ■y .A.cr .CC.C. ..G ..G. .T. .A. .c. .T. .Y. .T. .G.. . .c. CT.C. .G. .03... ..T 25 G. ..G. .c. .A. .c .G. .A. .A. .T. .T.cr .AC.C. .TG.G. . ..C. .A. .A. .c. .T. AT.C. .A. .CG.C. .CC 26 G. A r T .c. .A. r A A T .A A ...CA .AC.C. .TG ..T.. ..G. A A c T T .G. T r. ..c. T. AT.C. ..G... rr 27 G. A r. r .c. .TT.A. T A r .T. G ...c. TAC... .TG.G.. C .T A .A c ..T.A. T r ..c. .G AT.C. T .03... TOC.T. ..G ..T.. C A A T CT.C. .C.C. r 29 G. A .c r T .c. A G r G .G.C. TQC.T. . .G.G.. ..T. . ..c. A A c ..c. AT.. . ..G.C. C 30 A. .T.. .A. . . .c. .C. .c. .T. .A. .T. .T. .G. .TA.T. .A.CA .AC.C. .AG . .c. .A. .A. .c. .T. .A. . .CA.T AT... .A. .CG.C. .c ..T. T T A T T .T. T T Y 33 A. T T G A .A. .T r .TT.AT.A. T r .T. A G. .. .CC... .T A T .A. A . .c. .T CT.C. A ..G.C. r 440 460 480 500 520 540 560 580 1 CTGCTATGACTCTAATCCACCTCCTrTTCClOCACGAAACAaG^ 2 C. .A C Ft. .A A. .G G T C .C. .R. .C. .A. .A .GC... .G..G. A. .G..A. .C. .A. .C. .A. .GC... .G. .G. .G..G. .G. .C. .G. .C. 9 TA..CGCA. .CA 10 .A..C. .A. .AA 11 TC A. .AA 12 TG..C. .A. .AA 13 TG..C. .A. .AA 14 .A A 15 .A A. .AA 16 -A A. .AA 17 .A..C AA 18 .A. .C AA 19 .A.. 20 .A.. 21 .A.. 22 .A.. 23 TA. . 24 TA..C..A..AA 25 TG..AGCA..AA 26 TA. .GGCAG.G. 27 .A. .A AA 28 .A AT. A. 29 TG. .A. .A. .AA 30 TA..03CT..A. 31 T. .G.G.C.CC 32 TG..A.CT...T 33 GCC. .C. 34 .A..CT.T. .AC T. .T. TC. .. • A .A. .A. TC.T A. .G..T..G. .C. .C. .C A. .CC.C. .T C C. .T. .C A.TC. .AY TA.T C. .C T A.TA. .AC A.T C G. .T..A. .C.C .C. .C T C. .C A.T... A. .C AAT. . .A. TC.T A A T T. .T T. . .AC. .GT. . .TA C C TC.G. .T. .A. .C. .T. .T. .T C A.TC. .CC.C A C C TC A A G. .C. .A. .T. .T T. . .A A.T. .C.C C. .T. ..C C.C. AAT. .AC C.C.T.T. ..CT. .C.C. AAT. OCT A A C. .A A.TC. GC.G. .T. . .A.T C C .T A. .T T C.C. .C .C. .AAT. T.A TC.T A A C .? A.T. . .AC A C C .C A C.T. .C AAT. T.A TC A T C. .A Y. .Y. .A.T. . .A A.T. .G. .C C .C A C.T. .C. .C. .AATT. A TC.T. T T T. .T. .A.TC. .A A.T C .C.T. .C.TGAT. . . .AA.TC.T T T T T. .A.TC. -A . . .AA . . .AA . ..AA TC.T. . . . TC.T. .T. TC.T. . . . TC.T TC.T. . . . TC.T. . . . TC T T A.. .G..A.. .A. .A.. T. .T. .A.TC. .A .. .A.T. . T. .T. .A.TC .A .. .A.T. . T .T. .A.TC. .A .. .A.T. . .A.TC. .GC . . .A.T. . . .C. -A.T. . .ACG.. . . .A . .C. .A.T.. .CC . -TA.T. . . .C. . .A. .T C. . . .T. .T T A.T. . .CC TA.T C. . X. .C. . .C..G. . T.. T.. A.. .T. -G. . ...C.T C.TGAT... G . ..C.T C.TGAT.. .G ...C.T C.TGAT... G . ..C.T C.TGAT... G . .TC.T. .A. .C. .AATT. .G ..TC.T. .A AATT. .G ...C.T..C T. ..C TA.G. .T C.C .C TT. .C. .T. .A T T... . .T..A..T A..T . . .A .03... CA. CA. . -CCTCA. .CCCACG. .GG.G.CA. . .G.G.CA. . .G.A.CA. . .G.A.CA. . .G.A.CT. . .G.G.CA. ..G.A.CA. . .G.A.CG. . .G.A.CA. . .G.A.CA. .TO.. .CA. .TG...CA. .CG.A.C. T. .A. -CG .03T .CGT.A. . .TG . .G.T.. . .T3 .TO .CG.T. .T 03 CG .CG .03 .03 .03.. . .G.G .TT. . ..T ..T ..T ..T ??? ..T TC T..A. .C T..T..G..C T T C.C A C C. .C T C GAT. . .AG.G C ..GG..??? GC.A A A A. .T A.T. . .CC.C A C A TC A. ,C .T.TA. .A A.C G CC.T G T T A.T. . .AC.C TA C C T. .G T CG. .C AAT. . .C. . .G. . -CA. -T T .C.T. .T C G. .C C.T GCTA. .ACT A. . -T. . .C C T. -T. .T. .T T. . .C.T. .A AATTA.A. .C. .OCT. . .C . .A.T CG.T AA.C A G A. .C ACT3. .ACT A. . .T. . .C .G. .C A. A. A CG. .C TA. .G. .C. .C.C .C. . .C. .TAG. .G. . . -T. -A. .A T G. .T. .C .C .T T CC T. . .T.C OC.C A T. .T TC.ACT. .C . .A. A.T. . .GT.G3. ,CTT. .C. -A. . . CT.A TT.G T C TEA. .OCT T. .T.T. . .C CC T T G T G. -C. -A. . -G.C . .G G T TT T T GTT. . .C CT3. .GC.T T C.C A T. .A. .T T. .TC A A G. .C .CCA. -C .A. . . Figure 3 (continued) the inferred number of substitutions (Table 3). For example, if a nucleotide site is twofold variable, i.e. if two bases occur at that position in an alignment of all species, then at least one base substitution has occurred at that position during the evolutionary his- tory of the species concerned. Likewise, if a position is threefold variable, at least two substitutions have occurred, and so on. By this approximation, the 293 variable positions have experienced at least 521 sub- stitutions, and substitutions at the third position outnumber substitutions at the first and second po- sitions by nearly 4 to 1 and by more than 12 to 1, respectively. Figure 2 presents a phylogeny of the Scombroidei based on an unweighted parsimony analysis of all informative nucleotide sites. In this cladogram, only the relationships among recently diverged taxa are strongly supported. There is support for the mono- phyly of genera within the family Scombridae (Thunnus, Euthynnus, Sarda, Scomber, and Scorn- Finnerty and Block: Evolution of cytochrome b in the Scombroidei 87 Table 3 Variable sites in the cytochrome 6 nucleotide alignment (Fig. 2) according to codon position. Variable sites are fur- ther characterized according to how many nucleotide states are present: 2 states=twofold variable, 3 states=threefold variable, fourstates=fourfold variable. Total sites Variable sites A) twofold variable sites B) threefold variable sites C) fourfold variable sites Minimum inferred substitutions = [(A) + 2(B) + 3(C)] Phylogenetically informative variable sites Codon position 1 2 3 Total 196 197 197 590 72 29 192 293 50 27 69 146 15 2 49 66 7 74 81 101 31 389 521 42 18 188 248 beromorus), and for the monophyly of the family Istiophoridae. Interrelationships within the family Istiophoridae and the genus Thunnus are well resolved. No other nodes are supported by more than fifty per- cent of bootstrap replicates (Felsenstein, 1985). Fur- thermore, there is a substantial polychotomy. Weighted nucleotide analysis The lack of resolution in the unweighted nucleotide analysis is not entirely unexpected. From Table 3, we can surmise that many nucleotide sites have in- curred multiple substitutions and therefore the like- lihood of convergent substitutions or reversals is high. In order to minimize the confounding effects of these homoplasious base substitutions, we have weighted infrequent substitution types more heavily using a modification of the method of Knight and Mindell (1993). If we disregard the direction of char- acter change, we can place all nucleotide substitu- tions into six classes : A<=>G, C<=>T, G<=>T, G<=>C, A<=>T, and A<=>C. Through pairwise sequence comparisons we obtained observed counts for each of these sub- stitution types (Table 2; also see Methods section). We observe a nearly 50-fold difference between the most common (Cc=>T) and the least common (G<=>T) substitution types. Then, from the total number of observed substitutions and the observed frequency of each base, we derived the expected number of oc- currences for each substitution type. The ratios of expected occurrences to observed occurrences for each substitution type (EOR's) were then used to weight the six types of base substitutions. The result of this weight- ing scheme is that substitution types that occur less frequently than expected are weighted more heavily. A phylogeny based on EOR weighting of nucleotide substitutions is presented in Figure 4. It retains all of the strongly supported nodes that appear in the unweighted topology. In addition, the weighted to- pology contains three more basal nodes that are strongly supported by the bootstrap analysis (>50%): the node uniting Gempylidae, Scombridae, and Trichiuridae, the node uniting Xiphiidae and Istiophoridae, and the node uniting Auxis and Euthynnus. This suggests that the character weight- ing scheme has accomplished its goal to some extent: we have retained the phylogenetic signal from rap- idly evolving substitutions while emphasizing the phy- logenetic signal from slowly evolving substitutions. According to the weighted cladogram (Fig. 4), all scombroids fall into two clades. The billfishes com- prise one clade consisting of a monophyletic Istiophoridae and its sister group, Xiphiidae. All other scombroids (Gempylidae, Scombridae, and Trichiuridae) fall into a separate clade. This major split within the suborder Scombroidei is in agree- ment with our previous study (Block et al., 1993). However, in contrast with our previous study, the use of character weighting and the inclusion of more distant outgroups leads to the result that the subor- der Scombroidei is not monophyletic. On the most parsimonious tree, Sphyraena and Coryphaena share a common ancestor with the gempylid-scombrid- trichiurid clade to the exclusion of billfishes, though this node does not receive particularly strong sup- port from the bootstrap analysis. This result indi- cates some support for the hypothesis that billfishes are not scombroids. More importantly, the cladogram excludes the possibility that billfishes and scombrids comprise a monophyletic group within the Scombroidei, as required by the scombrid subgroup and scombrid sister group hypotheses. In summary, the weighted analysis agrees with the nonscombroid hypothesis and conflicts with the scombroid subgroup and scombroid sister group hypotheses. Amino acid analysis Amino acid substitutions occur far less frequently than nucleotide substitutions owing to the strong functional constraints on many regions of the mol- ecule. Cytochrome b is a component of the electron transport chain and spans the inner mitochondrial membrane. The portion of the gene sequenced in this study encodes 195 amino acids corresponding to resi- dues 46 through 240 of the human cytochrome b (Fig. 5). 88 Fishery Bulletin 93|1). 1995 Isliophorus platypterus Makaira nigricans Tetraphtrus albidus Tetrapturus audax Tetrapturus anguslirostris Tetrapturus pfluegeri Tetrapturus belone Makaira indica Xiphias gladius Xiphiidae Thunnus alalunga Tlumnus albacares Thunnus maccoyii Thunnus thynnus Thunnus obesus Katsuwonus pelamis Euthynnus affinis Euthynnus alletteratus Auxis thazard Sarda chiliensis Sarda sarda Scombridae + Gempylidae Scomber japonicus Trichiuridae Scomber scombrus Trichiurus lepturus Scomberomorus cavalla Scomberomorus maculata Acanlhocybium solandri Ruvettus pretiosus Lepidocybium flavobrunneum Gasterochisma melampus Gempylus serpens Sphyraena sphyraena Coryphaena equiselis Morone saxatilis Mycteroperca interstitialis Crossostoma lacustre Cyprinus carpio Figure 4 Phytogeny of the Scombroidei based on a weighted, maximum parsimony analysis of informative nucleotide sites. The six types of nucleotide substitutions are weighted according to the ratio of their expected occurrence to their observed occurrence (see Table 3). Weights used for each sub- stitution type are the following: A«=>G=1, CoT=l, Gt=>T=13, GoC=4, A<=>T=2, and AoC=2. Crossostoma and Carpio were specified as the outgroup. The tree depicted is the single most parsimonious topology identified in a heuristic search: TBR branch swapping was performed on 10 starting trees generated through random stepwise addition of taxa. Tree length is 2,348 steps. PAUP 3.1. was unable to derive consistency and retention indices for the cladogram that incorpo- rated the weighting scheme. Circled numbers at nodes indicate the percentage of trials in which a given partition between taxa is supported in 1,000 replications of the bootstrap analysis (Felsenstein, 1985). This fragment spans four transmembrane domains and includes part of the region implicated as the outer membrane redox reaction center (Howell and Gilbert, 1988; Howell, 1989; Fig. 6). In a comparison of the inferred peptide sequences across the 36 species in- cluded in this study, 134 (69%) of the 195 amino acid residues are invariant, 34 (17%) occur in 2 amino acid states, and 27 (14%) occur in 3 or more states. Fmnerty and Block: Evolution of cytochrome b in the Scombroidei 89 Carpio Crossostcira Myctoperca Morcne Coryphaena Sphyraena Xiphias Istiophoridae (8) Thunnus (5) Euthynnus (4*) Sarda (2) Sccrrbertmorus c. Scorrberonrtrus m. Acanthocybium C^sterochisra Scxrrber japonicus Scarber scarbrus Gerrpylus Lepidocybium Ruvettus Trichiurus Carpio Crossostcira Myctoperca Morone Coryphaena Sphyraena Xiphias Istiophoridae (8) Thunnus {5} Euthynnus (4*) Sarda (2) Scccrbertmorus c. Scarberomorus m. Acanthocyiun Gastercchisma Sconber japonicus Scomber sccnbrus Genpylus Lepidocybium Ruvettus Trichiurus Alignment of in otide sequences gies) and the a sequence withi among the gen< studies are un 1993). 10 20 30 40 50 60 70 80 90 LTuLFIAMHYTSDISTAFSSViraCRI^^ I.. I SP. . -M. ... P.VES. LOO 110 Tyrmr .t .qAVPVMTwr 120 130 140 150 160 170 180 190 X^WlTOa^SVINAXLTOFFAFBFLLPFVIAAOTIEIi^^ .1 AAL.I... .IP AAV.VG. . .IP V. ..TVL.VL. . .1 AAL.IG.. .1 T AVL.V. .S .1 T AVL.M3.. Figure 5 ferred amino acid sequences. The amino acid sequences were inferred from the nucle- presented in Figure 3 by using the translation option of Mac Vector (IBI technolo- nimal mitochondrial genetic code. There was no variation in inferred amino acid i the family Istiophoridae, within the genus Thunnus, within the genus Sarda, nor traAuxis, Euthynnus, and Katsuwonus. Conserved positions identified by previous ierlined in the query sequence, Carpio (Howell and Gilbert, 1988; Esposti et al., This level of variability in amino acid sequence is very similar to that reported in a study of placental mammals, a group whose divergence times are prob- ably comparable to scombroids (Irwin et al., 1991). Much of the variation in scombroid cytochrome b occurs in the transmembrane portion of the molecule and represents substitutions between hydrophobic residues (leucine, isoleucine, and valine). The larg- est stretches of invariant residues (21 and 17) occur in a region implicated as part of the Q o redox reac- tion center (Howell and Gilbert, 1988; Howell, 1989; Fig. 6). All of the functionally constrained sites iden- tified by previous studies are conserved throughout the fishes included in this study (see Fig. 5; Howell and Gilbert, 1988; Esposti et al., 1993). Figure 7 presents a parsimony analysis based on 38 informative amino acid sites. The amino acid se- quences do not provide information about more re- cent speciation events because they evolve very slowly, but they contain important evidence about the relationship of billfishes to other scombroids. The amino acid analysis shares two important similari- ties with the weighted nucleotide analysis: first, Scombridae, Gempylidae, and Trichiuridae comprise a clade, and second, Sphyraena and Coryphaena share a common ancestry with this Scombridae- Gempylidae-Trichiuridae assemblage to the exclusion of the billfishes (Xiphiidae and Istiophoridae). The node uniting Sphyraena with the scombrid-gempylid- trichiurid clade is one of the more strongly supported nodes according to the bootstrap analysis. Therefore, cytochrome b amino acid substitutions support the non- scombroid hypothesis and conflict with the scombrid subgroup and scombrid sister group hypotheses. 90 Fishery Bulletin 93(1). 1995 NHj COOH Figure 6 Variability in amino acid sequence superimposed over a structural model for cyto- chrome b (Howell, 1989). Hypervariable residues, present in three or more amino acid states, are indicated by solid circles. Variable residues, present in two states, are indicated by open circles. The amino acids present at invariant residues are specified on the diagram. Residue 1 of this fragment is equivalent to the forty-sixth residue from the amino terminal of the protein in humans. The strength of the evidence that billfishes are not scombroids can be emphasized by directly examining the amino acid characters that are informative about this issue. Of the 38 informative amino acid sites, no sites unite billfishes and other scombroids to the ex- clusion of other perciforms, whereas eight sites unam- biguously separate billfishes from all other scombroids, i.e. sites where all billfishes possess one character state and all other scombroids possess some other character state (characters 12, 14, 15, 16, 113, 117, 140, and 169; Fig. 5). At all of these sites, billfishes share the same character state as one or more of the percoid fishes. Furthermore, at three of these eight sites (15, 16, and 169), Gempylidae, Scombridae, and Trichiuridae share a common state with Sphyraena to the exclusion of all other species in the study As this character analysis emphasizes, the amino acids are consistent with the hypothesis that billfishes are not scombroids and that Sphyraena is the sister group of a clade consisting of Gempylidae, Scombridae, and Trichiuridae. Intrafamilial relationships Within the family Istiophoridae (Istiophorus, Makaira, and Tetrapturus), cytochrome b nucleotide sequence provides a particularly well resolved and strongly sup- ported phylogenetic signal. This is probably due to the recency of the istiophorid radiation. The maximum se- quence divergence between any two species within this clade is less than five percent. We have performed a more in depth analysis of the interrelationships of istiophorids using the exhaustive search option of PAUP 3.1 (Swofford, 1991). Use of the exhaustive search op- tion guarantees identification of the most parsimoni- ous tree. The topology of this tree is identical to the topology of the istiophorid clade within the more inclu- sive scombroid phylogeny (Fig. 8, cf. Fig. 2). Neighbor- joining and UPGMA analyses produce an identical to- pology. Computer simulations suggest that agreement between these three methods should increase our con- fidence in a phylogenetic hypothesis (Kim, 1993). Finnerty and Block: Evolution of cytochrome b in the Scombroidei 91 / Sarda // Auxis-Euthynnus-Katsuwonus /// Thunnus /y^^ Gasterochisma VI n O ■^^ ifa / Scomberomorus cavalla Scomberomorus maculata 3 a CL V n + /%. (84) <^ /^ \^v O 1 r MK \\ / Acanthocybium T3 y\\\ \^\ Lepidocybium El n ,/ \\\ \^ Gempylus + H T); V=nucleotide transversions (C/T<=>A/G). Within the Istiophoridae transitions outnumber transversions 54 to 6. Neighbor-joining (Saitou and Nei, 1987) and UPGMA den- drograms produced with Phylip 3.5 (Felsenstein, 1993) have the same topology. Distance trees were constructed by using Kimura's (1980) two parameter genetic distance, and by assuming a tran- sition to transversion bias of 9:1. of cytochrome b does not support the monophyly of the genus Makaira. The black marlin, Makaira indica, appears to be the sister group of a clade con- taining all other istiophorids, while the blue marlin, M. nigricans, is sister group of the sailfish, /. platypterus. The most parsimonious tree that contains a monophyletic Makaira is six steps longer than the shortest tree overall (158 ver- sus 152), and on the most parsimonious tree, the M. nigricans-I. platypterus node is strongly supported by bootstrap analysis (85%). Cytochrome b provides good resolution of the relationships of the genera of the tribe Thunnini (Auxis, Euthynnus, Katsuwonus, and Thunnus). According to the nucleotide data the nine Thunnini species sequenced in this study com- prise two clades, one consisting of the genus Thunnus and one containing the other genera: Auxis, Euthynnus, and Katsuwonus. This dis- tinct split in the Thunnini was proposed by Kishinouye in 1923 and is consistent with the mor- phological hypothesis of Collette et al. (1984). Support for the monophyly of the Thunnus clade is particularly robust; however, the relation- ships within the genus cannot be resolved with- out the inclusion of both Thunnus tonggol and Thunnus atlanticus which were not sequenced in this study. The number of substitutions sepa- rating T. thynnus from T. maccoyii (<0.5% se- quence divergence) are small considering their status as separate species. Discussion Interfamilial relationships and the limits of the Scombroidei Throughout this analysis, we have focused on the long-standing controversy over the limits of the Scombroidei and, particularly, whether billfishes are scombroids. Cytochrome b appears to be informative on this issue. In the two phy- logenetic analyses that emphasize the more slowly evolving characters (see Figs. 4 and 7), the most parsimonious tree topology is clearly most consistent with the hypothesis that bill- fish are not scombroids: in each case, one or more nonscombroids share a common ancestry with the scombrid-gempylid-trichiurid clade to the exclusion of billfishes (Table 4). Therefore, according to the criterion of parsimony, the nonscombroid hypothesis is superior to the scombrid subgroup and to the scombrid sister group hypotheses. However, in our opinion, the Finnerty and Block: Evolution of cytochrome b in the Scombroidei 93 most parsimonious trees alone do not constitute suf- ficient evidence to reject these unfavored hypotheses. The question we must ask is the following: How unparsimonious are these hypotheses? In comparing the tree topologies that support each competing hypotheses (Table 4), it is clear that our data refute the notion that billfishes share a com- mon ancestor with the Scombridae to the exclusion of other scombroids (Gregory and Conrad, 1937; Berg, 1940; Fraser-Brunner, 1950; Collette et al., 1984; Johnson, 1986). For example, the shortest trees sup- porting a billnsh-scombrid clade are 13% longer than the minimum-length tree based on inferred amino acid sequence (Table 4). According to the cladistic permutation test for nonmonophyly (Faith, 1991), this length difference constitutes significant evidence against the monophyly of scombrids plus billfishes. The condition that billfishes and scombrids comprise a monophyletic group is a requirement of both the scombrid subgroup and scombrid sister group hypoth- eses. Therefore, according to the cytochrome b data, we reject these two hypotheses. The cytochrome b data clearly support the third hypothesis, that billfishes are not scombroids, though not as strongly as they refute the first two hypoth- eses. According to the inferred amino acid sequences, the shortest tree that supports scombroid monophyly places billfishes as sister group to all other scom- broids and is nearly 3% longer than the most parsi- monious tree overall (145 versus 141 steps). This length difference alone does not constitute signifi- cant evidence against the monophyly of the Scom- broidei according to a cladistic permutation test for nonmonophyly (see Methods section; Faith, 1991). However, as previously mentioned, there are three amino acid characters that unite scombrids, gempylids, and trichiurids with Sphyraena to the exclusion of billfishes (amino acids 15, 16, and 169). There are no characters that unite scombrids, gempylids, and trichiurids with billfishes to the ex- clusion of the putative outgroups. Our study is con- sistent with the hypothesis that billfishes are most closely related to some percoid lineage (Nakamura, 1983; Potthoff et al., 1986). The question of which taxon is most closely related to billfishes remains unanswered. On the basis of this evidence, we sup- port a conservative definition of the Scombroidei, including only the families Scombridae, Gempylidae, Table 4 Comparison of three competing hypotheses of billfish (Istiophoridae and Xiphiidae) relationships based on inferred amino acid sequences from cytochrome 6. 'na' = not applicable. Characteristics of tree which would support hypothesis Hypothesis I: Scombrid subgroup II: Scombrid sister group III: Nonscombroid Scombridae + billfishes are Billfishes are sister group of a a monophyletic group monophyletic Scombridae Acanthocybium is the sister group of billfishes Billfishes do not compose part of a monophyletic group with any other scombroid taxon or taxa Does the most parsimonious tree support the hypothesis? No No Yes If the answer to B is no, how much longer is the shortest tree which does support the hypothesis? 13.5% 13.0% (160 steps vs. 141 steps) (159 steps vs. 141 steps) na Based on the increase in tree length, can we reject the underlying hypothesis with statistical significance? Yes Yes (T-PTP = 0.01) (T-PTP = 0.01) na 1 The topology dependent permutation tail probability ( T-PTP; Faith, 1991) was used to determine the difference. Values of T-PTP<0. 05 were considered significant. See Methods section. significance of the length 94 Fishery Bulletin 93(1), 1995 and Trichiuridae (Cuvier and Valenciennes, 1832; Gosline, 1968; Potthoffet al., 1986). How can these inferences from molecular data be reconciled with the morphological data? We believe that this is an instance where molecular data comple- ment morphological data well. Cytochrome b provides an unambiguous phylogenetic signal that billfishes are genetically distant from other scombroids. In contrast, the existing morphological data does not clearly discriminate between a number of hypoth- eses. The number of character reversals in morpho- logical phylogenies that classify billfishes as scom- broids indicates that there have been many ho- moplastic changes in the billfish lineage. According to the morphological evidence, either billfishes are scombroids and have undergone several reversals to the primitive state, such as their low number of ver- tebrae, or billfishes are not scombroids but have evolved many convergent similarities to scombroids, such as their paired lateral caudal keels. Many of the morphological characters that unite billfishes to other scombroids, particularly to Scom- bridae, may be adaptations for continuous swimming, and are therefore of questionable phylogenetic value. These include hypurostegy, the projection of the cau- dal fin-ray bases anteriorly to cover the hypurals (Col- lette et al., 1984; Johnson, 1986), fusion of the hypurals (Collette et al., 1984; Johnson, 1986), and inter- filamentar gill fusion (Johnson, 1986). Hypurostegy and interfilamentary gill fusion are known to have evolved convergently in nonscombroid taxa (Luvarus imperialis [Leis and Richards, 1984]; and Amia calva [Bevelander, 1934]). The molecular data presented here provide a phylogenetic signal that is indepen- dent of convergent morphological adaptations that might confound phylogenetic analysis. There has been convergent evolution in the molecular characters, but unlike many of the morphological characters men- tioned, this convergent evolution does not appear to be the result of strong selection: most amino acid substi- tutions exchange amino acids with similar size, charge, and degree of polarity. Therefore, when compared with the existing morphological data, the phylogenetic sig- nal in the molecular data is less likely to have been obscured by similar selective pressures acting upon distantly related lineages. Istiophorid phylogeny Historically, there have been numerous disagree- ments over the number of species within the Istiophoridae and their interrelationships (Goode, 1882; Jordan and Evermann, 1926; LaMonte and Marcy, 1941; Nakamura, 1983). This is evidenced by the synonymies for many istiophorids, e.g. the Medi- terranean spearfish, Tetrapturus belone, has also been assigned to Istiophorus (Ben-Tuvia, 1953) and Makaira (Tortonese, 1958). The most thorough treat- ment of billfish systematics to date is a phenetic analysis conducted by Nakamura (1983). Nakamura recognized 11 species of istiophorid billfishes in three genera, including the designation of separate Atlan- tic and Indo-Pacific species for blue marlin (Makaira nigricans and M. mazara) and sailfish (Istiophorus albicans and /. platypterus). The molecular evidence presented here agrees with Nakamura ( 1983) in supporting the monophyly of the genus Tetrapturus, and within this genus, clades con- sisting of audax + albidus and pfluegeri + angus- tirostris + belone. Cytochrome b does not support the recognition of separate Atlantic and Pacific species of blue marlin and sailfish. Previous results (Finnerty and Block, 1992) identified substantial overlap in the cytochrome b haplotypes found among Atlantic and Pacific populations of blue marlin. The sailfish sample in this study includes one Atlantic specimen and one Pacific specimen that differ at only two sites among 590 (0.3%). We infer from the cytochrome b data (Block et al., 1993; and this study) a nonmono- phyletic Makaira and support for a clade consisting of the blue marlin (Makaira nigricans) and the sail- fish (Istiophorus platypterus). Based on the cytochrome b data, istiophorid tax- onomy at the generic level is not concordant with phylogeny. It is premature to suggest taxonomic re- vision of istiophorid genera, but we believe it is im- perative to obtain more molecular data, particularly from nuclear genes, to determine whether the infer- ences presented here can be corroborated. Further- more, we recognize the need for an extensive cladis- tic analysis of istiophorid relationships based on ad- ditional morphological data. Another taxonomic is- sue raised by this study concerns the number of valid Tetrapturus species. An extensive genetic survey of several populations from each species is required to determine the number of evolutionarily independent or reproductively isolated lineages within this genus. Relationships within the genus Thunnus The systematics of the genus Thunnus have been well studied owing to the commercial importance of tu- nas and interest in physiological specializations as- sociated with the evolution of endothermy Collette (1978) suggested a taxonomic subdivision of the ge- nus reflecting a split between tropical species (sub- genus Neothunnus: blackfin tuna, Thunnus atlan- ticus, longtail tuna, Thunnus tonggol, andyellowfin tuna, Thunnus albacares) and species that inhabit cooler waters (subgenus Thunnus: bluefin tuna, Finnerty and Block: Evolution of cytochrome b in the Scombroldei 95 Thunnus thynnus, southern bluefin tuna, Thunnus maccoyii, albacore, Thunnus alalunga, and bigeye tuna, Thunnus obesus). According to this hypothesis, the primitive condition for the genus Thunnus is a tropical distribution, and the cold water tunas com- pose a monophyletic group united by specializations that allowed them to exploit cooler temperate or deep waters. The nucleotide analyses presented in Fig- ures 2 and 4 are not consistent with this hypothesis. The cytochrome b phylogeny groups a tropical spe- cies, the yellowfin tuna, Thunnus albacares, with two species adapted for extremely cold water, the blue- fin tuna and southern bluefin tuna (Thunnus thynnus and Thunnus maccoyii). However, it is premature to draw conclusions about relationships within the ge- nus Thunnus until data are obtained from two tropi- cal species not included in this study, Thunnus atlanticus and Thunnus tonggol. Acknowledgments We thank A. Stewart, J. Kidd, A. Borisy, S. Eng, S. Malik, D. Wang, F. Manu, and V. Master for techni- cal assistance. We are indebted to C. Proctor, P. Grewe, G. DeMetrio, P. Davie, J. Pepperell, K. Dickson, B. Collette, and F. Carey for tissue samples. B. Collette, D. Johnson, J. Graves, and M. Westneat provided valuable assistance on the project and con- structive comments on the manuscript. This research was supported by NSF grant IBN8958225 to B. A. B. and NEH molecular biology training grant IBN8958225 and a Sigma Xi Grant-in-aid of Research to J. R. F. Literature cited Bannikov, A. F. 1985. Fossil scombrids of the USSR. Tr. Paleontol. Inst. Akad. Nauk SSSR 210:59-90. Ben-Tuvia, A. 1953. Mediterranean fishes of Israel. Bull. Sea Fish. Sta. Haifa 8:1-40. Berg, L. S. 1940. Classification of fishes both recent and fossil. Tr. Zool. Inst. Akad. Nauk SSSR 5<2):87-517. [In Russian.] Bevelander, G. 1934. The gills of Amia calva are specialized for respira- tion in an oxygen deficient habitat. Copeia 1934:123-127. Block, B. A. 1986. Structure of the brain and eye heater tissue in mar- lins, sailfish, and spearfishes. J. Morphol. 190:169-189. Block, B. A., J. R. Finnerty, A. F. R. Stewart, and J. Kidd. 1993. Evolution of endothermy in fish: mapping physiologi- cal traits on a molecular phylogeny. Science 260:210-214. Carroll, R. L. 1988. Vertebrate paleontology and evolution. W.H. Free- man and Co., New York. Casanova, J. L., C. Pannetier, C. Jaulin, and P. Kourilsky. 1991. Optimal conditions for directly sequencing double- stranded PCR products with sequenase. Nucl. Acids Res. 18(13):4028. Chang, Y.-S., Huang, F.-L., and T.-B. Lo. 1994. The complete nucleotide sequence and gene organi- zation of carp (Cyprinus carpio) mitochondrial genome. J. Mol. Evol. 38:138-155. Collette, B. B. 1978. Adaptations and systematics of the mackerels and tunas. In G. D. Sharp and A. E. Dizon (eds.), The physi- ological ecology of tunas. Academic Press, New York P- 7-39. Collette, B. B., T. Potthoff, W. J. Richards, S. Ueyanagi, J. L. Russo, and Y. Nishikawa. 1984. Scombroidei: development and relationships. In H. G. Moser et al. (eds.), Ontogeny and systematics of fishes. Allen Press, Lawrence, KS, p. 591-620. Cuvier, G., and A. Valenciennes. 1832. Histoire naturelle des poissons 8:1-509. Eschmeyer, W. N. 1990. Catalog of the genera of recent fishes. California Academy of Sciences, San Francisco, 697 p. Esposti, M. D., S. De Vries, C. Massimo, A. Ghelli, T. Patarnello, and A. Meyer. 1993. Mitochondrial cytochrome 6: evolution and structure of the protein. Biochimica et Biophysica Acta 1143:243-271. Faith, D. P. 1991. Cladistic permutation tests for monophyly and non- momophyly. Syst. Zool. 40(3):366-375. Felsenstein, J. 1993. PHYLIP (Phylogeny Inference Package), version 3.5. Distributed by the author, Univ. Washington, Seattle, WA. 1985. Confidence limits on phylogenies: an approach using the bootstrap. Evolution 39:783-791. Finnerty, J. R., and B. A. Block. 1992. Direct sequencing of cytochrome 6 reveals highly di- vergent haplotypes in blue marlin, Makaira nigricans. Mol. Mar. Biol. Biotech. 1:206-214. Fraser-Brunner, A. 1950. On the fishes of the family Scombridae. Annu. Mag. Nat. Hist., Ser. 12(3):131-163. Goode, G. B. 1882. The taxonomic relationships and geographical dis- tribution of the members of the swordfish family, Xiphiidae. Proc. U.S. Natl. Mus. 4:415^33. Gosline, W. A. 1968. The suborders of perciform fishes. Proc. U.S. Natl. Mus. 124(3647):l-78. Greenwood, P. H., D. E. Rosen, S. H. Weitzman, and G. S. Meyers. 1966. Phyletic studies of teleostean fishes, with a provi- sional classification of living forms. Bull. Am. Mus. Nat. Hist. 131:339-456. Gregory, W. K. 1933. Fish skulls: a study of the evolution of natural mechanisms. Trans. Am. Philos. Soc. 28(2):75^81. Gregory, W. K., and G. M. Conrad. 1937. The comparative osteology of the swordfish (Xiphias) and the sailfish (Istiophorus). Am. Mus. Novit. 952:1-25. GyUensten, U. B., and H. A. Erlich. 1988. Generation of single-stranded DNA by the polymerase chain reaction and its application to direct sequencing of the HLA-DQA locus. Proc. Natl. Acad. Sci. U.S.A. 85:7652-7656. Howell, N. 1989. Evolutionary conservation of protein regions in the 96 Fishery Bulletin 93(1), 1995 proton-motive cytochrome b and their possible roles in re- dox catalysis. J. Mol. Evol. 39:157-169. Howell, N., and K. Gilbert. 1988. Mutational analysis of the mouse mitochondrial cy- tochrome 6 gene. J. Mol. Biol. 203:607-618. Irwin, D. M., T. D. Kocher, and A. C. Wilson. 1991. Evolution of the cytochrome b gene of mammals. J. Mol. Evol. 32:128-144. Johnson, G. D. 1986. Scombroid phylogeny: an alternative hypothe- sis. Bull. Mar. Sci. 39(1):1-41. Jordan, D. S., and B. W. Evermann. 1926. A review of the giant mackerel-like fishes, tunnies, spearfishes and swordfish. Occas. Pap. Calif. Acad. Sci. 12:1-113. Kim, J. 1993. Improving the accuracy of phylogenetic estimation by combining different methods. Syst. Biol. 42(3):331-341. Kimura, M. 1980. A simple method for estimating evolutionary rates of base substitutions through comparative studies of nucle- otide sequences. J. Mol. Evol. 16:111-120. Kishinouye, K. 1923. Contributions to the study of the so-called scombroid fishes. J. Coll. Agric, Imp. Univ., Tokyo 8:293-475. Knight, A., and D. P. Mindell. 1993. Substitution bias, weighting of DNA sequence evo- lution, and the phylogenetic position of Fea's viper. Syst. Biol. 42(1):18-31. Kocher, T. D., W. K. Thomas, A. Meyer, S. V. Edwards, S. Paabo, F. X. Villablanca, and A. C. Wilson. 1989. Dynamics of mitochondrial DNA evolution in animals: amplification and sequencing with conserved primers. Proc. Natl. Acad. Sci. U.S.A. 86:6196-6200. LaMonte, F. R., and D. E. Marcy. 1941. Swordfish, sailfish, marlin, and spearfish. Ichthyol. Contrib. Int. Game Fish Assoc. l(2):l-24. Leis, J. M., and W. J. Richards. 1984. Acanthuroidei: development and relationships. In H. G. Moser et al. (eds.), Ontogeny and systematics of fishes. Allen Press, Lawrence, KS, p. 547-551. Lutken, C. F. 1880. Spolia Atlantica. Dansk. Vid. Selsk. Skrift. Copen- hagen, Ser. 5, 12:409-613. McDowell, J. R., and J. E. Graves. In review. Genetic analysis of billfish population structure. Nakamura, I. 1983. Systematics of the billfishes (Xiphiidae and Istiophoridae). Publ. Seto Mar. Biol. Lab. 28:255-396. Potthoff, T., W. J. Richards, and S. Ueyanagi. 1980. Development of Scombrolabrax heterolepis (Pisces, Scombrolabracidae) and comments on familial relationships. Bull. Mar. Sci. 30:329-357. Potthoff, T., S. Kelley, and J. C. Javech. 1986. Cartilage and bone development in scombroid fishes. Fish. Bull. 84:647-678. Regan, C. T. 1909. On the anatomy and classification of the scombroid fishes. Annu. Mag. Nat. Hist., Ser. 8, 3:66-75. Saitou, N., and M. Nei. 1987. The neighbor-joining method: a new method for recon- structing phylogenetic trees. Mol. Biol. Evol. 4:406-425. Swofford, D. L. 1991. PAUP: phylogenetic analysis using parsimony, Ver- sion 3.1. Computer program distributed by the Illinois Natural History Survey, Champaign, IL. Thomas, W. K., and A. T. Beckenbach. 1989. Variation in salmonid mitochondrial DNA: evolution- ary constraints and mechanisms of substitution. J. Mol. Evol. 29:233-245. Tortonese, E. 1958. Elenco dei leptocardi, ciclostomi, pesci cartilaginei ed ossei del Mare Mediterraneo. Atti. Sco. Ital. Sci. Nat. 97(4):309-345. Tyler, J. C, G. D. Johnson, I. Nakamura, and B. B. Collette. 1989. Morphology ofLuvarus imperialis (Luvaridae), with a phylogenetic analysis of the Acanthuroidei (Pisces). Smithson. Contrib. Zool. 485:1-78. Tzeng, C.-S., S.-C. Shen, and P. C. Huang. 1990. Mitochondrial DNA identity of Crossostoma (Homalopteridae, Pisces) from two river systems of the same geographical origin. Bull. Inst. Zool. Acad. Sin. 29:11-19. Abstract. — Three species of nephropid lobsters have been rec- ognized in the genus Homarus: the American and European lobsters, H. americanus and H. gammarus of the northwestern and northeast- ern Atlantic, respectively, and the Cape lobster of South Africa, H. capensis, few specimens of which have been studied until recently. Analysis of new specimens allows reconsideration of the systematic status of this species and a subse- quent transfer to a monotypic new genus Homarinus. Far smaller than its northern relatives, with a maximum observed carapace length of 47 mm, the Cape lobster has first chelae adorned with a thick mat of plumose setae and less abundant setae on the carapace, tail fan, and abdominal pleura, whereas these setae are absent in Homarus. Relative length and shape of the carpus on pereopod 1, tooth pattern on cutting edges of first chelae, shape of the linguiform rostrum, large size of oviducal openings, and structure of male pleopods differ from corresponding features in Homarus. Comparative analysis of DNA from the mito- chondrial 16s rRNA gene demon- strated considerable sequence di- vergence of the Cape lobster (9.7%) from its putative congeners. The magnitude of this estimate relative to that between the two North At- lantic species (1.3%) further sug- gests that taxonomic revision is warranted. Assignment of Homarus capensis (Herbst, 1 792), the Cape lobster of South Africa, to the new genus Homarinus (Decapoda: Nephropidae) Irv Kornfield Department of Zoology and Center for Marine Studies University of Maine, Orono. Maine 04469 Austin B. Williams National Marine Fisheries Service Systematics Laboratory National Museum of Natural History. Smithsonian Institution Washington, DC 20560 Robert S. Steneck Department of Oceanography and Ira C. Darling Center University of Maine, Walpole, Maine 04573 Manuscript accepted 25 September 1994. Fishery Bulletin 93:97-102 (1995). Until now, three species of neph- ropid lobsters have been recognized in the genus Homarus Weber, 1795 (see Holthuis, 1991)://. americanus H. Milne-Edwards, 1837, the north- western Atlantic American lobster; H. gammarus (Linnaeus, 1758), the northeastern Atlantic-Mediterra- nean European lobster; andH. cap- ensis (Herbst, 1792), the South Af- rican Cape lobster. All are found in cool or cold temperate waters, and the North Atlantic species range into subarctic waters. The northern H. americanus and H. gammarus are well-known, abundant, and eco- nomically valuable species, but the southern H. capensis has long been problematic because only a few specimens (13 males, 1 female) were known to exist in collections (Barnard, 1950; Wolff, 1978; Hol- thuis, 1991). Gilchrist (1918) had seen only three specimens and re- marked (p. 46) that "it is a very rare species, and is not even known to Cape Fishermen." Kensley (1981) recorded its distribution in the Cape Province as Table Bay to East Lon- don, and recent new collections ex- tend the range to Transkei (Kado et al., 1994). Regardless of its rarity, sufficient specimens of the Cape lobster, liv- ing and preserved, are now avail- able for analysis of its distribution, morphological, and genetic at- tributes, and systematic status. Results of our studies indicate that this species should be removed from Homarus and placed in a genus of its own; this paper provides sup- porting evidence for this action and offers supplementary descriptive information on the species. Homarinus, new genus Figs. 1-4 Type species — Homarus capensis (Herbst, 1792) by present designa- tion and monotypy. Description — Carapace moderately compressed, narrower than deep, sparsely setose, middorsal carina barely evident on gastric region, ob- solescent on thoracic region posterior to deep cervical groove. Rostrum 97 98 Fishery Bulletin 93(1), 1995 Figure 1 Homarinus capensis (Herbst). Living male, carapace length 3.41 cm, photographed in an aquarium in Sea Fisheries Research Institute, Cape Town, South Africa, by Robert Tarr. (a) Left lateral; (6) dorsal. Kornfield et al.: Cape lobster taxonomy 99 a b d i— 2 — / Figure 2 Male pleopods (pi); mesial views of pi 1 (slight lateral folds on tips not shown in these views), and mesial views of appendix masculina on mesial ramus of pi 2: (a and 6) Homarinus capensis, left (USNM 251452); (c and d) Homarus americanus, right (USNM 13952); (e and f)H. gammarus, right (USNM 2085). Scale is 1 mm; bar 1 applies to c through f\ bar 2 applies to a and 6. linguiform in dorsal view, broad at base where mar- gins coalesce with orbits, margins bearing 4-6 small spines and gradually tapering anteriorly to rather abruptly pointed or narrowly rounded tip, reaching distal 1/3 of penultimate article of antennular peduncle, shallow dorsal concavity running its entire length. Telson and uropods with thick fringe of plumose setae on distal margin and with scattered non- plumose long setae dorsally on these appendages and sixth abdominal segment. Telson as wide at base as long, with lateral margins slightly sinuous and subparallel bearing obsolescent spines and rugae, each side ending in fixed posterolateral spine; ter- minal margin beyond spine broadly convex; distal 1/3 of surface bearing obsolescent transverse rugae. Uropods broadly subovate, sparsely setose on dorsal surface; mesial ramus broadest near posterior mar- gin with width about 0.73 length, row of obsolescent lateral marginal spines ending in fixed posterolat- eral spine; lateral ramus with width about 0.72 length, diaresis well behind midlength bearing row of fixed but irregularly worn spines ending in stron- gest spine at posterolateral angle. Chelae of first pereopods with thick coat of long plumose setae on upper surface of palm, overhang- Figure 3 Homarinus capensis (Herbst), tail fan (from figure in H. Milne-Edwards, 1851). ing extensor margin and distributed a distance along fixed finger; similar setae on mesial surface of car- pus and ventral surface of merus. Fingers not gap- ing; those of major chela with crushing teeth (often worn) opposed from near base to about midlength 100 Fishery Bulletin 93(1). 1995 Ha Hg He Ha Hg He Ha Hg He Ha Hg He Ha Hg He Ha Hg He Ha Hg He Ha Hg He ggtcgcaaacttttttgtcgatatgaactctcaaaataaataacgctgtt 5 atccctaaagtaacttaaatttttaatcaacaancaanggatcanttaca 100 . ca.c.a . t. . cacnnnnnnaaatatctctgtattttaaatttaaacagttacnnaaatta g t c....t..a....a..t tatcatcgtcgccccaacgaaataattntagtatataaataatattaaac c ...t ac.c g t.. tttcaactcatctaattatatactaaattattaagctttatagggtctta . . .t ..a...t g.a tcgtccctttaaaatatttaagccttttcacttaaaagtcaaattcaatt c . . tg . a . tttgtgtttgagacagtttgcttcttgtccaaccattcatacaagcctcc 150 200 250 300 350 ac.t.t. aattaagagactaatgactatgctaccttc 380 . g. nn. Figure 4 Partial sequence for the mitochondrial 16s rRNA gene. Sequences for Homarus americanus (Ha), H. gammarus (Hg), and Homarinus capensis (He) have been deposited with GenBank Accession Numbers U11238, U11246, and U11247 respectively. Dots indicate nucleotides identical with Ha; letters indicate nucle- otide substitutions at the homologous sites. Sites marked 'n' have unresolved nucleotides. ing form -inus, resembling. The gen- der is masculine. Homarinus capensis (Herbst, 1 792), new combination Synonymy— Holthuis (1986:243, fig. 1) gave an exhaustive synonymy for Homarus capensis, and a later (1991:59) less inclusive account. These treatments are so recent and readily available that reiteration here would be unnecessarily redun- dant. Succeeding reference to the species follows. Homarus capensis. — Kado, Kittaka, Hayakawa and Pollock, 1994:72, figs. 2, 3, 4. followed by row of intermittent noncrushing moder- ate conical teeth with 4-6 smaller ones in intervals between them; minor chela with latter pattern of noncrushing teeth on cutting edge of each finger; tips of fingers on each chela curved toward each other and crossing. Carpus of major chela elongate; anterior margin with two prominent spines and smaller ones between, palmar condyle subcircular and flattened, with sug- gestion of spines or tubercles on its anteromesial margin; dorsomesial margin strongly tuberculate and partly obscured by setae; shorter dorsolateral mar- gin also tuberculate but less prominently so; strong low spines on mesioventral margin. Merus bearing subdistal anterolateral spine, well-separated sharp tubercles on mesiodorsal margin, and mesioventral row of fairly uniform small tubercles. Minor chela with similar but less developed orna- mentation; merus with acute spines and spiniform tubercles. Etymology — The name Homarinus is derived from French homard, lobster, and the adjectival combin- Material — Cape Province, South Af- rica. USNM 251451. 16, East Lon- don?, R. Melville-Smith, 92-RMS-O, Nov 1992, regurg., dismembered, carapace length (cl) 26.5 mm, short carapace length (scl) 21 mm, abdo- men length (abdl) 33.0 mm. USNM 251452. 1 6 , southwest Dassen Island [33°26'S, 18°05'E], regurgitated from Sebastichthys capensis, badly crushed and partly dismembered, R.S. Steneck, 92-D-2, 1 Dec 1992, cl 32 mm, scl 25.5 mm. USNM 251453. 19, Still Bay [34°23'S, 21°27'E], dismembered, R. Melville- Smith, RMS7, abdl 45 mm. USNM 251454. 1 9 , Still Bay, regurg., R. Melville-Smith, RMS8, 5 mm, abdl 47 mm. Additional specimens reported to us by R. Melville- Smith, Sea Fisheries Institute, Cape Town: 1 6 , North Dassen Island, tide pool, RSS, 92-D-l, 3 Feb 1992; 19 . Port Alfred, RMS 1; 18, Houghham Park, Algoa Bay; 1 8 , Dassen Island, west side, RMS 3; 1 6 , Cape St. Francis, RMS 4; 18, Cintsa Reef, East London, RMS 5; 1 6 , Sunday's River mouth, RMS 6; 2 6 , Cape St. Francis, RMS 9 and 10; 1 9 , Haga Haga, Transkei coast, RMS 11. Description — As for genus with addition of the fol- lowing details. Abdominal pleura well developed, with rounded angles; pleuron of segment 1 small; pleuron of seg- ment 2 broad, overlapping first and third pleura; pleura 3^t-5 with antero ventral angle rounded, pos- terolateral angle subrectangular; pleuron of segment 6 rounded ventrally, posterolateral angle rounded and confluent with anterolateral angle of telson. Kornfield et al.: Cape lobster taxonomy 101 Telson with dorsal setae distributed in 3 longitu- dinal tracts, central and submarginal on either side; central tuft proximally in midline and another near each anterolateral corner; sparse similar setae on abdominal pleura; lateral ramus of uropod with ven- tral submarginal row of setae laterally. Eyes with distal edge of cornea slightly exceeding level of basicerite tip; this tip reaching to midlength of narrowly rounded antennal scale exceeded by its very strong anterolateral spine (rarely doubled) reaching distal edge of penultimate article in anten- nular peduncle; latter falling short of distal margin of terminal article in antennal peduncle. Epistome with median anterior spine closely flanked at either side by shorter rounded spine. Cheliped of pereopod 1 having fixed finger with narrowed extensor margin set off by shallow submar- ginal groove. Palm with compound row of low for- ward pointing spines and tubercles on flexor surface, similar development on extensor edge originating at carpal condyle and running along proximal margin of palm, across its basal end, and distally for a dis- tance along palm. Oviducal opening on coxa of pereopod 3 oval; its axes 1.3 x 1.8 mm on measured female noted below. Pleopod 1 with distal article broader than shaft and hollowed mesially, forming flattened tubular opening when appressed to opposite member, tip ir- regularly rounded. Pleopod 2 with appendix masculina on mesial aspect of endopod bearing tuft of strong setae at apex. Uropods with protopodite bearing 2 strong spines overhanging proximal end of mesial and lateral ra- mus respectively. Variation — There is minor variation in development of spines, tubercles, etc., among the two females and two males examined. According to Stebbing (1900), sides of the rostrum may have 5, 6, or 7 spines on the margin. Density of setae on exoskeletal parts is subject to considerable variation, owing perhaps to recency of molting, age, or abrasion after preservation. Color — Color of a living animal is shown in Figure 1. Published records summarized by Holthuis (1986) indicate that color may depart considerably from that shown here: coral-red to tawny or reddish yellow, which may have resulted from postmortem changes; or, in the fresh state, "of a rather dark olive colour, not dissimilar to that of the Northern lobster" Gilchrist (1918:45). Molecular characterization — Comparative analysis of a portion of the 16s ribosomal RNA gene from mitochondrial DNA (mtDNA) was conducted by using standard protocols (Kocher et al., 1989). Mito- chondrial DNA's purified by CsCl ultracentrifugation (Lansman et al., 1981) were amplified by PCR with the conserved primers 16sar and 16sbr of Palumbi et al. (1991). Following asymmetric amplification (Homarus americanus and H. gammarus) or cycle- sequencing (Homarinus capensis), DNA's were manu- ally sequenced by the dideoxy chain-termination method of Sanger et al. (1977). Aligned sequences are presented in Figure 4. Sequence divergence be- tween taxa was estimated by using the two-param- eter method of Kimura (1980). Sequence divergence between Homarus americanus and H. gammarus was 1.3%, whereas average divergence between these two species and Homarinus capensis was 9.7%. The 16s rRNA gene is one of the most slowly evolving regions of the mtDNA molecule (Xiong and Kocher, 1994); this conservative property makes it particularly use- ful for comparative studies among distantly related taxa. Though there is no formal recognition of equiva- lence between levels of sequence divergence and taxo- nomic rank (Hillis and Moritz, 1990), it is clear that the relative magnitude of divergence can be a useful taxonomic indicator (Avise, 1994). The magnitude of sequence differentiation that we observed between H. capensis and the two North Atlantic taxa strongly suggested the existence of two discrete clades. Mo- lecular divergence reinforced our conclusions from the reexamination of the morphology of these species. Remarks — Morphological differences between Homarinus capensis and the two species of Homarus are clear cut. Perhaps the most obvious differences are that Homarinus capensis has a dense coat of se- tae on the outer surface of the palms and on other articles of the chelipeds (PI), and scattered setae distributed over the carapace, tail fan, sixth abdomi- nal segment, and pleurae of the remaining abdomi- nal segments; Homarus americanus and H. gam- marus are smooth and glabrous. The telson of Ho- marinus has subparallel sides and its exposed sur- face bears many obsolescent transverse rugae (Fig. 3); the telson of Homarus species has sides converg- ing toward the tip, giving a subtriangular shape. First pleopods are more elongate and slender in Homarus species than in Homarinus (Fig. 2). The two species of Homarus attain large size (Wolff, 1978), whereas Homarinus capensis appears to be much smaller at maturity. No ovigerous females of H. capensis have been found, but openings of the oviducts are at least twice the size of those on com- parably sized specimens of the species of Homarus (see Kado et al., 1994). This suggests that there are fewer eggs with accelerated larval development in Homarinus capensis relative to slower larval devel- 102 Fishery Bulletin 93(1). 1995 opment from smaller more numerous eggs in Homarus species (Kado et al., 1994). Acknowledgments Our conclusions converged independently from two viewpoints. A. B. W. and other carcinologists have long understood grounds for generic separation of the Cape lobster from Homarus on the basis of morphol- ogy. I. K. and R. S. S. concluded this on the basis of genetic divergence and were well into their analysis before forces were joined. A. B. W. drafted the sys- tematic section and assembled the jointly produced text. Keiko Hiratsuka Moore rendered drawings of the pleopods. G. C. Steyskal provided advice on the choice of a new generic name. The manuscript was critically reviewed by W. Glanz, R. B. Manning, and T. A. Munroe. We are indebted especially to colleagues at the Sea Fisheries Institute, Cape Town, South Africa, who helped us in this study; Roy Melville- Smith provided materials and information, and Rob- ert Tarr photographed the living specimen of Cape lobster. George M. Branch, University of Cape Town, provided logistic support and aided in specimen ac- quisition. Yan Kit Tarn and Alex Parker provided sequence data. R. S. S. was supported by grants from the South African Foundation of Research Develop- ment, the Visiting Scholar Fund, and the Student Fund for Visiting Scholars of the University of Cape Town. Molecular work was supported by NOAA Sea Grant (NA90AAD-SG499) and NSF (EHR-9108766 and OCE-9203342). Literature cited Avise, J. C. 1994. Molecular markers, natural history and evolu- tion. Chapman and Hall, NY, 511 p. Barnard, K. H. 1950. Descriptive catalogue of South African decapod Crustacea. Ann. South African Mus. 38:1-837. Gilchrist, J. D. F. 1918. The Cape lobster and the Cape crawfish or spiny lobster. Mar. Biol. Rep. South Africa 4:44-53, 2 pis. Herbst, J. F. W. 1792. Versuch einer Naturgeschichte der Krabben und Krebs nebst einer systematischen Beschreibung ihrer verschiedenen Arten. Vol 2:i — viii, 1-225, pis. 22^46. Hillis, D. M., and C. Moritz. 1990. Molecular systematics. Sinauer Associates, Sunderland, MA, 588 p. Holthuis, L. B. 1986. J. C. Fabricius' (1798) species of Astacus, with an account of Homarus capensis (Herbst) and Eutrichocheles modestus (Herbst) (Decapoda Macrura). Crustaceana 50:243-256. 1991. FAO species catalog. Marine lobsters of the world. An annotated and illustrated catalog of species of interest to fisheries known to date. FAO Fisheries Synopsis 125, 13:viii, 1-292. Kado, R., J. Kittaka, Y. Hayakawa, and D. E. Pollock. 1994. Recent discoveries of the "rare" species Homarus capensis ( Herbst, 1 792 ) on the South African coast. Crus- taceana 67:71-75. Kensley, B. 1981. On the zoogeography of Southern African decapod Crustacea, with a distributional checklist of the species. Smithsonian Contrib. Zool. 338:i-iii, 1-64. Kimura, M. 1980. A simple method for estimating evolutionary rate of base substitution through comparative study of nucleotide sequences. J. Mol. Evol. 16:111-120. Kocher, T. D., W. K. Thomas, A. Meyer, S. V. Edwards, S. Paabo, F. X. Villablanca, and A C. Wilson. 1989. Dynamics of mitochondrial DNA evolution in mam- mals: amplification and sequencing with conserved primers. Proc. Nat. Acad. Sci. (USA) 86:6196-6200. Lansman, R. A, R. D. Shade, J. F. Shapiro, and J. C. Avise. 1981. The use of restriction endonucleases to measure DNA sequence relatedness in natural populations. Ill: Tech- niques and potential applications. J. Mol. Evol. 17: 214-226. Linnaeus, C. 1758. Systema naturae per regna tria naturae, secundum classes, ordines, genera, species, cum characteribus, differ- entiis, synonymis, locis, ed. 10, 1, iii + 824 p. Laurentii Salvii, Holmiae, Stockholm. Milne-Edwards, H. 1837. Histoire naturelle des Crustaces, comprenant 1'anatomie, la physiologie et la classification de ces animaux, Vol. 2, 532 p. Librairie Encyclopedique de Roret, Paris. 1851. Observations sur le squelette tegumentaire des Crustaces decapodes, et sur la morphologie de ces animaux. Ann. Sci. Nat., Paris (3, Zool.)16:221-291, pis. 8-11. Palumbi, S., A Martin, S. Romano, W. O. McMillan, L. Stice, and G. Grabowski. 1991. The simple fool's guide to PCR, v. 2.0. Special pub- lication of the Univ. of Hawaii Dep. Zoology and Kewalo Marine Laboratory, 23 p. Sanger, F., S. Nicklen, and A. R. Coulson. 1977. DNA sequencing with chain-terminating inhib- itors. Proc. Nat. Acad. Sci. (USA) 74:5463-5467. Stebbing, T. R. R. 1900. South African Crustacea. Mar. Investig. South Af- rica 1:14-66, pis. 1-4. Weber, F. 1 795. Nomenclator entomologicus secundum entomologiam systematicum ill. Fabricii, adjectis speciebus recens detectis et varietatibus.... C. E. Bohn, Chilonii [Kiel] et Hamburgi, viii + 171 p. Wolff, T. 1978. Maximum size of lobsters (.Homarus) (Decapoda, Nephropidae). Crustaceana 34:1-14, pis. 1-2. Xiong, B., and T. D. Kocher. 1994. Phylogeny of the sibling species of Simulium venustum and S. verecurdum (Diptera: Simuliidae) based on sequences of the mitochondrial 16s rRNA gene. Mol. Phyl. Evol. 3:293-303. Abstract. — A radiometric age- ing method was used to resolve con- flicting results from ageing tropi- cal lutjanids based on annual ring counts in whole and sectioned otoliths. The number of rings de- tected in sectioned otoliths of Lut- janus erythropterus, L. malabar- icus, and L. sebae from unexploited populations in the Gulf of Carpentaria, Australia, were 1.6 to 2.4 times the number found in whole otoliths. To obtain an inde- pendent estimate of age, we mea- sured 210 Pb/ 226 Ra radioactive dise- quilibria of both whole and cored otoliths. As all species had high lev- els of 226 Ra, they could be aged with relative accuracy by this method. Samples of whole otoliths and cores with a similar ring count had simi- lar radiometric ages. In samples whose sectioned and whole-otolith ages differed by more than 4 years, the whole otolith ring count agreed better with the radiometric age (for an uptake activity ratio i?=0.0). This result stands in marked con- trast to the radiometric age valida- tion of section counts for slow-grow- ing, long-lived fish inhabiting tem- perate to subtemperate waters. In this region, all species lived less than 10 years and grew to a maxi- mum size of up to 600 mm SL. They reached a similar length in one year, but L. erythropterus grew faster than the other two species thereafter. The sexes had the same growth rates. Our results were similar to those found for these spe- cies elsewhere and suggest that in tropical fishes, such as lutjanids, rings observed in sectioned otoliths and other hard parts may not be formed annually. Where possible, ages derived from counts in these structures should be verified by independent methods. Ageing of three species of tropical snapper (Lutjanidae) from the Gulf of Carpentaria, Australia, using radiometry and otolith ring counts David A. Milton CSIRO Division of Fisheries Marine Laboratories. RO. Box 1 20 Cleveland. Queensland 4 1 63, Australia Steven A. Short Environmental Radiochemistry Laboratory ANSTO. Private Mail Bag 1 Menai. NSW. 2234. Australia Present address: Kmgett Mitchell and Assoc. RO. Box 33-849. Auckland. New Zealand Michael F. O'Neill Stephen J. M. Blaber CSIRO Division of Fisheries Marine Laboratories. RO. Box 1 20 Cleveland. Queensland 4 1 63. Australia Manuscript accepted 18 August 1994. Fishery Bulletin 93:103-115 (1995). Tropical fishes can be difficult to age because many species do not deposit annual rings in their hard parts (Longhurst and Pauly, 1987). Lutjanids, which are highly valued commercial fishes in the tropical Indo-Pacific region, often have ring patterns in their hard parts that are difficult to interprete (e.g. Davis and West, 1992). The age and growth of many lutjanid species have been well studied and the results of these studies have formed the basis of age-structured stock assessments upon which the management of these fisheries is based (e.g. Sains- bury, 1988). In the western Pacific, Lutjanus malabaricus has been the most widely studied lutjanid, as it is the main catch of trawl and line fisher- ies in northern Australia, adjacent Indonesian waters, and in the South China Sea. The reported maximum age (up to 10 yr ) and growth param- eters differ both between regions (Lai and Lui, 1974, 1979) and within one area (northern Austra- lia: Lai and Lui, 1979; Chen et al., 1984; Edwards, 1985; McPherson and Squire, 1992). These studies estimated age from growth rings in vertebrae (Lai and Lui, 1979; Chen et al., 1984; Edwards, 1985) or in whole otoliths (McPherson and Squire, 1992). The latter method may underestimate the age of longer-lived species because of the difficulty of distinguishing all the growth rings (Casselman, 1974). The timing of formation of annual growth rings in Lutjanus from northern Australia has not been fully verified. Several authors (Lai and Lui, 1974, 1979; Chen et al., 1984; Yeh et al., 1986; Davis and West, 1992) have concluded that the outer ring is probably deposited 103 104 Fishery Bulletin 93(1), 1995 annually, but the season when this ring is formed varies between studies and species. Such ambigu- ities cast doubt on the validity of the conclusions and suggest that differences in the estimated growth rate and age of Lutjanus populations may be related to problems of interpretation rather than to biological differences. A radiometric method has recently been used suc- cessfully to estimate the age of long-lived fishes (Bennett et al., 1982; Fenton et al., 1991). This method uses the known decay rates of isotopes of Radium-226 ( 226 Ra) and Lead-210 ( 210 Pb) in bony parts to estimate the age of fish. It does not rely on operator interpretation to estimate age and there- fore is particularly useful for ageing long-lived spe- cies where the growth rings are often not clearly de- fined (Casselman, 1974). The objectives of the present study were 1) to esti- mate the age and growth of Lutjanus malabaricus, L. erythropterus, and L. sebae from the Gulf of Carpentaria by counting rings in whole and sectioned otoliths; and 2) to use the 210 Pb/ 226 Ra radiometric ageing method to make an independent age estima- tion of the same fish. S ' U «m T AUSTRALIA > • • 10" • • J • • • • • / ~~ef,"E Figure 1 Map of the Gulf of Carpentaria showing the distribution and relative abundance of Lutjanus erythropterus, L. malabaricus, and L. sebae during a systematic survey in November 1990. Materials and methods Sampling Most samples of Lutjanus erythropterus, L. mala- baricus, and L. sebae were collected during a sys- tematic survey of the Gulf of Carpentaria between long. 136° and 142°E in November 1990. Two similar random-sampling surveys were made across the northern Gulf of Carpentaria (north of lat. 14°30'S) in November 1991 and January 1993. Samples of Lutjanus malabaricus were also collected during a survey of eight areas in the Gulf of Carpen-taria by the commercial trawler Clipper Bird in June 1990 (Fig. 1). Details of survey design, trawl gears, and trawl durations are given in Blaber et al.(1994). Commercial-sized Lutjanus malabaricus (1-3 kg) were obtained from fish retained for sale after the June 1990 survey. During the systematic survey in November 1990, all specimens of the three target species of lutjanids were retained for ageing studies. In November 1991 and January 1993, only fish from length classes underrepresented in previous samples were processed. All fish were measured (standard length [SL] in mm), weighed (±1 g), and sexed, and both sagittae were removed, dried, and stored in la- belled bags for future analysis. Radiometry Radioanalysis requires about 1 g of sample material; therefore, fish were pooled to obtain the necessary sample weight. For juveniles, up to four otoliths were required to obtain this weight. Otoliths used for radioanalysis were chosen in two ways. First, for each species, otoliths from juvenile, maturing, and ma- ture fish that had the same sectioned-otolith ages, similar otolith weights, and similar sizes, and came from the same region of the Gulf of Carpentaria were pooled for radioanalysis. Second, otoliths of the same whole-otolith age and from fish of similar size were abraded with a mechanical sander to a central core approximating the weight (see Table 2), length, and shape of the otolith of a fish whose whole-otolith age was 3 (otolith length=11.6 ± 0.7 for L. erythropterus; 12.7 ± 0.4 for L. malabaricus; and 11.4 ± 0.4 for L. sebae). The exception was sample 2490 for which otoliths were ground to a core age of 2 (weight 0.156 ± 0.005 g; otolith length 9.2 ± 0.16 mm; n=92). The otolith nucleus at the center of the cores was located by examining intact otolith morphology and by sec- tioning other samples (Campana et al., 1990). This age is less than the age at sexual maturity for all species. Milton et al.: Ageing of Lutjanus erythropterus. L malabancus. and L sebae 105 The method of radioanalysis of the otoliths is de- tailed in Fenton et al. (1990, 1991). It involves mea- suring the specific activity of 226 Ra: 210 Pb by alpha- spectrometry. Because of the extremely small spe- cific activities measured (0.01-0.1 dprn-g" 1 for Polo- nium-210 [ 210 Po]), cleanliness is of the utmost im- portance in the analytical procedure. Every item of laboratory ware that contacted the otolith solutions and otoliths was chemically decontaminated in al- kaline 0.05M Na 4 EDTA(pH 10.5). The otoliths were washed and rinsed several times in this solution, then washed several times in 0.1M HC1 (<10 s) and fi- nally washed twice in water. Our analyses of 210 Pb, via its short-lived daugh- ter-proxy 210 Po, and 226 Ra were made with high-reso- lution alpha-spectrometers according to the meth- ods of Fenton et al. (1990). The mean 210 Po reagent blank was 0.0071 ± 0.0012 dpm. Recovery of 210 Po was always at least 90% and instrument background counts (for 208 Po and 210 Po) were less than one countd -1 . 226 Ra was analyzed by a direct alpha-spec- trometry method and chemical yield was measured by gamma spectrometry of a Barium-133 ( 133 Ba) tracer (Fenton et al., 1990, 1991). Mean activity of the 226 Ra blanks was 0.0174 ± 0.0026 dpm, which was lower than in previous studies (e.g. Bennett et al., 1982; Fenton et al., 1991) owing to careful con- trol of reagents. Recovery of 226 Ra (as estimated by the recovery of 133 Ba tracer) was greater than 85% for all samples. (l-e-' --). XT\\ l-(l-R) (l-e-) XT \ -X(t-T) (2) where all parameters are the same as in the previ- ous model, except T, which is the estimated age of the otolith core. A linear mass growth model was assumed only up to the age of the core. The initial uptake 210 Pb/ 226 Ra activity ratio was generally as- sumed to be i?=0.0. This is the most conservative value, and so radiometric age estimates derived with this value must overestimate the maximum possible age of the sample. The above equations were solved numerically by a Newton-Raphson iteration method (Fenton et al., 1991). Stable element analysis The levels of lead and barium in otoliths are pre- sumed to act as stable equivalents of 210 Pb and 226 Ra and so can be used to assess the uptake of the radio- active isotopes and to normalize the radiometric data (Fenton and Short, 1992). Therefore, the concentra- tions of stable lead, barium, strontium (Sr), and cal- cium (Ca) in each otolith sample were measured for an aliquot of each dissolved otolith solution used in the radiometric analysis. Each solution was analyzed by inductively coupled plasma mass spectrometry for lead and barium and by inductively coupled plasma atomic emission spectrometry for strontium and calcium. Data analysis The ages of whole otoliths were calculated on the basis of a single constant (linear) growth rate by the equation originally derived by Bennett et al. (1982): A=l-(1-R) 1 It (1) where A=the ratio of the activity of 210 Pb to 226 Ra activity at time t ( 210 Pb/ 226 Ra) t ; i?=ratio of 210 Pb to 226 Ra at the time of deposition [( 210 Pb/ 226 Ra) ]; and >.=decay constant for 210 Pb (0.03114 yr _1 ). Assump- tion of a single linear mass growth rate produces radiometric ages that are greater than those that would result from assumption of an exponential (non- linear) rate, the bias always favoring a higher value (Campana et al., 1993). It should be understood that using this assumption (linear mass growth of the otolith) will produce age estimates that always over- estimate the real age. For otolith cores, ages were calculated from Smith et al.'s (1991) equation: Otolith ageing Pairs of otoliths from each fish were cleaned of ex- cess tissue, dried at 60°C for 24 h, weighed (± 0.1 mg) and measured along the longitudinal axis with dial calipers (± 0.05 mm). One otolith of each pair was embedded in polyester resin and cross-sectioned with a diamond saw (Augustine and Kenchington, 1987). Thin sections (approximately 200 |im) of each otolith were bonded to microscope slides with thermo- plastic cement. Each section was polished on both faces with 800-grit wet-and-dry carborundum paper before being examined with a video-enhanced light microscope attached to a microcomputer with pre- cise distance-measuring software. The rings (pre- sumed annuli) were counted and the distance be- tween them measured along the dorsal axis adjacent to the sulcus, where they were most clearly distin- guishable. In whole otoliths, the rings were counted against a strong background point light source. Counts of rings in all whole and sectioned otoliths were made independently by two readers. When the ring counts differed, the otoliths were reexamined by both readers. If the counts still differed by more 106 Fishery Bulletin 93(1), 1995 than one, the data were discarded (<5% of all otoliths). If counts differed by one, the higher value was chosen (10% of otoliths). The relative frequency of these discrepancies was similar for all species. Data analysis The length-at-age data were fitted to the repara- meterized von Bertalanffy growth curve of Francis (1988). This method has the advantage that the pa- rameters estimated are independent and can be com- pared directly between species and populations. Most previous studies of lutjanid age and growth have fitted the von Bertalanffy growth equation to data on length at age (e.g. Lai and Lui, 1979; Manooch, 1987; Davis and West, 1992). However, the estimated parameters L m , K, and t Q either do not have direct biological meaning (e.g. Knight, 1968; Schnute and Fournier, 1980; Ratkowsky, 1986) or are extrapo- lations from the data (Ratkowsky, 1986). Francis (1988) extended the equation of Schnute and Fournier (1980) to derive a new set of parameters L v L 2 , and L 3 (his L, I , and l w ), which correspond to the length at the lower, middle, and upper limits of any arbitrarily defined age range, such that: L t =L 1+ (L 3 -L 1 )(l-r 2{t ^ /u "^ ) )/a-r 2 ), (3) where r = (L 3 —L 2 )/(L 2 —L 1 ); L t is the mean length of a fish at age t; and L v L 2 and L 3 are the length at the lower, middle, and upper limits of two arbitrary ages and w. By fitting a curve of this form, extrapola- tions beyond the data are avoided, as the three fit- ted parameters are chosen from within the range of the data and hence can be directly compared with the results of previous studies. In this study, we set = 1 ring and w = 6 rings for each species. This equation has the advantage that the age range to be examined can be chosen by the investigator, rather than having to be the largest and smallest age classes found, as required by the Schnute and Fournier ( 1980) equation. These param- eters (Lj, L 2 , and L 3 ) can also be expected to have similar properties to those of Schnute and Fournier (1980) and not to show the high negative correlation between L x and K (Francis, 1988). All parameters were estimated by an iterative least-squares method (SAS NLIN procedure with the Marquardt option; SAS, 1989). Vaughan and Kanciruk (1982) found that this procedure consis- tently showed the least bias in parameter estimates, converged rapidly, and provided more precise esti- mates than did standard linear techniques. A mea- sure of goodness-of-fit was obtained by calculating an r 2 value from the residual and the explained sums of squares derived from the least-squares regression. Relationship of ring counts in whole and sectioned otoliths with radiometric ages The estimated age from ring counts in whole and sectioned otoliths used in the radiometry were com- pared for all species by two methods. First, the rela- tionship between radiometric age and whole and sec- tioned otolith ages of the same fish were plotted. If the slope of the relationship was not significantly different from 1, the results of the two methods were considered to be in close agreement. Second, the two ageing methods were compared with the radiomet- ric ages with a Wilcoxon matched-pairs ranks test (Conover, 1980). The two hypotheses tested were 1) that whole otolith ring counts underestimated true age (radiometric age) or 2) that sectioned otolith ring counts overestimated true age. Results Radiometry Lutjanus erythropterus— The specific activity of 226 Ra and the 210 Pb/ 226 Ra activity ratio differed among the three samples of L. erythropterus (Tables 1 and 2). The activity ratio was highest in the cored sample (0.118 ± 0.031; Table 2). Ring counts in whole otoliths were linearly related to otolith mass (Fig. 2A) and ring count in sectioned otoliths, though the relationship was significantly weaker CP<0.05). Radiometric age estimates were calculated on the basis of a single constant (linear) growth rate for otolith mass, which removes the need to include the mass growth rela- tion in the radiometric age calculation (Eq. 1). Un- der the assumption of a constant growth model, ra- diometric age estimates were most similar to those obtained from the ring counts in whole otoliths (Table 2). The match was best for the cored otolith sample where model assumptions are less stringent (sample 2673). Lutjanus malabaricus — The specific activity of 226 Ra in L. malabaricus otoliths differed among samples and among size classes (Tables 1 and 2). The 210 Pb/ 226 Ra activity ratios ranged from less than 0.027 to 0.212 and varied to a similar degree in cored and whole-otolith samples (Table 2). Otolith weight was linearly related to the number of rings in whole otoliths (Fig. 2B), and this relationship was stron- ger than that for counts from sectioned otoliths Milton etal.: Ageing of Lutjanus erythropterus, L malabaricus, and L sebae 107 Table 1 Elemental composition of otoliths of three species of Lutjanus used in the radiometric analysis. Whole = whole otoliths used; cored = otoliths cored to age 3+ (L. erythropterus ) or 2+(L. malabaricus and L. sebae ). Numbers in parentheses represent repeated analyses of a sa mple in which several otoliths of similar whole and sectioned age had been combined. 226 Radium 210 Lead Lead Barium Pb/Ba Strontium Calcium Sr/Ca Whole/or dpm-g -1 dpm-g" 1 (Pb) (Ba) mass (Sr) (Ca) mass Species Sample cored (± la) (± la) (ppm) (ppm) ratio (ppm) (ppm) ratio L. erythropterus 2065 Whole 0.2277 ± 0.0132 0.0174 ±0.0047 0.08 18.7 0.004 2,800 395,000 0.0071 2066 Whole 0.1623 ± 0.0087 0.0070 ± 0.0035 0.19 11.5 0.016 2,720 398,000 0.0068 2673 Cored 0.1331 ± 0.0087 0.0157 ± 0.0040 0.66 9.2 0.071 — — — L. malabaricus 2062(2) Whole 0.2390 ±0.0111 -0.0025 ± 0.0045 0.27 8.2 0.033 2,915 462,000 0.0063 2063 Whole 0.0728 ± 0.0066 0.0067 ± 0.0042 3.49 6.5 0.537 3,330 470,000 0.0071 2063(2) Whole 0.0582 ± 0.0049 -0.0010 ± 0.0025 0.22 13.4 0.016 1,990 321,000 0.0062 2063(3) Whole 0.0916 ± 0.0053 0.0072 ±0.0017 0.55 4.8 0.114 2,240 399,000 0.0056 2064 Whole 0.2118 ±0.0164 0.0173 ± 0.0024 2.28 5.8 0.390 3,000 395,000 0.0076 2438 Whole 0.1014 + 0.0064 0.0068 ± 0.0036 0.41 5.3 0.080 2,005 426,000 0.0047 2439 Whole 0.2942 ± 0.0141 0.0133 ± 0.0043 0.06 7.5 0.008 2,250 415,000 0.0054 2440 Whole 0.1080 ±0.0068 0.0135 ± 0.0029 0.18 6.2 0.029 2,910 438,000 0.0067 2489 Cored 0.1678 ± 0.0088 0.0356 ± 0.0055 <0.09 6.7 <0.014 2,160 407,000 0.0053 2490 Cored 0.1219 ±0.0078 0.0180 ± 0.0037 <0.09 6.2 <0.014 2,040 416,000 0.0049 L. sebae 2068 Whole 0.1036 ± 0.0064 0.0139 ± 0.0034 3.13 8.7 0.360 2,360 396,000 0.0060 2069 Whole 0.1046 ±0.0058 0.0312 ± 0.0037 1.38 8.1 0.170 2,510 398,000 0.0063 2070 Whole 0.0460 ± 0.0042 0.0100 ±0.0023 0.46 5.0 0.092 — — — 2647 Cored 0.2143 ±0.0114 0.0373 ± 0.0049 0.50 11.5 0.043 — — — 2648 Cored 0.1756 ± 0.0099 0.0458 ± 0.0052 0.66 9.4 0.071 — — — Table 2 Results of radiometric and direct ageing otoliths of Lutjanus malabaricus, L. erythropterus and L sebae from the Gulf of Carpentaria. Radiometric ages were calculated by using a constant growth rate model and by using R = 0.0 (where R = initial 210 Pb: 226 Ra activity ratio at time of deposition). All errors n radiometric age estimates expressed at la level (n = number of otoliths in sample). SE = Standard error. Numbers in parentheses represent repeated analyses of a sample in which several otoliths of similar whole and sectioned age iad been combined. Mean length Mean otolith Whole Sectioned 210p b .226 Ra Radiometric Species Sample n (mm)± SE mass (g) ± SE otolith age otolith age activity ratio age L. erythropterus 2065 3 316 ±2 0.3315 ± 0.0186 3 3 0.076 ±0.021 5.1 ± 1.5 2066 2 364 ±- 0.3875 ± - 3.3 6 0.043 ± 0.022 2.8 ± 1.5 2673 3 368 ±7 0.4750 ± 0.0507 4 9 0.118 ±0.031 5.5 ±1.1 L. malabaricus 2062(2) 2 310 ± - 0.4852 ± - 3 3 <0.027 (95% CD <1.8 (95% CD 2063 2 350 ± - 0.5775 ± - 4 6 0.092 ± 0.058 5.7 +4.3,-4.0 2063(2) 2 348 ±- 0.6170 ±- 4 6 <0.069 (95% CD <4.6 (95% CD 2063(3) 3 346 ±7 0.6118 ±0.0133 4 6 0.079 ± 0.019 0.8 ±0.8 2064 3 443 ± 7 1.5591 ± 0.0493 6.7 14 0.082 ±0.013 5.6 ± 0.9 2438 4 250 ±2 0.2517 ± 0.0063 3 3.5 0.067 ± 0.036 4.5 +2.6,-2.5 2439 1 650 2.1155 9 13 0.045 ± 0.015 3.0 ± 1.0 2440 1 560 2.1111 7 19 0.125 ±0.028 8.8 + 2.2,-2.1 2489 4 455 ± 10 1.6185 ± 0.1349 9 13 0.212 ±0.035 8.7+1.5,-1.4 2490 5 422 ±7 1.1055 ± 0.0501 8 8 0.148 ±0.032 6.1 ± 1.2 L. sebae 2068 4 222 ± 5 0.2429 ± 0.0261 2 3 0.134 ±0.034 9.5 + 2.7,-2.6 2069 2 304 ±- 0.6152 ±- 3.5 7 0.298 ± 0.039 24.2 +4.2,-3.9 2070 2 399 ±- 1.5658 ± - 5.5 15 0.217 ± 0.054 16.4+5.1,-4.6 2647 3 400 ± 15 1.4462 ± 0.0184 5 12.3 0.174 ±0-023 7.1 ± 1.0 2648 2 462 ±- 2.1000 ±- 7 15.5 0.261 ± 0.033 11.2+1.5,-1.4 108 Fishery Bulletin 93(1). 1995 "l-5-i l erythropterus 6 8 10 Number of rings Figure 2 The relationship between otolith weight and the number of rings counted in whole otoliths of (A) L. erythropterus, (B) L. malabaricus, and (C)L. sebae. (P<0.05). Under the assumption of a constant mass growth model, radiometric age estimates were again most similar to those found for whole otolith ring counts. The match was best for samples of cored otoliths (2489, 2490) where assumption of a mass growth model is almost absent (Table 2). Lutjanus sebae — The specific activity of 226 Ra and the 210 Pb/ 226 Ra activity ratio varied less between samples in L. sebae than in the other species (Tables 1 and 2). As with the other species, otolith weight was linearly related to the ring counts of whole otoliths; therefore, a single constant growth rate was assumed in interpre- tation of the radiometric data (Fig. 2C). The radiomet- ric age estimates of intact otolith samples of juveniles (2068, 2069, 2070), based on the assumption of no allogenic 210 Pb uptake in the otoliths (R=0.0), were higher than the ring counts for both sectioned and whole otoliths (Table 2). Samples 2068 and 2069 were prob- ably subject to high rates of allogenic 210 Pb uptake, as indicated by the high stable Pb/Ba mass ratios (Table 1). Radiometric ages of both sets of cored otoliths were most similar to the age estimates based on whole otolith counts. However, both these samples (2647 and 2648) had very low stable Pb/Ba mass ratios (Table 1). Mod- elled radiometric ages of L. sebae samples (both whole and cored) for different values of R indicate that R - 0. 10 best matches the ring count of whole otoliths (Table 3). Lead.'Barium ratios The stable lead:barium ratios of all samples were plotted against radiometric age assuming an initial activity ratio/? = 0.0 (Fig. 3). Neither L. malabaricus nor L. erythropterus showed an increase in the ratio with increasing age. However, in four of the five L. sebae samples radiometric age increased rapidly with increasing stable lead (Fig. 3). Otolith ageing Lutjanus erythropterus — The growth curves of L. erythropterus based on ring counts in whole otoliths 30- A L sebae • L. malabaricus n L. erythropterus >: 20- 0.3) (Table 4) and lived to a similar age. Lutjanus malabancus — The growth curves express- ing the best fit of length-at-age data from both sec- tioned otoliths and whole otoliths show significant differences (P<0.05) in the estimated growth rates (Fig. 4B). More rings were counted in sectioned otoliths than in whole otoliths from the same fish (Fig. 6B), but were linearly related (whole otolith count=0.64 x (sectioned otolith count) + 0.79; r 2 =0.81, 1,869 =3614.7, P<0.001). Growth parameters of the reparameterized von Bertalanffy equation of male and female L. mala- baricus did not differ except for L 3 ; this parameter was larger in males (P<0.05). Not all fish collected were sexed, but the growth parameters of the com- bined equation differed from that obtained from the subsets that were sexed (Table 4). Lutjanus sebae — Ages based on counts of sectioned and whole otoliths differed significantly in L. sebae over 350 mm SL (P<0.05; Fig. 4C). More rings were detected in the otoliths of these fish when they were sectioned than when examined intact, although the number of rings detected by the two methods were linearly related (Fig. 6C; whole otolith count=0.50 x (sectioned otolith count) + 0.19; r 2 =0.80, F 1 140 =546.0, P<0.0001). The growth parameters of the reparameterized von Bertalanffy equation were similar for both sexes (Table 4). Lutjanus sebae were larger at one year (L x ) Table 4 Growth parameters (SL ± SE) of the reparameterized von Bertalanffy growth equations for Lutjanus malabaricus, L. erythropterus, and L. sebae ( 1-6 rings) from the Gulf of Carpentaria (r 2 = nonlinear i estimate of goodness-of-fit). Species Sex n LjiSE L 2 ±SE L 3 ±SE r 2 L. erythropterus both 172 75.40 ± 11.67 335.21 ± 2.73 457.12 ± 10.01 0.93 females 61 75.03 ± 17.57 346.66 ± 5.07 477.29 ± 15.64 0.95 males 30 86.06 ± 22.0 337.47 ± 4.50 468.66 ± 18.55 0.94 L. malabaricus both 878 78.09 ± 2.99 298.94 + 1.72 424.92 ± 1.37 0.95 females 159 195.37 ± 27.37 329.09 ± 4.31 423.19 ±2.70 0.70 males 73 100.63 ± 15.50 313.62 ± 6.91 442.67 ± 4.54 0.92 L. sebae both 144 122.27 ± 3.22 287.28 ± 2.18 451.501 3.27 0.97 females 14 99.92 ± 17.84 277.43 ± 8.58 443.96 ± 7.54 0.99 males 9 113.50 ± 3.98 284.83 ± 5.30 461.10 ±4.41 0.99 Fishery Bulletin 93(1), 1995 A bUU- L erythropterus 400- \Tu 300- 200- D /W [ ] \ - whole otolith 100- 0- { - sectioned otolith Figure 4 Plot of the mean length-at-age (±) range and the growth curves of the three species oiLutjanus based on ring counts in whole and sectioned otoliths. than were other species (P<0.05). However, at six years of age (L 3 ) they were about the same size as L. erythropterus but were larger than L. malabaricus (P<0.05). Relationship of ring counts in whole and sectioned otoliths with radiometric ages There was a significant linear relationship between both whole and sectioned otolith ring counts and ra- diometric age (Fig. 7; P<0.001 in both cases). The slopes of the lines of best fit differed (/}=1.04 ± 0.11; r 2 =0.84 for whole otolith ring counts and /?=1.83 ± 0.06; r 2 =0.87 for sectioned otolith ring counts). Be- cause the initial activity ratios of the L. sebae samples (R) were obviously greater than 0.0 in at least the whole otolith samples, these were not included in the analyses. There was no significant difference between whole otolith ring counts and radiometric ages for all spe- cies combined (T=53.5; P>0.30, re=15) or for L. malabaricus (T=17.5; P>0.15, rc=10). However, for all species combined we found that the sectioned ring counts were significantly greater than the radiomet- ric age of the same fish (T=6.5; P<0.001, ra=15). The sectioned ring counts of L. malabaricus were also greater than the radiometric ages (T=2; P<0.005, n=10). Discussion This is the first study to use 210 Pb/ 226 Ra activity ra- tios to verify the age of relatively short-lived tropi- cal fishes. Previous studies that have used these ra- tios to estimate age have focussed on species that live to at least 70 years (Bennett et al., 1982; Campana et al., 1990; Fenton et al., 1991). In the Lutjanidae, natural levels of 226 Ra in the otoliths were high, which helped to minimize the variances in the 210 Pb/" 226 Ra activity ratio and hence the errors in the age estimates. Radiometry provided strong evidence that the rings counted in whole otoliths were the best estimate of the true age of the three lutjanids studied. The radiometric methods we used tend to overes- timate age because the assumptions concerning the otolith mass growth model and rate of incorporation of allogenic 210 Pb were conservative. The only con- ceivable mechanism that would lead to underesti- mation of ages radiometrically would be a signifi- cant loss of radon ( 222 Rn) from otoliths during growth (West and Gauldie, in press). Radon is the daughter of 226 Ra and the only gas- eous precursor of 210 Pb in the decay chain. Its mean lifetime is only 4.8 x 10 5 seconds, and its effective (physical) diffusivity in otoliths would be about 0.5 x 10" 12 m 2 -s _1 . Radon diffusion out of otoliths would be further retarded by adsorption to organic matter (Wong et al., 1992). Simple calculations based on the known microstructure of otoliths (Campana and Neilson, 1985) and on the existing data on radon emanation (Morawska and Phillips, 1993) show that significant loss of radon from otoliths is extremely unlikely, as previously suggested from empirical stud- ies (Fenton and Short, 1992). Milton et al.: Ageing of Lutjanus erythropterus, L maiabancus. and L. sebae 1 1 Figure 5 Photographs of an otolith of a 270-mm L. erythropterus showing the discrepancy between the number of rings seen by examining (A) the intact otolith (2 rings) and (B) after sectioning (5 rings). Scale=l cm. Fishery Bulletin 93(1), 1995 Why ages derived from whole and sectioned otoliths were significantly different remains unclear. The differences in ring counts increased with the size of the fish, and the slope of the regression (whole vs. sectioned ring count) was steepest for the fastest- growing species, L. erythropterus. The otoliths were large (up to 30 mm long, and weighing 3 g), so the daily rings during periods of reduced or variable growth of younger fish were still relatively widely spaced. Thus, what would appear as a diffuse, single hyaline zone in a whole otolith examined against reflected light may have appeared in section as a group of hyaline and opaque zones. These problems 14 - A L. erythropterus 12- o 10- ooo o o 8- o o o o 6- ooo ooo 4- oooo ooo 2- ooo o o - * i ' i • i i 2 4 6 8 Sectioned otolith ring count -* -» ro 3 Ol O Ol o 03 IOOO P- IOOOOOO 0) ooooooo ST ooooooo g oooooooo ooooooooo o ooooooooo oo ooooooo o o oo o ooo o 2 4 6 8 10 20- c L. sebae 15- 10- 5- o- lOOOOO oooooo ooooooo oooooo ooooo oo oooo oo oo o 1 1 1 1 . 1 I 1 1 2 4 6 8 10 Whole otolith ring count Figure 6 Plot of the relationship between whole and sec- tioned otolith ring counts of the three species of Lutjanus. in otolith interpretation were most marked in L. erythropterus and led to the greatest discrepancy in ring counts. Studies of the age and growth of Lutjanus mala- baricus from northern Australia and the South China Sea used ring counts in vertebrae (Lai and Liu, 1974, 1979; Edwards, 1985), sectioned otoliths (Chen et al., 1984), and whole otoliths (McPherson and Squire, 1992). Their estimates were similar to the estimates we obtained from whole-otolith ageing, although L. malabaricus from the Great Barrier Reef appear to grow much faster and live at least one year less than those found in other areas (McPherson and Squire, 1992). However, the previous studies and our study provide different estimates of the von Bertalanffy growth parameters L x and K (Table 5). These differ- ences may have major impacts on age-structured fish- ery models (e.g. yield per recruit) that use these pa- rameters to estimate optimal yield. Lutjanus erythropterus and L. sebae from the Gulf of Carpentaria grew at similar rates to those reported from other parts of northern Australia (Ju et al., 1988; McPherson and Squire, 1992) and elsewhere within their range (Druzhinin and Filatova 1980; Yeh et al., 1986; McPherson and Squire, 1992). However, the growth of L. sebae in the Gulf of Carpentaria did not decline as they approached the maximum age ob- served. This may have been caused by an error in the ring count in otoliths of older fish or because the older age classes were not caught in the trawls. The maximum size of L. sebae in Australian waters has been reported to be between 1.0 and 1.4 m (Allen, 12- 10- Slope = 1.04 ±0.11 - y S r 2 = 0.84 / c 8 - D O ° fi- o> 6 c ir 4" o / A / □ • X • A* / • L malabancus whole • S ± • A L erythropterus whole 2" / O L malabancus cores ./ Q L sebae cores / A/- erythropterus core 0" ( ) 2 4 6 8 10 12 Radiometric age (yr) Figure 7 The relationship between radiometric age (yr) and whole otolith ring counts of all samples (except L. sebae whole otolith samples). Milton etal.: Ageing of Lutjanus erythropterus. L. malabancus. and L sebae 13 Table 5 Von Bertalanffy growth parameters of tropical Lutjanus from northern Australia and elsewhere within their range (W=whole otoliths; S=sectioned otoliths; V=vertebrae; U=urohyal; Sc =scales). Species Locality Sex Method K L x Maximum age Reference L. erythropterus Gulf of Carpentaria Both W 0.30 565 6 Present study Great Barrier Reef F w 0.44 500 7 McPherson and Squire (1992) M w 0.41 500 7 McPherson and Squire (1992) Northwest Shelf Both V 0.21 603 7 Juetal. (1988) L. malabaricus Arafura Sea Both V 0.17 707 10 Edwards (1985) Both V 0.12 790 8 Lai and Lui (1979) Gulf of Carpentaria Both w 0.22 592 9 Present study N.W. Australia Both V 0.13 768 8 Lai and Lui (1979) Both V 0.25 715 10 Chen etal. (1984) S. China Sea Both V 0.14 790 11 Lai and Lui (1974) Great Barrier Reef F w 0.23 696 7 McPherson and Squire ( 1992) M w 0.18 820 7 McPherson and Squire ( 1992) Vanuatu Both s 0.31 600 — Brouard and Grandperrin (1984) L. sebae Gulf of Aden Both Sc 0.16 660 11 Druzhinin and Filatova (1980) Gulf of Carpentaria Both w 0.06 1483 9 Present study N.W. Australia Both V 0.13 678 10 Yeh etal. (1986) Great Barrier Reef F w 0.18 851 8 McPherson and Squire (1992) M w 0.15 736 8 McPherson and Squire (1992) L. vittus N.W. Australia F u 0.37 267 7 Davis and West (1992) M u 0.22 346 8 Davis and West (1992) 1985; Grant, 1985) or 16 to 22 kg (Grant, 1985; Allen and Swainston, 1988), which is much greater than we recorded (5 kg). This species may, therefore, live more than 10 years. Indeed, large L. sebae (over 800 mm) from the Great Barrier Reef are known to live on deep coral reefs at depths greater than 60 m 1 ; the deepest part of the Gulf of Carpentaria is only 55 m. This sug- gests that fish may move from this region as they grow. Our radiometric ageing results have several im- portant implications beyond the verification of the age structure of each species. First, they demon- strated that for species that have a high otolith 226 Ra specific activity, 210 Pb/ 226 Ra activity ratios can be used to age fish as young as 3 years with accuracy. Previously these radioisotopes have only been used to age long-lived species (>10 yr; Bennett et al., 1982; Campana et al., 1990; Fenton et al., 1991). Other radioisotope pairs ( 228 Th: 228 Ra) have been used to age short-lived tropical species (Campana et al., 1993), but these are only useful for fish up to 5 years old because of the short half-life of Th-228. Second, for relatively short-lived species, radiomet- ric ageing of whole otoliths and cores using a single- phase linear model of otolith mass growth rate gave similar results. Campana et al. (1990) and Smith et 1 Williams, D. Australian Institute of Marine Science, PMB No. 3, Townsville 4810, Queensland, Australia. Personal commun., 1993. al. (1991) argued that new material accreting to the outer surface of the otolith may not accrete 226 Ra in similar specific activities to the juvenile (t=0). This would invalidate the use of a simple otolith mass growth model to interpret the radiometric data for otoliths of postjuvenile fish. However, even with a single-phase linear mass growth model (a two-phase model would have reduced the age estimates), we were able to verify that the ring counts in whole otoliths were a more accurate measure of the true age than counts from sectioned otoliths (in accord with core radiometric ages). However, we agree with Smith et al. (1991) that otoliths should be cored for radiometric ageing, if possible, which would avoid the use of an otolith mass growth model. The third point that arises from our analyses re- lates to the ratio of allogenic to radiogenic lead in Lutjanus otoliths. We set the uptake activity ratio value at zero (R=0.0) because higher values would have lowered the age estimates (e.g. Smith et al., 1991). However, from the stable lead/barium ratios and the high age estimates of two of the L. sebae samples (2068 and 2069) it appears that, at least for this species, the juveniles may be taking up more allogenic 210 Pb than the adults (Fenton and Short, 1992). There was no systematic increase in the Pb/ Ba mass ratios of L. malabaricus and there is insuf- ficient data for L. erythropterus to be conclusive (Fig. 1 14 Fishery Bulletin 93(1), 1995 3). However, for lutjanids it appears that a Pb/Ba mass ratio <0.2 probably indicates that the assump- tion of a low initial activity ratio (R) is valid, whereas the three samples where the Pb/Ba mass ratio is 0.3- 0.6 indicate that the assumption of low R may be invalid. The Pb/Ba ratios are, therefore, a useful test of the validity of the low R assumption. Finally, this appears to be the first instance where radiometric methods are more consistent with whole- otolith ages rather than sectioned-otolith ages. All previous radiometric studies offish from temperate and subtemperate waters have verified section counts (Bennett et al., 1982; Campana et al., 1990; Fenton et al., 1990, 1991; Smith et al., 1991). The metabolic effects of the annual cycle of inorganic and organic deposition in otoliths may be more pronounced in these environments resulting in clear annuli in otoliths offish from more temperate regions. Conclusions This study has shown that radiometry using 210 Pb/ 226 Ra activity ratios in both whole and cored otoliths can accurately estimate the ages of fish as young as 3 years. Stable leadibarium mass ratios were used to identify samples that may invalidate the assump- tion of constant uptake of allogenic lead (i?=0). For the lutjanids examined, ring counts in sectioned otoliths were shown to overestimate fish ages. Meth- ods such as marginal increment analysis do not verify that the ageing method used is accurate unless the pattern is demonstrated to be consistent for all age classes. This indicates that tropical fish should be aged by two independent methods where possible to help minimize possible ageing errors. Acknowledgments We thank John Salini, David Brewer, and Ted Wassenberg for coordinating otolith collection and Robert Chisari for meticulously performing the ra- diochemical alpha source preparations. Gwen Fenton and Chris O'Brien made constructive comments on an earlier draft of the manuscript. This project was partly funded by the Australian Fishing Industry Research and Development Council (FRDC grants 88/90 and 29/91). Literature cited Allen, G. R. 1985. FAO species catalogue. Vol. 6: Snappers of the world. FAO, Rome, 208 p. Allen, G. R., and R. Swainston. 1988. The marine fishes of north-western Australia. W. A. Museum, Perth, 201 p. Augustine, ()., and T. J. Kenchington. 1987. A low-cost saw for sectioning otoliths. J. Cons. Int. Explor. Mer 43:296-298. Bennett, J. T., G. W. Boehlert, and K. K. Turekian. 1982. Confirmation of longevity in Sebastes diploproa (Pi- sces: Scorpaenidae) from 210 Pb/ 226 Ra measurements in otoliths. Mar. Biol. 71:209-215. Blaber, S. J. M., D. T. Brewer, and A. N. Harris. 1994. The distribution, biomass and community structure of fishes of the Gulf of Carpentaria, Australia. Aust. J. Mar. Freshwater Res. 45:375-396. Brouard, F., and R. Grandperrin. 1984. Les poissons profonds de la pente recifale externe a Vanuatu. Notes et documents d'Oceanographie No. 11. ORSTROM Port- Vila, Vanuatu, 131 p. Campana, S. E., and J. D. Neilson. 1985. Microstructure of fish otoliths. Can. J. Fish. Aquat. Sci. 42:1014-1032. Campana, S. E., H. A. Oxenford, and J. N. Smith. 1993. Radiochemical determination of longevity in flyingfish Hirundichthys affinis using Th-228/Ra- 228. Mar. Ecol. Prog. Ser. 100:211-219. Campana, S. E., K. C. T. Zwanenberg, and J. N. Smith. 1990. 210 Pb/ 226 Ra determination of longevity in redfish. Can. J. Fish. Aquat. Sci. 47:163-165. Casselman, J. M. 1974. Analysis of hard tissues of pike Esox lucius with spe- cial reference to age and growth. In T B. Bagenal (ed. ), The ageing offish, p. 13-27. Unwin Brothers, Ltd., England. Chen, C. Y., S. Y. Yeh, and H. C. Liu. 1984. Age and growth of Lutjanus malabaricus in the north west shelf off Australia. Acta Oceanogr. Taiwan 15:154-164. Conover, W. J. 1980. Practical nonparametric statistics. John Wiley and Sons, New York, 493 p. Davis, T. L. O., and G. J. West. 1992. Growth and mortality of Lutjanus vittus from the north west shelf of Australia. Fish. Bull. 90:395-404. Druzhinin, A. D., and N. A. Filatova. 1980. Some data on Lutjanidae from the Gulf of Aden. J. Ichthyol. 39:8-14. Edwards, R. R. C. 1985. Growth rates of Lutjanidae (snappers) in tropical Australian waters. J. Fish Biol. 26:1-4. Fenton, G. E., D. A. Ritz, and S. A. Short. 1990. 210 Pb/ 226 Ra disequilibria in otoliths of blue grenadier Macruronus novaezelandiae: problems associated with ra- diometric ageing. Aust. J. Mar. Freshwater Res. 41: 467-473. Fenton, G. E., S. A. Short, and D. A. Ritz. 1991. Age determination of orange roughy, Hoplostethus atlanticus (Pisces: Trachichthyidae), using 210 Pb: 226 Ra disequilibria. Mar. Biol. 109:197-202. Fenton, G. E., and S. A. Short. 1992. Fish age validation by radiometric analysis of otoliths. Aust. J. Mar. Freshwater Res. 43:913-922. Francis, R. I. C. C. 1988. Are growth parameters estimated from tagging and age-length data comparable? Can. J. Fish. Aquat. Sci. 45:936-942. Grant, E. M. 1985. Guide to fishes. Dep. Harbours and Marine, Bris- bane, 896 p. Milton et al.: Ageing of Lutjanus erythropterus, L malabancus. and L sebae I 15 Ju, D. R., S. Y. Yeh, and H. C. Liu. 1988. Age and growth of Lutjanus altifrontalis in the waters off northwest Australia. Acta Oceanogr. Taiwan 20: 1-12. Knight, W. 1968. Asymptotic growth: an example of nonsense disguised as mathematics. J. Fish. Res. Board Can. 25:1303-1307. Lai, H. L., and H. C. Liu. 1974. Age determination and growth of Lutjanus sanguineus in the South China Sea. J. Fish. Soc. Taiwan 3:39-57. 1979. Age determination of Lutjanus sanguineus in the Arafura Sea and northwest shelf. Acta Oceanogr. Taiwan 10:160-171. Longhurst, A. R., and D. Pauly. 1987. Ecology of tropical oceans. Acad. Press, London, 407 p. McPherson, G. R., and L. Squire. 1992. Age and growth of three dominant Lutjanus species of the Great Barrier Reef inter-reef fishery. Asian Fish. Sci. 5:25-36. Manooch, C. S. 1987. Age and growth of snappers and groupers. In J. J. Polovina and S. Ralston (eds.), Tropical snappers and grou- pers: biology and fisheries management, p. 329- 373. Westview Press, Boulder. Morawska, L., and C. R. Phillips. 1993. Dependence of the radon emanation coefficient on radium distribution and internal structure of the material. Geochim. Cosmochim. Acta 57:1783-1797. Ratkowsky, D. A. 1986. Statistical properties of alternative parameter- izations of the von Bertalanffy growth curve. Can. J. Fish. Aquat. Sci. 43: 742-747. Sainsbury, K. 1988. The ecological basis of multispecies fisheries, and management of a demersal fishery in tropical Australia. In J. Gulland (ed.), Fish population dynam- ics, p. 349-382. Wiley, Chichester, England. SAS (SAS Institute, Inc). 1989. Non-linear regression. In SAS user's guide: statis- tics, p. 575-606. SAS Inst., Inc., Cary, NC. Schnute, J., and D. Fournier. 1980. A new approach to length-frequency analysis: growth structure. Can. J. Fish. Aquat. Sci. 37:1337-1351. Smith, J. N., R. Nelson, and S. E. Campana. 1991. The use of Pb-210/Ra-226 and Th-228/Ra-228 disequilibria in the ageing of otoliths of marine fish. In P. J. Kershaw and D. S. Woodhead (eds), Radionuclides in the study of marine processes, p. 350-359. Elsevier, London. Vaughan, D. S., and P. Kanciruk. 1982. An empirical comparison of estimation procedures for the von Bertalanffy growth equation. J. Cons. Int. Explor. Mer 40:211-219. West, I. F., and R. W. Gauldie. In press. Determination of fish age using 210 Pb: 226 Ra disequilibrium methods. Can. J. Fish. Aquat. Sci. 51. Wong, C. S., Y. P. Chin, and P. M. Gschwend. 1992. Sorption of radon-222 to natural sediments. Geo- chim. Cosmochim. Acta 56:3923-3932. Yeh, S. Y, C. Y. Chen, and H. C. Liu. 1986. Age and growth of Lutjanus sebae in the waters off northwestern Australia. Acta Oceanogr. Taiwan 16:90-102. Abstract. — Age and growth of the dusky shark, Carcharhinus obscurus, was estimated from bands in the vertebral centra of 122 individuals and from length-fre- quency data from 341 individuals. The von Bertalanffy growth func- tion parameters from the vertebral analysis were considered more ro- bust (L =373, #=0.038, < =-6.28, male; zT=349, #=0.039, * =-7.04, female). Comparison of male and female growth curves generated from vertebral data indicate a sta- tistically significant difference; however, these differences are due primarily to larger sizes attained by adult females. Estimates of age at maturity indicate that dusky sharks follow the typical carchar- hinid pattern of slow growth and late age at maturity. The size at maturity is reported at 231 cm FL and 235 cm FL for males and fe- males, respectively. These lengths correspond to approximately 19 years for males and 21 years for fe- males. The oldest fish aged from ver- tebrae was a 33+ year-old female. Age and growth estimates for the dusky shark, Carcharhinus obscurus, in the western North Atlantic Ocean Lisa J. Natanson John G. Casey Nancy E. Kohler Narragansett Laboratory, Northeast Fisheries Science Center National Marine Fisheries Service, NOAA 28 Tarzwell Drive Narragansett, Rhode Island 02882-1 199 Manuscript accepted 15 July 1994. Fishery Bulletin 93:116-126 (1995). Sharks have become increasingly important in U.S. commercial fish- eries in the western North Atlantic Ocean in recent years. U.S. landings of large coastal sharks, represented primarily by several species in the family Carcharhinidae, increased from 135 to 7,122 metric tons (t) from 1979 to 1989 (Anon., 1993). Musick et al. (1993) reported that annual recreational catches are es- timated to be 35,000 U.S. tons and related annual mortality is over 10,000 U.S. tons (9,074 1). As a group, sharks tend to exhibit slow growth, late age at maturity, and low fecun- dity (Holden, 1973). As a conse- quence of these life history charac- teristics, recruitment in sharks is directly dependent on stock size (Holden, 1973). This direct relation- ship means that elasmobranchs may not be able to recover readily from overexploitation (Holden, 1973). The dusky shark, Carcharhinus obscurus, is part of the species com- plex presently managed under the Secretarial Shark Fisheries Manage- ment Plan (FMP) for the Atlantic Ocean (Anon. 1993). Currently, dusky sharks are harvested in commercial fisheries off the southeastern United States and in the Gulf of Mexico. Rec- reational fishermen off the northeast- ern United States also catch dusky sharks (Casey and Hoey, 1985; Musick et al., 1993). The shark FMP (Anon. 1993) details the need for ac- curate life history information on in- dividual species taken in the shark fishery. Proper management at the species level requires specific infor- mation on age and growth. The dusky shark is a common coastal pelagic species with a world- wide distribution in temperate and tropical waters (Compagno, 1984). In the western North Atlantic, it ranges from as far as Banquereau Bank off Nova Scotia, Canada, to southern Brazil, including the Gulf of Mexico and Caribbean Sea (Hoey, 1983; Compagno, 1984). Tagging studies show dusky shark move- ments from southern New England to Yucatan, Mexico (Casey et al. 1 ; Hoey, 1983). Age and growth studies of large sharks are difficult because many species are highly migratory, mak- ing them available for only short seasonal periods, and different ele- ments of the population segregate spatially by size and sex (Hoenig and Gruber, 1990). In addition, the large size attained by adults makes them difficult to sample. Recent lit- erature has discussed the benefits of growth and longevity estimates attained from tag and recapture 1 Casey, J. G., H. L. Pratt Jr., and C. E. Stillwell. 1980. The shark tagger summary. Newsletter of the Coop. Shark Tagging Program. U.S. Dep. Commer., Northeast Fish. Sci. Cent., Natl. Mar. Fish. Serv., 28 Tarzwell Rd., Narragansett, RI, 02882-1199. 116 Natanson et al.: Age and growth estimates for Carcharhmus obscurus I 17 studies (Casey and Natanson, 1992). These data are not available for the dusky shark nor is validation of vertebral band periodicity. Previous attempts to age the dusky shark were based on limited data and were inconclusive (Lawler, 1976; Hoenig, 1979; Schwartz, 1983). We have attempted to strengthen age esti- mates of C. obscurus by using vertebral band counts together with marginal increment analysis and by us- ing comparisons with length-frequency data. With the von Bertalanffy growth function thus derived, we esti- mate age at maturity and longevity for this species. Materials and methods Data and vertebral samples from dusky sharks were obtained between 1963 and 1993 from research cruises, sport fishing tournaments, and commercial shark fishermen from Cape Cod, Massachusetts, to off the east coast of Florida. Vertebral samples were taken in all months except January, March, and November. Length measurements Total and fork lengths were measured to the nearest centimeter (cm) for each specimen. Fork length (FL) was measured from the tip of the snout to the fork of the tail. Total length (TL) is defined as the distance from the snout to a point on the horizontal axis in- tersecting a perpendicular line extending downward from the tip of the upper caudal lobe to form a right angle (Kohler et al. 2 ). All lengths used are fork lengths unless otherwise noted. FL can be converted to TL by using the regression equation: FL = 0.8352 (TL) -2.2973. [r 2 = 0.99, n = 167] Vertebral samples Vertebral samples were taken from above the bran- chial chamber. Sections of vertebral columns were trimmed of excess tissue and then frozen or preserved in 70% ethanol (Casey et al., 1985). Two vertebrae from each specimen were processed histologically following Casey et al. (1985), with the exception of the use of RDO (DuPage Kinetics) for decalcification. All vertebral sections were cut sagit- tally through the focus to a thickness of 80-100 mi- crons, stained with Harris hematoxylin, and mounted in glycerin jelly (Humason, 1972). Bands in the vertebra were counted from an im- age projected on a Summagraphics MM-1812 digi- tizing tablet (Skomal, 1990). Measurements from the focus to growth bands at points along the internal corpus calcareum were digitized directly into an IBM PC-XT computer. The radius of each centrum was measured from the focus to the distal margin of the intermedialia along the same diagonal as the band measurements. Annual growth marks were defined following Casey et al. (1985) for the sandbar shark, Carcharhinus plumbeus, where the annual mark is defined by a wide translucent zone that traverses the intermedialia and continues into the corpus calcareum as an opaque band. Vertebral sections from 171 dusky sharks were prepared. Bands in the same centrum section were counted at least once by each of four investigators to verify that the band counts were repeatable. Sections were considered unreadable if bands could not be discerned in accordance with the above definition. If two readers considered the section unreadable, the sample was eliminated from the final analysis. Counts were accepted if two or more readers agreed. The individual ring measurements for all readers in agreement were then averaged. If two readers agreed on one count and two on another for the same specimen, the higher count was accepted. Specimens where there was no initial agreement were recounted until two of the investigators reached a consensus or the sections were discarded. The relationship between vertebral radius (VR) and FL was calculated to determine the most appro- priate method for back calculation of the size-at-age data (Ricker, 1969). The FL to VR relationship was linear but did not pass through the origin. There- fore, the Lee method was considered more appropri- ate (Ricker, 1969): I - a + (b x s), where / = the length of fish when the vertebra was obtained; a = the intercept on the length axis; b = the slope of the line; and s = the total vertebral radius. A von Bertalanffy growth function (VBGF) was fit- ted to the data by using the following equation (von Bertalanffy, 1938): L t =L„(l-e- k «-<°>), 2 Kohler, N. E., J. G. Casey, and P. A. Turner. Length-weight re- lationships for 13 Atlantic sharks. Unpubl. manuscr. where L t = predicted length at time t\ L x = mean asymptotic fork length (of the fish); K = a growth rate constant (yr _1 ); and t = the theoretical age at which the fish would have been zero length. 118 Fishery Bulletin 93(1), 1995 Growth in length data were analyzed by using FISHPARM, an IBM PC compatible program (Prager et al., 1987), which implements Marquardt's algo- rithm for nonlinear least squares parameter estima- tion (Marquardt, 1963). Bernard's (1981) multivariate analysis for compar- ing growth curves was employed to test the hypoth- esis that male and female vertebral growth curves were the same. This method also determines which of the von Bertalanffy parameters are the most sta- tistically significant cause of any differences in growth. Marginal increment analysis Validation, the confirmation of the temporal mean- ing of the growth increment (Brothers, 1983), is dif- ficult to attain for large pelagic species and was at- tempted by using marginal increment analysis. The marginal increment ratio (MIR) (Skomal, 1990) was calculated by using the following equation: MIR = (VR - R n )/(R„ - R n ^), where VR = the vertebral radius; R n = the last complete band; and R n _ 1 = the next to last complete band. Mean MIR was plotted against month to locate peri- odic trends in band formation. The MIR relates the edge formation to the width of the previous completed band, which corrects for differences in band width between small and large fish. Length frequency Length-frequency distributions were analyzed by us- ing Shepherd's (1987) model. The sample was sepa- rated by sex and calculations were made at 3-cm in- tervals. Initial values of L m and K, based on biologi- cal parameters obtained from the literature (Springer, 1960; Compagno, 1984) were entered into the pro- gram which was then rerun until the highest score function was attained. The L M and if associated with this score function were used to calculate t Q by using the following equation: t Q = t + (UK) (\n[L x - L t ]/LJ, where t = (birth); L t = mean size at birth; K = the von Bertalanffy growth constant; and L oo = the mean asymptotic fork length. Longevity Estimates of longevity were obtained by using tag and recapture data. Data on eight recaptured dusky sharks at liberty for greater than 10 years were ex- amined. Age at tagging was assigned from the size estimate provided at the time of release. This esti- mated age was based on growth curves derived from vertebrae. The number of years at liberty were then added to estimate age at recapture. Results Vertebral samples Of the 171 processed vertebra, 36 (21.0%) were con- sidered unreadable. Initial agreement by two or more readers was reached on 89 specimens. The remain- ing 50 sections were recounted by two of the investi- gators. A consensus was reached on 37 of those re- counted and the rest were discarded as unreadable. Six were then eliminated for having no information on sex. The remaining 120 (70.2%) consisted of 53 male and 67 female specimens ranging in size from a 73 cm FL neonate to a 296 cm FL adult female. The FL-VR regression showed a linear relationship: FL = 12.82(VR) + 24.99 [n = 114; r 2 = 0.99] . The FL to VR relationship was significantly differ- ent between the sexes for all fish combined (ANCOVA, P<0.05). However, this was due to three large females whose removal from the analysis al- tered the curves and showed the males and females to be statistically indistinguishable (P<0.05) (Fig. 1). We chose to use the combined relationship without those three samples. Back-calculated as compared with empirical length-at-age data show a smaller estimated size for fish of younger ages, when calculated from the ver- tebrae of the older fish, indicating the presence of a slight Lee's phenomenon for both sexes (Table 1). Lee's phenomenon was more pronounced in females and increased with age. The MIR data showed a distinct, periodic trend of increasing increment growth from April through June (female) or July (male); after this peak there was a slight decrease and apparent leveling (Fig. 2). The decrease in incremental growth is not large enough to indicate a double band formation. The graph suggests that an annual winter band is formed between September and April. This band can be vis- ible by February in males; no data were available for females. The time of annulus formation cannot Natanson et al.: Age and growth estimates for Carcharhinus obscurus 300 - 250 g 200 _c ? 150 o _i £ 100 - 50 -■ • ••» Large females not used for regression calculation 10 15 Radius (mm) 20 25 Figure 1 Relationship between vertebra] radius (cm) and fork length (cm) for male and female dusky sharks, Carcharhinus obscurus. be further established owing to a lack of winter samples. January was used as the month of band formation for the assignment of age classes (Casey et al., 1985). Back-calculated length at first band (80.2 cm FL male; 85.8 cm FL female ) corresponded closely to the known size at birth of 85-100 cm TL (Castro, 1983; Compagno, 1984). The first winter band would have formed after approximately six months growth (as- suming January deposition and spring parturition), and the following bands represented annual growth (Branstetter, 1987). The oldest female in the sample was 33+ years and the oldest male, 25+ years. The parameters of the VBGF determined from the back-calculated data were similar to known life his- tory characteristics except that the predicted L^ for males was higher than that for females (Table 2). Those samples that were neonates with no visible birthmark were excluded from the VBGF analysis. Therefore, only 114 samples (47 male and 67 female) were included in the final calculations. The t Q and if values appear simi- lar between the sexes (Table 2). However, the male and female growth curves are significantly different (P<0.05) based on Bernard's ( 1981) multivariate analysis (Table 3). The results indicated that the differences were caused by the t and L x values (in order of significance). The reported size at maturity for the dusky shark is 231 cm FL and 235 cm FL for males and females, respectively. These lengths correspond to 19 years for males and 21 years for females based on the ver- tebral growth curves (Table 4). Length frequency Length observations from a total of 208 female and 133 male dusky sharks were used to calculate von Bertalanffy parameters by using length-frequency analysis. Samples were obtained from 1961 to 1987 for the months May through November. Because of small yearly sample sizes, data for all years were combined by month. A comparison of the VBGF parameters from the length-frequency analysis [LF] with those derived from vertebral analysis (Table 2) shows that the L m and t values from the vertebral analysis for females were lower than those derived from the length-frequency analysis, and that the K value for females was basi- cally the same for both data sets. The length-frequency analysis for males results in a lower L^ than that from the vertebral analysis and in higher t and K values. The VBGF differences in both sexes are not large and both curves indicate late age at maturity (males: 25 yr [LF], 19 yr [vertebral]; females: 16 yr [LF], 21 yr [ver- tebral]) and slow growth (males: if =0.049 [LF], 0.038 [vertebral]; females: #=0.040 [LF], 0.039 [vertebral]) (Fig. 3). The von Bertalanffy parameters for the sexes combined are shown for comparison (Table 2). Longevity Tagging records from NMFS Cooperative Shark Tag- ging Program show that 6,067 dusky sharks were tagged and 131 recaptured between 1962 and 1992. 120 Fishery Bulletin 93(1), 1995 Table 1 Back-calculated and observed size-at-age data for male and female dusky shark Carcharhinus obscurus. Male Ring( age in years) Birth 6 months 1 2 3 4 5 6 7 8 Back-calculated X 80.2 87.3 94.1 103 113.9 124.4 132 140.5 149.7 157.7 163.8 SD 5.6 5.5 6.2 7 9.2 10.6 10.7 11.7 12.7 12.6 10.5 n 47 34 30 28 25 21 20 20 19 17 Observed X 87.7 100.5 123.5 116.7 124.5 138 148 173.5 164 SD 5.1 53. 2.1 5.5 4.9 0.7 7.9 n 13 4 2 3 4 1 1 2 3 Male Ring( age in years) 9 10 11 12 13 14 15 16 17 18 19 Back-calculated X 161.7 179.2 188.6 196.1 202.4 209.8 216.1 220.5 226.5 232.3 237.9 SD 11.6 12.3 10.4 11.8 11.7 13.5 13 11.4 11.7 12.4 12.5 n 14 13 11 10 10 10 10 9 9 8 8 Observed X 172 177.5 177 233 245 260.5 SD 2.1 9.2 n 1 2 1 1 1 2 Male Ring (age in years) 20 21 22 23 24 25 26 27 28 29 30 Back-calculated X 246.4 252.6 254.9 256.6 252.6 255.2 SD 14.5 13.2 15.1 16.1 n 6 6 4 3 1 1 Observed X 256.5 256 263.5 265 SD 3.5 9.2 n 2 1 2 1 1 female Ring (age in years) Birth 6 months 1 2 3 4 5 6 7 8 Back-calculated X 85.8 92.3 99.3 107.4 118.8 128.6 136.2 143.7 150.5 157.8 164.8 SD 5.1 4.5 5 6.3 8.4 9.4 9.5 8.5 8.8 9.4 9.9 n 67 55 52 50 48 45 41 38 35 33 33 Observed X 91.8 104.3 106.5 107 122.3 134.8 138.3 161 154.5 SD 4.5 7.2 6.4 2.8 3.8 16.8 26 12.5 3.5 n 12 3 2 2 3 4 3 3 2 Natanson et al.: Age and growth estimates for Carcharhinus obscurus 121 Table 1 (continued) Female Ring (age in years) 9 10 11 12 13 14 15 16 17 18 19 Back-calculated X 171.5 178.8 186.3 192.9 199.8 206.2 212.4 216.7 222.6 228.4 233.4 SD 10.2 9.6 10.8 10.9 12.4 12.9 13.3 10.5 11.6 12.3 12.6 n 33 30 28 28 28 28 28 27 27 27 27 Observed X 183 190 262 281 SD 15.5 9.9 n 3 2 1 1 Female Ring (age in years) 20 21 22 23 24 25 26 27 28 29 30 Back-calculated X 237.9 242.1 246 149.8 252.9 256.4 258.6 262.9 265.4 266.2 265.1 SD 12.3 12.1 12.5 12.2 12.6 13.5 11.9 13.3 11.8 15.2 12.7 n 26 24 23 22 20 16 15 13 9 5 4 Observed X 253.4 263 284 156.5 161.5 274 266.5 272 270.8 281 262 SD 14.8 2.1 9 16.3 10.5 6.5 n 2 1 1 2 4 1 2 4 4 1 1 Female Ring (age in years 1 31 32 33 34 35 36 37 38 39 40 41 Back-calculated X 267.9 277.1 291.4 SD 15.2 16.6 rc 3 2 1 Observed X 269 269 276 SD rc 1 1 1 Eight of these fish were at liberty from 10.1 to 15.8 years. Estimated ages at tagging were based on the vertebral growth curve and ranged from birth to 27 years. The best example of longevity came from a dusky shark that was tagged at an estimated 27 years (260 cm FL) and was recaptured 12 years later at an estimated age of 39 years (Table 5). Discussion In the present study, vertebral data and length-fre- quency data were independently analyzed to derive estimates of von Bertalanffy growth parameters for the dusky shark. Because of the differences between the methods and their sensitivity to the data used to calculate the VBGF parameters, each method pro- duced slightly different growth curves and, therefore, different estimates of age at maturity and longevity (calculated based on maximum reported size). The length-frequency estimates obtained from the dusky shark data are probably somewhat biased owing to limitations of the data and properties of the length- frequency model (Majkowski et al., 1987; Shepherd 122 Fishery Bulletin 93(1). 1995 et al., 1987; Natanson, 1990). As a slow-growing, long-lived species, the dusky shark may have over- 1.2 MALE 1 OH = 0.8 /\ Z 0.6 < W 04 / V" 02 r^* J FMAMJ JASOND MONTH n= 001 64 11 13 54 00 12 FEMALE or 5 0.8 y\ Z 0.6 < W 04 J 02 J FMAMJ JASOND MONTH n= 001 517 16 22 20 00 Figure 2 Mean vertebral marginal increment ratios (MIR) by month for each of four readers for the dusky shark, Carcharhinus obscurus. Number of samples used to calculate the means for each month are located below the figure. lapping lengths at age which may obscure length modes and bias the estimates of model parameters (Rosenberg and Beddington, 1987; Shepherd et al., 1987). The vertebral method is therefore considered the more robust method and the length-frequency parameters are used for comparison only. Yoccoz (1991) has brought up questions as to the validity of judging biological significance based on statistical tests. He suggests that statistical signifi- cance is not necessarily indicative of biological sig- nificance; this appears to be the case with the dusky shark. The statistically significant differences shown between male and female dusky shark vertebral growth curves may not reflect biological differences. Examination of the length-at-age data suggests that biologically the differences between male and female vertebral curves are small. The age and size at ma- turity differ by only two years and five centimeters for males and females (Table 4). Females are pre- sumed to grow ultimately to a larger size than males. This means that either growth slows in males after maturity or that males do not live as long as females. The vertebral VBGF derived in this study is very similar to the curve attained by Hoenig (1979) for combined sexes for the ages under consideration (birth to 33 years) but is different from data presented by Lawler (1976) and Schwartz (1983). Hoenig's ( 1979) parameter values for the VBGF have a slightly higher L ro and t and lower K than parameters de- rived from vertebral analysis in the present study (Table 2). Lawler (1976), using vertebral analysis to determine the age of female dusky sharks, obtained VBGF-parameter values markedly different from the present study (Table 2). The L x in his study is more than twice as large as the L x reported here and his lvalue suggests a much slower growth rate. These two factors combine to make Lawler's (1976) curve appear as a straight line from birth to 34 years. Table 2 The von Bertal, dusky sharks ai Parameters inffy para id Lawler meters derived in this study compared to those derived in Hoenig's (19791 's (1976) study of female dusky sharks, Carcharhinus obscurus. study of male and female Male Female Combined L„ K t n £» K 200 kg/hr) in spring and fall at depths of 183-365 m and decreased in winter, while above 183 m CPUE was highest (about 50- 150 kg/hr) in July-August but dropped to at or near 0.0 kg/hr in November-March. There was no appar- ent seasonal trend in CPUE at depths >366 m. The proportion of mature females at each macro- scopic maturity stage varied seasonally (Fig. 3). Be- cause spring discards included fish that were the Rickey: Maturity, spawning, and seasonal movement of Atheresthes stomias 131 Market n = 2,167 15 20 25 30 35 40 45 50 55 60 65 70 75 80 Discard n = 185 014 012 0.10 08 0.06 0.04 02 000 15 20 25 30 35 40 45 50 55 60 65 70 75 60 Survey n = 351 15 20 25 30 35 40 45 SO 55 60 65 70 75 Length (cm) Figure 2 Length-frequency distributions of arrowtooth flounder by sample category. Dark bars = males; clear bars = females. same size as fish in winter market samples, discard and market samples were pooled by common month and by keeping years separate. Throughout the year, samples almost always included large spent/resting females that did not show signs of ovarian recrudes- cence. Gravid females first appeared consistently in September 1991. The proportion of developing, gravid, and spent females stayed relatively constant through November. In December the first ripe/run- ning fish and a substantial increase in the propor- tion of spent females were seen. The next available sample was March 1992 when all the mature females were in the spent/resting stage. Developing females reappeared the following May, and their proportion increased into the fall. In 1992, the first gravid and ripe/running fish were seen in November. Length at 50% maturity calculated from survey data was 28.0 cm for males and 36.8 cm for females (Table 5). Estimates of L 50% from pooled market and discard ("commercial") data were lower for males and higher for females than estimates from survey data, although confidence intervals for L 50% overlapped. For females, seasonal estimates of L 5m varied widely. The greatest L 5Q% (>41 cm) was seen before spawn- ing (May-August) and the lowest (<37 cm) during spawning (September-December). Parameters for the logistic function were compared with a likelihood- ratio test (Kimura, 1980). Estimates from commer- cial data were significantly different from survey estimates for both females (x 2 =145.490, P«0.001; Fig. 4) and males (x 2 =79.383, P«0.001). In a com- parison of years, logistic curves fit to September- December 1991 (commercial) and September-Novem- ber 1992 ( survey) data were significantly different (like- lihood-ratio test, x 2 =143.257,P«0.001) although again confidence intervals for L 5QC/c overlapped. Ovarian tissue samples were analyzed histologi- cally from 111 female arrowtooth flounder collected late December 1991 during spawning. Each of the five macroscopic maturity stages was represented and no two macroscopic stages showed the same fre- quency distribution of oocyte types (Fig. 5). Chroma- tin nucleolar, perinucleolar, and atretic oocytes were present in all the sampled ovaries. In ovaries of im- mature fish, none of the oocytes had progressed be- yond the perinucleolar stage. Vitellogenic or yolked oocytes were prevalent in developing and gravid stage ovaries, and hydra ted oocytes were seen frequently in gravid and ripe/running stage ovaries. Oocytes with cortical alveoli were most frequently seen in spent/resting ovaries. Atresia was more prevalent in all the ovarian stages of spent/resting fish than in immature fish (Table 6). The percent occurrence of a atretic oocytes was lowest in ovaries from developing fish and high- est in ovaries from spent/resting fish. Beta atresia was most common in spent/resting ovaries but also occurred in developing, gravid, and immature ova- ries. All the immature and 43.8% of the spent/rest- ing females had perinucleolar stage ovaries. Postovulatory follicles (POF) were present in ovaries from all macroscopic stages except immature. POF were most frequently seen in ripe/running ovaries and were common in gravid and spent/resting ova- ries; whereas 7 of 29 developing females examined for histology had ovaries with POF. Postovulatory follicles were also present in 7 of 21 spent/resting 132 Fishery Bulletin 93(1). 1995 162 79 300 148 165 172 104 41 50 36 0.4 0.2 - 0.0 H — V — V — H 1 — *V — 4 H H — 4 f — H f — V — V — H Jul Aug Sep Oct Nov Dec Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov 1991 rj> <3 1992 [> H Developing £ Gravid Ripe/Running [~ H Spent/Resting Figure 3 Proportions of mature female arrowtooth flounder at each macroscopic maturity stage by month. Number of females listed at top. Table 4 Washington commercial bottom trawl catch rates (kg/hr) of arrowtooth flounder, Atheresthes stomias, by depth interval based on the minimum depth recorded for each tow. n = number of tows. Year Month 1- -182 m 183- -365 m 366-547 m 547+ m n kg/hr n kg/hr n kg/hr n kg/hr 1991 July 1,644 155.7 176 184.0 31 44.6 9 134.5 August 1,391 54.5 179 130.6 21 3.0 5 0.0 September 1,362 14.5 187 157.6 54 27.7 7 0.0 October 860 11.8 274 231.7 56 64.3 4 0.0 November 210 0.0 95 20.3 37 22.7 3 0.0 December 187 0.0 126 8.9 82 35.8 7 0.0 1992 January 221 0.1 120 14.9 82 8.9 18 11.0 February 596 0.0 240 10.7 61 12.2 37 0.4 March 883 0.3 201 19.5 178 39.8 85 8.9 April 462 7.4 155 53.9 110 68.5 31 1.7 May 829 16.3 232 228.2 63 71.0 40 0.0 June 1,131 19.0 174 344.1 38 16.4 90 0.5 July 1,246 53.4 134 50.8 13 1.7 82 1.5 females with perinucleolar-stage ovaries. One 41.0- cm gravid female had no POF and 6.3% of its oocytes were hydrated. All other gravid females had POF. Overall mean oocyte diameters (/im) and standard deviations were as follows: perinucleolar 79.6 ± 34.9 (n=420); cortical alveoli 185.4 ± 23.4 (n=220); vitellogenic 722.9 ± 73.9 (n=290); and hydrated 940.6 ± 206.8 (n=170) (Fig. 6). Chromatin nucleolar stage oocytes were not measured because they never rep- resented the most advanced stage present in an ovary. Mean diameter of perinucleolar oocytes in spent/resting females was about 10 /im greater than that in the immature females (Student's £-test, P<0.003). Some of the variance in hydrated oocyte size Rickey. Maturity, spawning, and seasonal movement of Atheresthes stomias 133 Table 5 Parameter estimates for the logistic model' of proportion mature at length (cm ), length at 50% mature, and 95% confidence intervals, for arrowtooth flounder, Atheresthes stomias from 1991- -92 Washington commercial (pooled market and discard) 1992 Washington survey, and 1972- -75 Oregon data (See Footnote 3 in the text). For females, results are also given for Washi ngton commereial data grouped by months in relation to the spawning season. Sex and stratum a b R 2 L 50% < Cm > 95%CIforL 50% n Males Washington-survey 24.990 -0.893 0.968 28.0 27.6-28.4 144 Washington-commercial 33.264 -1.197 0.968 27.8 27.5-28.1 424 Oregon 17.397 -0.615 0.971 28.3 27.8-28.8 218 Females Washington-survey 19.891 -0.540 0.971 36.8 36.3-37.3 207 Washington-commercial 20.874 -0.559 0.984 37.4 37.0-37.7 1,928 Oregon 15.056 -0.352 0.989 42.8 42.4-^13.2 1,628 Females 2 Jul-Aug 1991 (before) 13.050 -0.281 0.390 46.5 43.2-49.7 298 Sep-Dec 1991 (during) 14.800 -0.410 0.945 36.1 35.5-36.7 887 Mar-Apr 1992 (after) 61.111 -1.568 0.991 39.0 38.8-39.1 239 May-Jul 1992 (before) 18.194 -0.438 0.928 41.6 40.6^2.6 504 1 P L = l/(l+e ta+w ->). 2 No samples obtained in January-February 1992. can be attributed to distortion of hydrated oocytes that occurs during histological processing. Gonosomatic indices (GSI) for immature and spent/resting fish remained fairly constant across seasons, whereas GSI for developing or gravid fish varied considerably over time, reflecting ovarian recrudescence (Table 7). Individual GSI for im- mature fish ranged from 0.0017 to 0.0154 (aver- age 0.0055), and individual spent/resting GSI ranged from 0.0037 to 0.0259 (average 0.0135). GSI for ripe/running fish (n=4; L =47.8) was not calculated because loss of eggs in handling pre- cluded accurate gonad weights. From histologi- cal analysis, hydrated oocytes and POF were found in "developing" females, indicating some misclassification of spawning females. Because of suspected misclassification, developing and gravid GSI data were pooled by month. GSI for develop- ing or gravid fish showed a rapid increase from about 0.03 in August 1991 and 0.02 in July 1992 to 0.06 in September of both years; the highest an- nual mean GSI occurred in December 1991 and No- vember 1992. The highest individual GSI was 0.2201 in November 1992 for a 38-cm gravid female. 1.0 0.8 0) TO E 0.6 o "g 0.4 Q. O ^0.2 0.0 TftKP*aHBl*ffi- 15 20 25 30 35 40 45 50 55 60 65 Fork Length (cm) -- Commercial^*- Survey Oregon Figure 4 Maturity distributions and logistic curves for female arrowtooth flounder calculated from pooled 1991-92 market and discard (commercial) data, 1992 survey data, and 1973-75 data from Oregon (see Footnote 3 in the text). Discussion The progression of gonad maturity stages, increase in GSI, and the appearance of gravid females show that arrowtooth flounder spawn during fall-winter off Washington. Spawning begins as early as Sep- tember, extends at least through December, and is completed by March. This coincides with the spawn- ing season for Atheresthes evermanni in the western 134 Fishery Bulletin 93(1), 1995 Table 6 Percent occurrence of oocytes in each oocyte developmental stage in arrowtooth flounder, Atheresthes stomias, by macroscopic and microscopic maturity stages. Percent occurrences of atresia and postovulatory follicles (POF) among all oocyte structures also included. Microscopic stage reflects the most advanced oocyti 3 type present, n = number of females, L = mean FL in cm; oocyte-stage 1 = chromatin nucleolar; stage 2 : = perinucleolar; stage 3 = cortical alveoli , stage 4 = vitellogenic; stage 5 = hydrated; and POF = postovulatory follicle. Samples were collected late December 1991. Oocyte developmental stage Atresia Macroscopic Microscopic stage stage n L (cm) 1 2 3 4 5 a P POF Immature Perinucleolar 17 35.7 19.0 81.0 0.0 0.0 0.0 11.5 1.3 0.0 Developing Vitellogenic 26 43.0 2.4 20.7 0.1 76.8 0.0 3.6 0.9 0.5 Developing Hydrated 3 39.7 1.0 20.6 0.0 77.0 1.4 6.6 0.9 0.9 Gravid Hydrated 15 40.4 3.1 25.5 0.2 47.0 24.1 7.2 0.9 7.1 Ripe/Running Hydrated 2 59.0 3.3 39.6 0.0 1.1 56.0 7.2 0.0 26.8 Spent/Resting Perinucleolar 21 48.2 15.8 84.2 0.0 0.0 0.0 21.7 7.3 5.4 Spent/Resting Cortical alveoli 26 61.8 14.5 76.1 9.4 0.0 0.0 20.1 10.2 2.9 Spent/Resting Hydrated 1 42.0 6.3 34.4 0.0 34.4 25.0 16.7 0.0 7.1 Developing Gravid Ripe/Running Spent/Resting □ Postov ulalory follicle □ Beta atretic Alpha atretic Alpha Hydrat Vitellogenic □ Cortical alveoli □ P •'"nucleolar □ Chromatin nucleolar Figure 5 Proportion of arrowtooth flounder oocytes assigned by histological criteria to ovarian de- velopmental stages according to macroscopic maturity stage of the whole ovary. Samples were collected late December 1991. Number of females is listed at top. Bering Sea reported by Pertseva-Ostroumova ( 1960). Hirschberger and Smith (1983) found some spawn- ing arrowtooth flounder during spring and summer months in the Gulf of Alaska, but their survey data were insufficient to define the spawning season with any certainty. The appearance of translucent oocytes is usually taken as an indication that spawning is imminent (hours or days) (West, 1990), although there are no laboratory data to indicate the speed at which arrowtooth flounder oocytes ripen and are ovu- lated. Gravid females were first seen in September 1991 coincident with an increase in GSI. A similar increase in September GSI was seen in 1992, but the first gravid females were observed in November, sug- gesting that the start of arrowtooth flounder spawn- ing may vary from year to year. Histological results show arrowtooth flounder are batch spawners, where one female spawns repeat- Rickey. Maturity, spawning, and seasonal movement of Atheresthes stomias 135 Table 7 Arrowtooth flounder, Atheresthes stomias, monthly mean fork length ( L , in cm) and mean gonosomatic index (GSI) and standard deviation (SD) for females selectively sampled for GSI by macroscopic maturity stage. July 1991-July 1992 samples were col- lected shoreside; September-November 1992 samples were collected at sea. Year Month mmature Developing/Gravi d Spent/Resting n L GSI SD n L GSI SD n L GSI SD 1991 July 1 48.0 0.0056 22 63.3 0.0277 0.0096 20 61.1 0.0164 0.0021 August 3 48.0 0.0080 0.0035 10 60.4 0.0290 0.0082 2 63.5 0.0120 0.0028 September 9 42.8 0.0064 0.0020 46 65.1 0.0587 0.0249 15 53.9 0.0163 0.0047 October 10 39.4 0.0051 0.0006 40 61.0 0.0738 0.0246 6 56.7 0.0120 0.0066 November 3 41.7 0.0045 0.0003 20 55.7 0.0883 0.0223 2 54.5 0.0051 0.0003 December 14 36.3 0.0048 0.0018 33 47.0 0.1160 0.0332 11 45.7 0.0070 0.0060 1992 March 10 35.9 0.0045 0.0017 — — — 10 49.5 0.0126 0.0015 April 6 40.5 0.0051 0.0013 — — — 20 55.3 0.0114 0.0035 May 9 36.6 0.0048 0.0030 1 67.0 0.0140 — 21 65.4 0.0135 0.0026 June 4 44.5 0.0067 0.0009 20 61.9 0.0171 0.0042 20 64.4 0.0151 0.0030 July 5 41.0 0.0071 0.0034 17 57.8 0.0215 0.0046 18 53.8 0.0145 0.0031 September 18 29.2 0.0063 0.0042 28 55.6 0.0615 0.0292 — — — October 10 35.9 0.0049 0.0017 10 46.0 0.0567 0.0303 — — — November 10 30.0 0.0056 0.0041 11 46.4 0.1004 0.0487 — — — edly over a protracted spawning season, as are Pacific halibut, Hippoglossus stenolepis (St-Pierre, 1984), and Dover sole, Microstomus pacificus (Hunter et al., 1992). Size frequencies of oocyte stages (Fig. 6) show distinct populations of oocytes that indicate a group-synchro- nous pattern of development. Postovu- latory follicles were found in "developing" females, those with no visible translucent oocytes, evidence that these fish had re- cently spawned and that macroscopic examination of ovaries could not separate all spawning from nonspawning fish. In September 1991, early in the spawning season, gravid mean GSI was signifi- cantly greater than developing GSI (Student's t-test, P«0.001), but by No- vember and December there was essen- tially no difference between mean GSI for developing and gravid females (Student's f-test, November P<0.105, December P<0.841); the highest mean GSI was ob- served in December. Under the macroscopic matu- rity definitions used, females progress from imma- ture to the developing stage, then cycle between "de- veloping" and "gravid" as successive batches of oo- cytes ripen and are ovulated. The ripe/running stage corresponds then only to the last and perhaps larg- est batch of oocytes, suggesting that by December spawning was near completion for some females. 0.25 0.20 c o ■C 0.15 o Q. O CL 0.10 + 0.05 0.00 Perinucleolar l \ V Cortical alveoli Vitellogenic 1 i ft a l\ k Hydrated Li „iA fl.,^/\,iflJ ■;„,,, LiiXU,mi^A,M mrA 150 300 450 600 750 900 1050 1200 1350 1500 1650 Oocyte diameter (microns) Figure 6 Size-frequency distributions of arrowtooth flounder oocyte developmen- tal stages from ovaries collected late December 1991. Proportions were calculated separately for each oocyte type. Spent/resting females were seen year-round, evi- dence that adult arrowtooth flounder may not spawn every year. Of particular concern is whether small, resting mature fish were misclassified as immature, and vice versa, since errors will bias estimates of size at ma- turity. Immature male arrowtooth flounder were dif- ficult to identify and errors undoubtedly occurred, 36 Fishery Bulletin 93(1), 1995 but there was not enough auxiliary information to quantify them. Macroscopically immature females examined for histology did not show signs of recent spawning, and all were microscopically staged as perinucleolar. Out of 48 spent/resting females exam- ined for histology, 43.8% also had perinucleolar ova- ries. Seven of these had POF, direct evidence of prior spawning. Of the remaining 14, atretic structures were more than twice as common as in immature females. Hunter et al. (1992) used atresia to distin- guish immature from uncertain maturity in Dover sole ovaries defined as inactive but concluded that microscopic examination of oocytes in histological sections may not identify all mature, postspawning females. Relatively high rates of atresia may indi- cate that fish have finished spawning (Wallace and Selman, 1981), but this alone is insufficient to sepa- rate mature from immature fish because atresia can be brought on by stresses not necessarily associated with spawning, such as starvation, pollution, or other environmental conditions (Wallace and Selman, 1981; Hunter and Macewicz, 1985; Hunter et al., 1992). Because histological criteria could not differ- entiate all mature from immature females and be- cause other microscopic evidence of prior spawning such as ovarian wall thickness (Burton and Idler, 1984) was not available, the degree of misclassi- fication of mature vs. immature females staged mac- roscopically could not be determined. Histological processing is known to cause shrink- age of oocytes (West, 1990); therefore oocyte diam- eters determined from processed tissue sections should be considered an index rather than an abso- lute measurement of oocyte size. For arrowtooth flounder, Pertseva-Ostroumova (1960) reported whole egg diameters are about 2.5-3.5 mm. Matarese et al. (1989) lists A. stomias egg diameter as approxi- mately 3 mm, three times the mean diameter of ripe oocytes determined in this study. Seasonal bathymetric migrations are a familiar pattern in flatfish. Dover sole, Microstomas pad ficus, petrale sole, Eopsetta jordani, and English sole, Pleuronectes vetulus, migrate seasonally across depths (Alverson et al., 1964), and Dover sole tend to reside at deeper depths at older ages (Hunter et al., 1990). Kabata and Forrester (1974) sampled arrowtooth flounder off Vancouver Island in May- June 1968 and found increasing length with depth, and a drop in abundance below 420 m (230 fm) con- sistent with these results. Trends in arrowtooth flounder catch rates by depth and season (Table 4) indicate arrowtooth flounder move offshore in win- ter. Arrowtooth flounder were common in shallow water (<183 m) in summer, when the average size of landed fish was large. In winter, smaller numbers and sizes of arrowtooth flounder were caught in deeper water; whereas several hundred tows were reported in shallow water with virtually no arrowtooth flounder. Large, mature, presumably spawning arrowtooth flounder may have moved out of the range of the trawl fishery, possibly to deeper water or north into Canadian waters. However, tar- geted arrowtooth flounder trips are rare and inde- pendent estimates of the amounts of arrowtooth flounder discarded from trawl catches are high, from nearly 76% off Oregon and Washington (Barss and Demory, 1985) to over 80% in the Gulf of Alaska. 1 Large volumes of discards and catch unreported in logbooks may obscure trends in distribution; they certainly result in underestimates of arrowtooth flounder CPUE. Hosie (1976) states that arrowtooth flounder spawn off central Oregon from December through March at about 200 fm. Hirschberger and Smith (1983) reported spawning arrowtooth floun- der at depths of over 350 m (191 fm) in the Gulf of Alaska. The full extent of the spawning depth range inhabited by arrowtooth flounder has not been de- termined, but in this study in 1991 gravid females were found in commercial tows out to 512 m (280 fm) and ripe/running females at 475 m (260 fm). In 1992 gravid and ripe/running females were found at 399 m (218 fm). Since these results also suggest that in winter the bulk of the population was in water as deep or deeper than 366 m, it is likely that the ma- jority of arrowtooth flounder off Washington spawn at depths exceeding 366 m (200 fm). To examine trends in length at maturity over time, I fitted logistic curves to Oregon trawl survey data from the 1970's 3 to compare with results from Wash- ington (Table 5). The Oregon survey covered the area from Newport, Oregon, south to Cape Blanco and included FL and maturity for 218 male and 1,628 female arrowtooth flounder. Macroscopic criteria used to distinguish mature from immature fish were identical in both studies. Washington maturity samples were collected in all months except Janu- ary and February. All months except July, August, and November were represented in the Oregon data. Arrowtooth flounder in the present study matured at a smaller size than those collected off Oregon, and likelihood-ratio tests (Kimura, 1980) showed sample nonlinear regressions for Oregon were significantly different when compared with both Washington sur- vey data (male x 2=: 74.555, P<<0.001; female X 2 =137.922, P«0.001) and commercial data (male X 2 =80.539,P«0.001; female x 2 =147.920,P«0.001). Distribution of female maturities across lengths (Fig. 4) suggests that female arrowtooth flounder are maturing at a smaller size than they were off Or- egon in the early 1970's, or that there are latitudinal Rickey: Maturity, spawning, and seasonal movement of Atheresthes stomias 137 differences in size at maturity. However, differences between results for Oregon and the present study could be explained by differences in sampling distri- butions across months, or by different interpretations of maturity codes by different observers; therfore they may not represent a biological change. Size-selectivity and areal or bathymetric sampling biases are critical to estimates of L 509l (Welch and Foucher, 1988; Trippel and Harvey, 1991). Predicted length at maturity may be biased if fish are size-seg- regated by area or depth (e.g. if immature fish do not migrate to spawning depths while targeted com- mercial trawl fisheries typically operate where large fish are most likely to be found in quantity, i.e. the spawning grounds). Smaller arrowtooth flounder were not well represented in commercial landings. Size selectivity in commercial fisheries occurs either through net selection (a lesser problem in the trawl survey) or through size-selective targeting and dis- carding. Net avoidance by larger fish may also be a factor. In the extreme case of male arrowtooth floun- der, estimated L 5m was below the size range of fish in market samples though well within the size range of fish in commercial discards and survey catches. Because the trawl survey sampled the widest size range of arrowtooth flounder over a fairly large area and depth range prior to peak spawning in 1992, size- at-maturity estimates from the trawl survey repre- sent the best available. Hunter et al. (1992) estimated size at maturity for female Dover sole and found samples taken during the spawning season yielded higher estimates of L 50% than did samples taken before spawning. They at- tributed this to the presence of postspawning females with "highly regressed" ovaries that were histologi- cally indistinguishable from immature females, and they concluded that estimates of length or age at first maturity should always be conducted prior to the onset of spawning, when such females are rare. I found the opposite seasonal pattern in length at maturity for female arrowtooth flounder; lowest L 50% was estimated from commercial samples collected in the fall during spawning, and highest L 509c was esti- mated from months preceding spawning. Market samples collected in summer (before spawning) tended to underrepresent smaller arrowtooth floun- der and yielded extremely high estimates of female length at maturity. In the case where sampling is limited to commercial trawl fisheries, it may be pref- erable to pool year-round sampling data to generate estimates of L 5Q% if fish are moving in and out of range of the trawl fleet, rather than to attempt to narrow the sampling window to just prior to spawn- ing as suggested by Hunter et al. (1992). This in- volves the explicit trade-off of some assumed increase in the misclassification of small fish with the signifi- cant bias caused by a seasonal inability to obtain representative samples of the entire size or bathy- metric range of a population. Perhaps coincidentally, female length-at-maturity curves generated from the year-round commercial data and the survey data were strikingly similar (Fig. 4), although statistically the curves were different. Acknowledgments Thanks go to Marion Larkin and the crew of the FV Larkin for their gracious assistance. Jack Tagart and Han-lin Lai advised on sampling design and statis- tical analyses, and Nancy Tonjes arranged routine sampling. I thank Ken Weinberg, Mark Wilkins, and other participants in the 1992 NMFS surveys for their assistance and cooperation, and the anonymous reviewer whose thoughtful comments vastly im- proved the manuscript. This paper is funded in part by a grant from the National Oceanic and Atmo- spheric Administration. Literature cited Alverson, D. L., A. T. Pruter, and L. L. Ronholt. 1964. A study of demersal fishes and fisheries of the north- eastern Pacific ocean. H. R. MacMillan lectures in fisheries. Univ. British Columbia, Vancouver, B.C., Canada, 190 p. Barss, W. H., and R. L. Demory. 1985. Observations on retention and discard of groundfish from a limited sampling of Oregon trawl vessels in 1982. Oregon Dep. Fish Wildl. Info. Rep. 85-7, 15 p. Burton, M. P., and D. R. Idler. 1984. The reproductive cycle in winter flounder, Pseudo- pleuronectes americanus (Walbaum). Can. J. Zool. 62:2563-2567. Gunderson, D. R., P. Callahan, and B. Goiney. 1980. Maturation and fecundity of four species of Sebastes. Mar. Fish. Rev. 42(3-4):74-79. Hart, J. L. 1973. Pacific fishes of Canada. Fish. Res. Board Can. Bull. 180, 740 p. Hirschberger, W. A., and G. B. Smith. 1983. Spawning of twelve groundfish species in the Alaska and Pacific coast regions, 1975-81. U.S. Dep. Commer., NOAATech. Memo. NMFS F/NWC:44, 50 p. Hosie, M. J. 1976. The arrowtooth flounder. Oregon Dep. Fish Wildl. Info. Rep. 76-3, 4 p. Hunter, J. R., and B. J. Macewicz. 1985. Rates of atresia in the ovary of captive and wild north- ern anchovy, Engraulis mordax. Fish. Bull. 83:119-136. Hunter, J. R., J. L. Butler, C. Kimbrell, and E. A. Lynn. 1990. Bathymetric patterns in size, age, sexual maturity, water content, and caloric density of Dover sole, Micro- stomas pact ficus. CalCOFI Rep. 31:132-144. 138 Fishery Bulletin 93(1). 1995 Hunter, J. R., B. J. Macewicz, N. C. Lo, and C. A. Kimbrell. 1992. Fecundity, spawning, and maturity of female Dover sole Microstomus pacificus, with an evaluation of assump- tions and precision. Fish. Bull. 90:101-128. Kabata, Z., and C. R. Forrester. 1974. Atheresthes stomias (Jordan and Gilbert 1880) (Pi- sces: Pleuronectiformes) and its eye parasite Phrixocephalus cincinnatus Wilson 1908 (Copepoda: Lernaeoceridae) in Canadian Pacific waters. J. Fish. Res. Board Can. 31:1589-1595. Kimura, D. K. 1980. Likelihood methods for the von Bertalanffy growth curve. Fish. Bull. 77:765-776. Mahoney, R. 1973. Laboratory techniques in zoology. John Wiley & Sons, New York, NY, 360 p. Matarese, A. C, A. W. Kendall Jr., D. M. Blood, and B. M. Vinter. 1989. Laboratory guide to early life history stages of north- east Pacific fishes. U.S. Dep. Commer., NOAATech. Rep. NMFS 80, 652 p. Pertseva-Ostroumova, T. A. 1960. (Reproduction and development of the species of the genus Atheresthes Jordan et Gilbert [Pleuronectidae, Pisces]). Zool. Zhur. 39(11):1659-1669. [In Russian with English summary.] Ranck, C. L., F. M. Utter, G. B. Milner, and G. B. Smith. 1986. Genetic confirmation of specific distinction of arrowtooth flounder, Atheresthes stomias, and Kamchatka flounder, A. evermanni. Fish. Bull. 84:222-226. Seber, G. A. F. 1982. The estimation of animal abundance and related pa- rameters, 2nded. MacmillanPubl.Co.,Inc.,NewYork,654p. St-Pierre, G. 1984. Spawning locations and season for Pacific halibut. Int. Pac. Halibut Comm. Sci. Rep. 70, 45 p. Trippel, E. A., and H. H. Harvey. 1991. Comparison of methods used to estimate age and length of fishes at sexual maturity using populations of white sucker {Catostomus commersoni). Can. J. Fish. Aquat. Sci. 48:1446-1459. Wallace, R. A., and K. Selman. 1981. Cellular and dynamic aspects of oocyte growth in teleosts. Am. Zool. 21:325-343. Welch, D. W, and R. P. Foucher. 1988. A maximum likelihood methodology for estimating length-at-maturity with application to Pacific cod (Gadus macrocephalus) population dynamics. Can. J. Fish. Aquat. Sci. 45:333-343. West, G. 1990. Methods of assessing ovarian development in fishes: a review. Aust. J. Mar. Freshwater Res. 41:199-222. Yamamoto, K. 1956. Studies on the formation offish eggs I. Annual cycle in the development of ovarian eggs in the flounder, Liopsetta obscura. J. Fac. Sci. Hokkaido Univ. Ser. VI, 12:362-373. Yang, M. S. 1988. Morphological differences between two congeneric species of pleuronectid flatfishes: arrowtooth flounder, Atheresthes stomias, and Kamchatka flounder, A. evermanni. Fish. Bull. 86:608-611. Yang, M. S., and P. A. Livingston. 1986. Food habits and diet overlap of two congeneric spe- cies, Atheresthes stomias and Atheresthes evermanni, in the eastern Bering Sea. Fish. Bull. 82:615-623. Abstract. Marine turtle tag- ging records were collected off east- central Florida by a shrimp trawler from May 1986 to December 1991. The data were analyzed to deter- mine species composition, size dis- tribution, seasonal occurrence, movements, morphometries, and growth of 928 incidentally captured turtles. Loggerhead turtles, Ca- retta caretta, were the most fre- quently captured species (83% of total catch), while Kemp's ridley, Lepidochelys kempi, and green turtles, Chelonia mydas, were caught less frequently (12% and 4%, respectively). The loggerhead turtle population consisted of a sea- sonably variable aggregation of subadult and adult turtles. The Kemp's ridley and green turtle populations were composed of sub- adult turtles and were captured primarily during winter months. Kemp's ridley and loggerhead turtles appeared to exhibit a sea- sonal north-south migrational pat- tern along the Atlantic coast. Re- gression equations were developed for the morphometric relationships of each species. Average yearly growth rates and estimates for the von Bertalanffy growth interval equation were calculated for logger- head and Kemp's ridley turtles. These results indicate that the coastal waters of the Cape Cana- veral area provide an important developmental habitat for the three species of marine turtle. Marine turtle populations on the east-central coast of Florida: results of tagging studies at Cape Canaveral, Florida, 1986-1991* Jeffrey R. Schmid Southeast Fisheries Science Center, National Marine Fisheries Service, NOAA 75 Virginia Beach Drive, Miami, Florida 33149 Archie Carr Center for Sea Turtle Research 223 Bartram Hall, University of Florida Gainesville, Florida 3261 I Manuscript accepted 29 August 1994. Fishery Bulletin 93:139-151 (1995). The marine turtle life history is a dy- namic progression of stages which includes oceanic dispersal of the off- spring and utilization of a series of distinct developmental habitats (Carr, 1980; Hendrickson, 1980). The early in-water stages of marine turtle development have not been as extensively studied as the repro- ductive stage of females. Informa- tion concerning the early life histo- ries of threatened and endangered marine turtles is critical in formu- lating conservation and recovery strategies as mandated by the En- dangered Species Act of 1973 and subsequent amendments. Inaccessibility of immature tur- tles in the open ocean is the major factor contributing to the lack of information on the early stages of development. Other than possible current-mediated dispersal sce- narios (Carr, 1986; Collard and Ogren, 1990), little is known about the pelagic stage of marine turtle development. However, information concerning the populations of im- mature turtles foraging in the coastal waters of eastern Florida has been accumulating as a result of data collected through commer- cial fisheries (fishery-dependent) and fishery-independent activities. Fishery-independent capture and tagging efforts have characterized the populations of loggerhead turtles, Caretta caretta, and green turtles, Chelonia mydas, foraging in the northern part of the Indian River lagoon system (Ehrhart and Yoder, 1978; Mendonca, 1981, 1983; Mendonca and Ehrhart, 1982; Ehrhart, 1983). All green turtles collected in the lagoonal habitat were immature, as were almost all of the loggerhead turtles. Aggrega- tions of marine turtles in the Port Canaveral ship channel were first reported in 1978, when two trawl- ers caught unprecedented numbers of loggerhead turtles while search- ing for a concentration of shrimp (Carr et al., 1980). This prompted the National Marine Fisheries Ser- vice (NMFS) to conduct trawl sur- veys of the ship channel from 1978 to 1984 (Butler et al., 1987; Hen- wood, 1987a; Henwood and Ogren, 1987). The surveys provided infor- mation on the seasonal occurrence and movement patterns of subadult and adult loggerhead turtles (Henwood, 1987a), as well as sub- adult Kemp's ridley, Lepidochelys "Contribution MIA-92/93-94 of the Miami Laboratory, Miami, Florida. 139 140 Fishery Bulletin 93(1), 1995 kempi, and green turtles (Henwood and Ogren, 1987) captured in the vicinity of Cape Canaveral. In addi- tion, the results of research conducted in response to incidental mortality of marine turtles due to dredg- ing in the Port Canaveral ship channel were pre- sented at the Cape Canaveral Sea Turtle Workshop (Witzell, 1987). In 1986, the NMFS Panama City Laboratory initi- ated long-term studies of marine turtles found along the northwest (Cedar Keys) and east-central (Cape Canaveral) coasts of Florida (Schmid and Ogren, 1990). The Kemp's ridley turtle was the target species in both study areas. This paper presents the results of NMFS marine turtle studies conducted in nearshore waters of east-central Florida from 1986 to 1991. Information concerning marine turtle species composition, relative abundance, size frequency, seasonal occurrence, move- ments, morphometries, and growth is provided. Materials and methods Data collection A commercial shrimp-fishing vessel was contracted by NMFS, from May 1986 to December 1991, to mea- sure, tag, and release marine turtles incidentally captured during trawling. Fishing effort and location were a function of the sea- sonal abundance of brown shrimp, Penaeus aztecus, and white shrimp, Penaeus setiferus. Trawling was con- ducted between St. Mary's Entrance, 30°43'N, and Sebastian Inlet, 27°52'N (Fig. 1), and was concentrated in the Cape Canaveral area, 28°30'N to 28°15'N, as defined by Henwood ( 1987a). Fishing effort did not extend beyond 24 km off- shore and 25.6 m in depth. The majority of effort occurred less than 8 km offshore and 13.4 m in depth. Trawling gear con- sisted of four 12.2-m or 12.8-m nets (two on each side) for targeting brown shrimp, or two 24.4-m nets (one on each side) for targeting white shrimp. Captured turtles were double tagged on the trailing edge of the fore flippers with #681 Inconel cattle ear tags. Tag- ging information for each turtle included: tag codes, species, date, location of cap- ture, latitude and longitude, depth, gear type, standard straight-line carapace length (SSCL; nuchal notch to posterior end of postcentral), and straight-line carapace width. Carapace length and width were measured to the nearest 0.1 inch with forester's calipers and were converted to metric units for analysis. Kemp's ridley and green turtles were weighed with a 15-kg capacity spring scale. Notes on the condition of the turtle were recorded when the animal was injured or deformed (e.g. missing flip- per, carapace wounds, etc.). NMFS issued Sea Turtle Conservation Regulations on 29 June 1987 (Federal Register, 1987) that re- quired vessels 25 feet (7.6 m) long or longer to use Turtle Excluder Devices (TED's) in the Cape Canaveral area beginning 1 October 1987. Subse- quently, a NMFS permit was issued authorizing the contract vessel to conduct a TED testing program during fishing operations. The testing procedure con- sisted of towing a net(s) equipped with a Morrison soft TED on one side of the boat and a net(s) without a TED on the other side. Pounds of shrimp, marine turtle captures, and total catch (when possible) were recorded for the trawl types. Effort data were available for 1989- 91, including trawl size and type, number of tows and total tow time, and number of days fished. Data analysis The terms "juvenile" and "subadult" used to describe the early stages of the marine turtle life history are St Mary's Entrance : Cape Canaveral Sebastian Inlet Figure 1 Sampling areas for marine turtles (Caretta caretta, Lepidochelys kempi, and Chelonia mydas) off the Atlantic coast of Florida from 1986 to 1991. Schmid: Marine turtle populations of the east-central coast of Florida 141 not well defined. In this study, the term "juvenile" has been reserved for immature turtles in the pe- lagic stage of development. A turtle is considered "sub- adult" when it has recruited to its respective coastal- benthic habitat and "adult" when sexually mature. Loggerhead turtles greater than 80-cm carapace length were considered adult, based on the length frequencies of Cape Canaveral nesting females (Carr, 1986, and references therein) and earlier investiga- tions of Henwood (1987a). Kemp's ridley turtles greater than 60-cm carapace length were considered adult (Pritchard and Marquez, 1973). Monthly trawling effort was calculated and stan- dardized according to Henwood and Stuntz (1985) by using the formula E ( Nets Length V Min { 305 A~60~ where E is the trawling effort in hours towed by a single 30.5-m headrope length net, Nets is the num- ber of nets towed, Length is the headrope length (m) of a net, and Min is the number of minutes fished. Capture records were analyzed to evaluate species composition within the study area, length-frequency distribution of each species, and patterns of seasonal distribution and movements. Linear regression analyses were performed for carapace width on length for loggerhead turtles. The morphometric data for loggerhead turtles were subdivided into a sub- adult group (<80 cm SSCL) and an adult group (>80 cm SSCL) because the carapace dimensions of this species change as the animals mature (Henwood and Moulding, 1987). Carapace width was regressed on length, and weight regressed on length for Kemp's ridley and green turtles. Turtles with carapace wounds or deformities were not included in the analy- ses. Regression residuals for length-weight relation- ships were analyzed graphically to assess the appro- priateness of the straight-line model (Sokal and Rohlf, 1981; Kleinbaum et al., 1988). Curved carapace lengths (CCL) of stranded turtles were converted to straight-line carapace lengths (SCL) by using the following regression equations of Teas (1993): SCL = -1.442 + (0.948 x CCL) for loggerhead turtles; SCL = 0.013 + (0.945 x CCL) for Kemp's ridley turtles. Total straight-line carapace lengths (TSCL) of log- gerhead turtles were converted to standard straight- line carapace lengths (SSCL) with the regression equation of Henwood and Moulding (1987): SSCL = (0.9964 x TSCL) - 0.775. Yearly growth rates were calculated from the formula G = A Length Days 365 where G is the growth rate in cm/yr, ALength is the difference between the recapture length and the ini- tial length, and Days is the number of days out. The von Bertalanffy growth interval equation was fitted to the recapture data with a nonlinear least-squares regression procedure (SAS, 1988). The von Bertalanffy growth interval equation (Fabens, 1965) for recapture is as follows: CL 2 =a-(a-CL 1 )e kt , where CL 2 is the carapace length at recapture, a is the asymptotic length, CL 1 is the length at first cap- ture, K is the intrinsic growth rate, and t is the time in years between captures. Results Trawling effort Monthly trawling effort varied from year to year ( 1989-91 ); however, monthly totals for all three years indicate that the majority of effort occurred from May to December (Table 1). This corresponds to the sum- mer-fall fisheries for brown and white shrimp, the target species during this study. Monthly turtle cap- ture rates were also variable, probably as a result of the combined seasonal fluctuations in trawling ef- fort and turtle abundance. A structured sampling scheme with equal monthly effort would be required to make accurate calculations of monthly changes in turtle abundance. Loggerhead turtle catch per unit of effort (CPUE) ranged from 0.02 turtles/net hour in October 1989 to 1.09 turtles/net hour in August of 1991. Maximum CPUE of 0.25 turtles/net hour was obtained for Kemp's ridley turtles in May 1990 and 0.05 turtles/net hour was obtained for green turtles in January 1989 (Table 1). Species composition A total of 774 (83%) loggerhead, 113 (12%) Kemp's ridley, and 41 (4%) green turtles were captured, tagged, and released during the course of the study. A leatherback turtle, Dermochelys coriacea, was also 142 Fishery Bulletin 93(1), 1995 captured and tagged. Sixty tagged turtles (42 log- gerhead, 15 Kemp's ridley, and 3 green) were recap- tured by the contract vessel. Additionally, 31 recaptures and recoveries (26 loggerhead, 4 Kemp's ridley, and 1 green turtle) were reported by other investigators. Loggerhead turtle, Caretta caretta — Seven hundred and seventy-four loggerhead turtle captures were Table 1 Monthly trawling effort (net hours) and turtle capture rates (turtles/ net hour) for 1989-91. Cc -Caretta caretta, Lk=Lepidochelys kempi, and Cm=Chelonia mydas. Species Year and Effort Total month (net hours) turtles/hr Cc/hr Lk/hr Cm/hr 1989 Jan 77.0878 0.3113 0.2465 0.0130 0.0519 Feb 13.1918 0.2274 0.0758 0.1516 0.0000 Mar 25.9838 0.3079 0.2694 0.0385 0.0000 Apr 41.1742 0.2672 0.1700 0.0971 0.0000 May 103.9350 0.0770 0.0673 0.0096 0.0000 June 123.1230 0.1462 0.0568 0.0650 0.0244 July 70.7558 0.1555 0.1555 0.0000 0.0000 Aug 72.7545 0.1924 0.1787 0.0137 0.0000 Sept 19.9875 0.1001 0.1001 0.0000 0.0000 Oct 49.5690 0.0202 0.0202 0.0000 0.0000 Nov 139.1130 0.1006 0.0719 0.0216 0.0072 Dec 56.3648 0.1242 0.1064 0.0177 0.0000 1990 Jan 27.1830 0.1104 0.1104 0.0000 0.0000 Feb 57.5640 0.2258 0.1737 0.0521 0.0000 Mar 18.3885 0.4894 0.4350 0.0544 0.0000 Apr 23.1855 0.4313 0.3450 0.0863 0.0000 May 15.9900 0.7505 0.5003 0.2502 0.0000 June 31.5802 0.1583 0.1583 0.0000 0.0000 July 147.1080 0.1971 0.1971 0.0000 0.0000 Aug 117.5265 0.0851 0.0851 0.0000 0.0000 Sept — — — — — Oct — — — — — Nov 148.3072 0.1483 0.1079 0.0067 0.0337 Dec 127.5202 0.2666 0.2196 0.0235 0.0235 1991 Jan 28.7820 0.8686 0.7991 0.0695 0.0000 Feb 23.1855 0.2588 0.2588 0.0000 0.0000 Mar 35.9775 0.1946 0.1668 0.0278 0.0000 Apr 21.5865 0.2780 0.2780 0.0000 0.0000 May 92.7420 0.2588 0.2588 0.0000 0.0000 June 33.5790 0.4467 0.4467 0.0000 0.0000 July 35.7776 0.6988 0.6988 0.0000 0.0000 Aug 21.9862 1.0916 1.0916 0.0000 0.0000 Sept — — — — — Oct 43.3089 0.2309 0.2078 0.0231 0.0000 Nov 77.5515 0.0903 0.0903 0.0000 0.0000 Dec 106.7332 0.1031 0.1031 0.0000 0.0000 Total 2,028.60 recorded off the east coast of Florida. Loggerhead turtles captured in Florida ranged from 38.2 to 110.0 cm SSCL (Fig. 2). Eighty percent (n=616) of the log- gerhead turtles captured were subadults and 20% (n-153) were adults. Loggerhead turtles were present year-round in the Cape Canaveral area (Table 2). Total monthly captures were highest during Novem- ber, December, and January; however, yearly cap- tures for these months varied substan- tially. Subadult loggerhead turtles were most abundant during all months, except June, and showed a decrease from April to July as adult abundance increases, probably in response to the nesting sea- son (Fig. 3). Peaks in the relative compo- sition of the adult size class during April and June correspond to the peak densities reported by Henwood (1987a) for males and females, respectively. Sixty-eight tagged loggerhead turtles have been recaptured or recovered since the implementation of this study. Fifty-two (76%) of these turtles were initially tagged by the contract vessel. The remaining six- teen (24%) loggerhead turtle recaptures were tagged by other investigators in Florida and Georgia. 1.2,3,4,5,6,7 Methods of capture included shrimp trawl (69%), beach stranding (22%), pound net (3%), power plant intake canal (3%), nesting fe- male (1%), and SCUBA sighting ( 1%). The amount of time between tagging and re- capture ranged from 1 to 2,499 days. How- ever, 70% (n=45) were recaptured within a year of initial capture. Twenty-six loggerhead turtles (23 sub- adults and 3 adults) initially captured 1 Bolten, A. University of Florida, Archie Carr Cen- ter for Sea Turtle Research, Gainesville, FL, 32611. Personal commun., 1992. 2 Foster, K. National Marine Fisheries Service, Mi- ami Laboratory, 75 Virginia Beach Drive, Miami, FL, 33149. Personal commun., 1994. 3 Guseman, J. University of Central Florida, Depart- ment of Biology, Orlando, FL, 32816. Personal commun., 1992. 4 Henwood, T. National Marine Fisheries Service, Southeast Regional Office, 9450 Koger Boulevard, St. Petersburg, FL, 33702. Personal commun., 1991. 6 Martin, E. Applied Biology, Inc., P.O. Box 974, Jensen Beach, FL, 34958. Personal commun., 1991. 6 Stuntz, W. National Marine Fisheries Service, Pascagoula Laboratory, P.O. Drawer 1207, Pascagoula, MS, 39567. Personal commun., 1991. 7 Teas, W. National Marine Fisheries Service, Mi- ami Laboratory, 75 Virginia Beach Drive, Miami, FL, 33149. Personal commun., 1991. Schmid: Marine turtle populations of the east-central coast of Florida 143 (A 120 110 - 100 90 5 80 H O 70 a 9 60 H 50 40 - 30 20 10 - x = 67.7 cm n = 769 pi . r_.ri-^-.. . 40 50 60 70 Carapace Length (cm) Figure 2 Length frequencies of loggerhead turtles, Caretta caretta, collected along the Atlantic coast of Florida from 1986 to 1991. Table 2 Monthly and yearly trawl captures of loggerhead turtles Caretta caretta. in the r earshore waters of Florida. Dashes indicate trawling effort outside of the study area. Jan Feb Mar Apr May June July Aug Sept Oct Nov Dec Total 1986 1 5/— — /5 37 31 44 123 1987 90 47 31 12 5 11/ /3 2 201 1988 1 16 1 2 4 3 2 6 8 15 58 1989 19 1 7 7 7 7 11 13 2 1 10 6 91 1990 3 10 8 8 8 5 29 10 10 10 16 28 145 1991 23 6 6 6 24 15 25 24 — 9 7 11 156 Total 136 64 68 34 47 43/— 69/— 50/- 19/— 66/— 74 104 774 within the Cape Canaveral study area were subse- quently recaptured within this area. Of this total, eleven turtles (9 subadults and 2 adults) were cap- tured and recaptured in the Port Canaveral ship channel. Eight loggerhead turtles captured in the Cape Canaveral area during the winter were recap- tured or recovered in Georgia, North Carolina, and Virginia during the summer and fall (Fig. 4). All these turtles were subadults ranging from 51 to 61 cm cara- pace length. Three tagged loggerhead turtles (two sub- adults and a nesting female) were reported south of Cape Canaveral by fishery-independent sources. There was a stronger correlation between carapace width and carapace length for subadult loggerhead turtles (r=0.9612; n=508) than for adults (r=0.7724; 7i=151). Regression equations were computed for the relationship of carapace width (CW) to length (SSCL) for subadults: CW = 9.0289 + 0.6848 (SSCL); and adults CW = 22.9153 + 0.5052 (SSCL). Fifty-one yearly growth rates were calculated for forty-nine loggerhead turtles. Extrapolating annual growth rates from these data is difficult owing to the 144 Fishery Bulletin 93(1), 1995 90 - 60 - ~ 70 Relative Composition o o o o 1 1 1 1 \i s / ^ Subadult A /\ + Adult 20 - A ^ A 10 - II 1 1 1 1 1 1 1 1 1 JAN FEB MAR APR MAY JUN JUL AUG SEP OCT NOV DEC Month Figure 3 Relative composition of subadult and adult loggerhead turtles collected along the Atlantic coast of Florida from 1987 to 1991. small sample sizes, measurement errors, and short- term recaptures. A number of treatments were ap- plied to the growth data in an attempt to control for measurement error. However, no single approach was able to account for all the error. Consequently, growth rates were calculated for 1) all data combined, 2) those tag and recapture data recorded by the con- tracted personnel, and 3) those data with recapture intervals greater than 90 days. A mean growth rate of 5.56 ± 23.91 cm/yr (range: -11.49 to 167.17 cm/yr) was calculated for all loggerhead turtle recaptures. Analysis of the loggerhead turtles tagged and recap- tured by the contract personnel indicated a mean growth rate of 1.00 ± 1.23 cm/yr (range: 0.00 to 4.01 cm/yr). Additionally, a mean growth rate of 2.98 ± 7.12 cm/yr (range: -5.96 to 38.44 cm/yr) was calcu- lated for all loggerhead turtle recaptures greater than 90 days at large, 1.84 ± 1.76 cm/yr (range: -0.23 to 8.08 cm/yr) for all recaptures greater than 180 days at large, and 1.77 ± 1.88 cm/yr (range: -0.23 to 8.08 cm/ yr) for all recaptures greater than 360 days at large. The von Bertalanffy growth interval equation was fitted to each of these data treatments. Estimates of asymptotic length (a) for loggerhead turtles ranged from 96.08 cm to 112.52 cm and estimates of intrin- sic growth rate (K) ranged from 0.0365 to 0.0588 (Table 3). The growth model for captures and recap- tures by the contract vessel had the lowest residual mean square, a criterion commonly used to select the best fit growth model (Dunham, 1978). The estimated parameters for this data treatment (a = 112.52 cm; #=0.0365) are similar to Henwood's (1987b) esti- mated parameters for nonlinear regression of the von Bertalanffy equation (a=110.002 cm; #=0.0313). Kemp's ridley turtle, Lepidochelys kempi— One hun- dred and thirteen Kemp's ridley turtle captures were recorded on the Atlantic coast of Florida. Kemp's rid- ley turtles ranged in size from 21.5 to 60.3 cm SSCL (Fig. 5). Sixty-five percent (n=70) of these turtles were early to mid-subadults (20-40 cm). With the excep- tion of a single adult turtle, the Kemp's ridley turtles caught on the east coast were classified as imma- ture. Kemp's ridley turtles were captured year-round in the Cape Canaveral area (Table 4). Their pres- ence in the Cape Canaveral area appeared to be sea- sonal; 61% (n=69) of the turtles were captured dur- ing the winter months of December to March. How- ever, a relatively large number of Kemp's ridley turtles captured in January and February of 1987 and in March of 1988 contributed significantly to this trend. Captures of Kemp's ridley turtles during the following years did not exhibit a pronounced seasonal pattern. Nineteen tagged Kemp's ridley turtles were recap- tured or recovered. Eighty-nine percent (n=17) of the turtles were recaptured by shrimp trawls, and 11% (n=2) were recovered from beach strandings. With the exception of a single turtle captured in the area Schmid: Marine turtle populations of the east-central coast of Florida 145 A TLANTIC OCEAN Figure 4 Long-distance recaptures and recoveries of tagged loggerhead turtles. Note: Arrows are not intended to indicate routes traveled by tagged turtles; they are a visual aid to differentiate tagging and recap- ture sites. 0=tagging location; X=recapture location. of initial tagging after 615 days at large, all Kemp's ridley turtles were recaptured within a year. Twelve (63%) Kemp's ridley turtles were initially captured in the Cape Canaveral area and subsequently recaptured within this area. Of this total, four turtles were captured and recaptured in the Port Canaveral ship channel. Two Kemp's ridley turtles had multiple recaptures within the Cape Canaveral area, one tagged in November 1986 was caught once in December 1986 and again in May 1987. Another turtle tagged in May 1990 was recaptured twice that September. Six Kemp's ridley turtles exhibited long-distance movements to and from the Cape Canaveral area (Fig. 6). Two of the recaptures were NMFS Galveston Laboratory headstart turtles released offshore of Padre Island, Texas, in May and captured on the Atlantic coast of Florida in February and March, 0.73 and 1.88 years after release. 8 Two Kemp's ridley 8 Caillouet, C, Jr. National Marine Fisheries Service, Galveston Laboratory, 4700 Avenue U, Galveston, TX, 77551. Personal commun., 1991. turtles displayed seasonal movements northward. The turtles were originally tagged in the Cape Canaveral area in December and February and sub- sequently recovered in Georgia and South Carolina in July. Another Kemp's ridley turtle exhibited a southerly migration along the Atlantic coast, from Virginia Beach to Port Canaveral. 9 There was a strong correlation between carapace width and carapace length (r=0.9953; n = 105) for Kemp's ridley turtles. Regression of carapace width on length resulted in the equation CW = -2.7157 + 1.0288 (SSCL). A straight-line equation was applied to the length- weight data; however, graphical analysis of the re- siduals indicated a curvilinear relationship between the two variables. Power regression was performed through the log-log transformation of weight and length measurements. A strong correlation (r=0.9756; n=88) was calculated for the transformed weight ( WT) to length relationship, regression of these vari- ables resulted in the equation log WT = -8.2837 + 2.8444 (log SSCL). Twelve yearly growth rates were computed for ten Kemp's ridley turtles. A mean growth rate of 8.28 ± 9.81 cm/yr (range: 0.00 to 29.16 cm/yr) was calcu- lated for all Kemp's ridley turtle recaptures. Analy- sis of the Kemp's ridley turtles tagged and recap- tured by the contract personnel indicated a mean growth rate of 6.92 ± 9.36 cm/yr (range: 0.00 to 29.16 cm/yr). A mean growth rate of 8.79 ± 10.32 cm/yr (range: 0.00 to 29.16 cm/yr) was calculated for re- captures greater than 90 days at large and 5.94 ± 1.80 cm/yr (range: 4.26 to 7.84 cm/yr) for recaptures greater than 180 days at large. The von Bertalanffy growth interval equation was fitted to each of these data treatments. Estimates of asymptotic length ranged from 60.66 cm to 77.85 cm and estimates of intrinsic growth rate ranged from 0.0577 to 0.6037 (Table 5). Asymptotic lengths were probably underestimated because of the lack of adult- sized Kemp's ridley turtles in the database. Green turtle, Chelonia mydas — Forty-one green turtles, ranging in size from 24.0 to 55.4 cm SSCL (Fig. 7), were taken from Florida waters. Eighty-one per- cent (n=33) of the green turtles captured off the east coast of Florida were early subadults less than 40 cm SSCL. No adult green turtles were encountered. 9 Keinath, J. Virginia Institute of Marine Science, College of Wil- liam and Mary, Gloucester Point, VA, 23062. Personal commun., 1993. 146 Fishery Bulletin 93(1), 1995 The presence of subadult green turtles in the Cape Canaveral area appeared highly seasonal (Table 6); 73% (ra=30) were captured from November to Janu- ary. As with other turtle species, this pattern resulted from a high number of captures in 1987 and a high monthly variation during other years. Four tagged green turtles were recap- tured during this study. Three turtles were originally tagged by contract per- sonnel in the Cape Canaveral area. The tag codes for the fourth green turtle matched a set of NMFS tags that had been distributed to Fort Lauderdale, Florida. Of the three green turtles tagged at Cape Canaveral, one was ini- tially tagged in January 1987 and then recaptured in April, approximately 68 km to the north. Another green turtle that was initially tagged in the Cape Canaveral area in January 1990 was re- captured in this area the following Oc- tober. A third green turtle was captured off Port Canaveral in September 1990 and found stranded approximately 41 km to the north the following month. There was a strong correlation (r=0.9590; n=39) between carapace width and carapace length for 24 - 22 - 20 - 18 - x = 37,0 cm of Turtles I I ji Number O ro I I 8 6 4 — X ' ! ' . : 2 — — III" II 1 ■'-:'j, '■'■'■'■ ^m , . 55 60 65 70 Carapace Length (cm) Figure 5 Length frequencies of Kemp's ridley turtles, Lepidochelys kempi, collected along the Atlantic coast of Florida from 1986 to 1991. green turtles. Regression of carapace width on cara- pace length resulted in the equation CW = 4.1763 + 0.6847 (SSCL). Table 3 Estimated values of asymptotic length (a ) and intrinsic growth rate ik ) from nonlinear regression of von Bertalanffy growth interval equation for logger- head turtles (one asymptotic standard error in parentheses). Data treatment n a k All recaptures Capture/recapture by contract vessel All recaptures >90 days All recaptures >180 days All recaptures >365 days 51 96.08 cm 0.0586 (7.07) (0.0149) Residual mean square error = 9.1054 17 112.52 cm 0.0365 (24.74) (0.0204) Residual mean square error = 0.4088 33 96.09 cm 0.0588 (8.72) (0.0185) Residual mean square error = 13.8969 24 96.40 cm 0.0569 (7.97) (0.0162) Residual mean square error = 10.8231 19 96.10 cm 0.0573 (8.82) (0.0183) Residual mean square error = 13.5947 Residual analysis of the length- weight relationship indicated the need for curvilinear terms in the re- gression model. A strong correlation (r=0.9587; n=37) was calculated for the log-transformed weight to length relationship, and regression of these variables resulted in the equation log WT = 8.8784 + 2.9815 (log SSCL). There were no growth data available for green turtles owing to the rela- tively low number of recaptures and the lack of data for the recoveries. Discussion The data for this project were col- lected incidentally through the com- mercial shrimp fishery of east-central Florida. Bias in trawling effort oc- Schmid. Marine turtle populations of the east-central coast of Florida 147 Table 4 Monthly and yearly trawl captures of Kemp's ridley turtles, Lepidochelys kempi, in the nearshore waters of Florida. Dashes indicate trawling effort outside of the study area. Jan Feb Mar Apr May June July Aug Sept Oct Nov Dec Total 1986 1' 1 0/— — /0 1 1 4 8 1987 13 10 4 1 1/— — — — —11 1 2 33 1988 1 17' 2 1 1 1 2 2 27 1989 1 2 1 4 1 8 1 3 1 22 1990 3 1 2 4 4 1 1 3 19 1991 2 1 — 1 4 Total 17 16 24 7 6 9/— 21— 21— 5/— 5/— 8 12 113 1 Recapture of a NMFS Galveston Laboratory Headstart Kemp's ridley turtle. MEXICO Figure 6 Long-distance recaptures and recoveries of tagged Kemp's ridley turtles Note: Arrows are not intended to indicate routes traveled by tagged turtles; they are a visual aid to differentiate tagging and recapture sites. 0=tagging location; X=recapture location. curred because amount of effort and location of trawl- ing were a function of shrimp abundance. These fac- tors certainly contributed to the annual, and possi- bly seasonal, variation in turtle captures observed in this study. Restrictions imposed on the shrimping industry during the course of the study also affected data collection. There was a marked reduction in the number of loggerhead captures following NMFS regu- lations issued in June 1987, requiring the use of TED's in the Cape Canaveral area (Federal Regis- ter, 1987). Despite the bias and inconsistencies of data collection, the use of trawl gear allowed access to marine turtle developmental stages not encoun- tered in nesting beach surveys and inshore netting studies. Furthermore, the Cape Canaveral area has a history of trawl studies for general comparison. 148 Fishery Bulletin 93(1). 1995 £12 O 10 - CD M X = 36 cm n = 41 M^ 10 20 30 40 50 60 70 80 90 100 110 120 Carapace Length (cm) Figure 7 Length frequencies of green turtles, Chelonia mydas, collected along the Atlantic coast of Florida from 1986 to 1991. Trawl surveys conducted by NMFS and the U.S. Army Corps of Engineers from 1974 to 1984 estab- lished that marine turtles, especially loggerhead turtles, aggregate in the Port Canaveral ship chan- nel. Henwood (1987a) reported a loggerhead CPUE of 2.00 to 4.86 turtles/hour from July to October 1980, Table 5 Estimated values of asymptotic length (a ) and intrinsic growth rate (K) from nonlinear regression of von Bertalanffy growth interval equation for Kemp's ridley turtles (one asymptotic standard error in parentheses). Data treatment n a K All recaptures 12 61.11cm 0.0577 (5.43) (0.2176) Residual mean square error = 3.4359 Capture and recapture by 10 60.81 cm 0.5943 contract vessel (5.76) (0.2439) Residual mean square error = 4.1701 All recaptures >90 days 6 60.66 cm 0.6037 (8.04) (0.3549) Residual mean square error = 8.2325 All recaptures >180 days 3 77.85 cm 0.2466 (21.09) (0.1770) Residual mean square error = 1.1478 increasing to 12.05 turtles/hour in November. But- ler et al. (1987) noted that mean CPUE by month was greater than 10 loggerhead turtles/hour from November 1981 to March 1982 and that there were lower CPUE values from April to September 1982. The CPUE values cited from the previous studies are greater than those in the present analysis, which may be attributable to the different objectives of the present study and the former trawl surveys. The CPUE data presented by Henwood (1987a) were collected during trawl surveys designed to re- duce turtle mortality from mainte- nance dredging in the Port Canaveral ship channel. Butler et al. ( 1987) con- ducted surveys of the channel to de- velop methods of estimating logger- head abundance. Marine turtles were the target species in both of these studies. The CPUE values reported in this study should be viewed as rep- resentative of turtles taken in the commercial shrimp fishery of east- central Florida. The data on loggerhead turtles col- lected in the present analysis are similar to the earlier investigations of Henwood ( 1987a). Most of the log- Schmid Marine turtle populations of the east-central coast of Florida 149 Table 6 Monthly and yearly trawl capt jresc f green turtles, Chelonia mydas, in the nearshore waters of Florida. Dashes indicate trawling effort outside of the study arej L. Jan Feb Mar Apr May June July Aug Sept Oct Nov Dec Total 1986 1 0/— — — — /O 2 3 1987 7 1 1 0/— — /0 6 15 1988 1 2 3 1989 4 3 1 8 1990 1 3 5 3 12 1991 — Total 11 1 1 1 3/— 0/— 0/— 2/— 3/— 6 13 41 gerhead turtles captured on the east-central coast of Florida were mid-subadults (50-70 cm), typical of immature loggerhead turtles in the western Atlan- tic Ocean. There was a shift to a larger size class during the spring and summer, a period when repro- ductively active adults immigrate to the nesting beaches of southeast Florida (Henwood, 1987a). At that time, some immature loggerhead turtles emi- grated to foraging grounds as far north as Chesa- peake Bay. Captures of adult loggerhead turtles in the coastal waters of Florida declined by late sum- mer with the end of the nesting season. Conversely, the presence of subadult loggerhead turtles increased with the onset of winter. Kemp's ridley turtles in the northwestern Atlan- tic are transported from their natal beaches in Mexico by major oceanic currents in the Gulf of Mexico (Col- lard and Ogren, 1990). The smallest Kemp's ridley turtles captured on the east coast of Florida coincide with the minimum size class for postpelagic turtles in the Gulf of Mexico (Ogren, 1989). Skeleto- chronological age estimates indicate that these turtles may be two years old (Zug and Kalb, 1989), which may indicate the length of this species' pelagic developmental stage. Recapture data from the present analysis and that of Henwood and Ogren ( 1987) suggest that Kemp's ridley turtles on the Atlan- tic coast overwinter in the Cape Canaveral area and migrate to northern foraging grounds during the sum- mer. The lack of significant numbers of adult turtles in the northwestern Atlantic suggests that Kemp's ridley turtles migrate from the U.S. east coast upon reaching sexual maturity. Recently, a Kemp's ridley turtle cap- tured and tagged on the southeast coast of Florida was observed nesting in the western Gulf of Mexico. 10 Relatively low numbers of green turtles have been captured in the Cape Canaveral area. This observa- 10 Martin, E. Applied Biology, Inc., P.O. Box 974, Jensen Beach, FL, 34958. Personal commun., 1994. tion may be the result of this species preference for a habitat other than the Port Canaveral ship channel and adjacent areas of shrimp trawling. Capture data from fishery-independent studies indicate that early subadult (20-40 cm) green turtles inhabit the nearshore reef tracts off the southeast coast of Florida (Ernest et al., 1989; Wershoven and Wershoven, 1989, 1992; Guseman and Ehrhart, 1990). A slightly larger size class of green turtle was captured on the seagrass shoals of the Indian River Lagoon system (Mendonca and Ehrhart, 1982). Seventy-eight percent of the 108 green turtles captured in Mosquito Lagoon were greater than 40-cm carapace length. Furthermore, green turtles captured in the Indian River Lagoon, south of Sebastian Inlet, were significantly larger than those collected on the reefs offshore of Vero Beach (Guseman and Ehrhart, 1990). There are a number of problems with the growth data presented in this paper. Extrapolating yearly growth rates from short-term recaptures amplifies measurement error. Extremely large and negative growth values were usually the result of short inter- vals between capture and recapture. Differences in the measuring techniques used by other investiga- tors was a major source of error when computing growth rates. Length measurements are often re- ported as "straight-line carapace length" when, in fact, there are four possible straight-line carapace lengths: total, standard, notched, and minimum (Pritchard et al., 1983). Standardized methods of measurement, or a definition of the measurement technique and accurate conversions between the vari- ous techniques, are necessary for comparisons be- tween studies (Bjorndal and Bolten, 1988). The growth models presented in this analysis should be interpreted cautiously given the forementioned prob- lems with the database. In conclusion, the results of this study are indica- tive of the importance of east-central Florida as a developmental habitat for three species of marine 150 Fishery Bulletin 93( 1995 turtle. The Cape Canaveral aggregation of logger- head turtles is composed of significant numbers of subadults. Furthermore, the east coast of Florida supports the second largest rookery for this species (Ross, 1982). Subadult Kemp's ridley and green turtles appear to overwinter in the Cape Canaveral area. The eastern seaboard of North America serves as a vital link between the pelagic stage of marine turtle development and recruitment to the coastal- benthic foraging stages. Continued research in coastal waters is essential to the conservation of these threatened and endangered species. Acknowledgments This project was initiated and managed in part by Larry Ogren. I am indebted to Captain Eddie Chadwick and the crew of the FV Mickey Anne for their diligence in the collection of data. Thanks are also due to Wayne Witzell and Nancy Thompson for constructive comments during manuscript prepara- tion; Wendy Teas and Kellie Foster for stranding and tagging reports; Alan Bolten, Charles Caillouet, Jamie Guseman, Tyrrell Henwood, John Keinath, Erik Martin, and Warren Stuntz for recapture infor- mation; Karen Bjorndal for assistance with growth equations and data treatments; and Lisa Gregory for assistance with the Macintosh graphics program SuperPaint. Literature cited Bjorndal, K. A., and A. B. Bolten. 1988. Growth rates of immature green turtles, Chelonia mydas, on feeding grounds in the southern Bahamas. Copeia 1988:555-564. Butler, R. W., W. A. Nelson, and T. A. Henwood. 1987. A trawl survey method for estimating loggerhead turtle, Caretta caretta, abundance in five eastern Florida channels and inlets. Fish. Bull. 85:447^153. Carr, A. 1980. Some problems of sea turtle ecology. Am. Zool. 20:489-498. 1986. New perspectives on the pelagic stage of sea turtle development. Dep. Commer., NOAATech. Memo. NMFS- SEFC-190:l-36. Carr, A, L. Ogren, and C. McVea. 1980. Apparent hibernation by the Atlantic loggerhead turtle Caretta caretta off Cape Canaveral, Florida. Biol. Conserv. 19:7-14. Collard, S. B., and L. H. Ogren. 1990. Dispersal scenarios for pelagic post-hatchling sea turtles. Bull. Mar. Sci. 47:233-243. Dunham, A E. 1978. Food availability as a proximate factor influencing individual growth rates in the iguanid lizard Sceloporous merriami. Ecology 59:770-778. Ehrhart, L. M. 1983. Marine turtles of the Indian River Lagoon System. Fla. Sci. 46:337-346. Ehrhart, L., and M. Yoder. 1978. The marine turtles of Merritt Island National Wildlife Refuge, Kennedy Space Center, Florida. /nG.E. Henderson (ed.), Proceedings of the Florida interregional conference on sea turtles. Florida Mar. Res. Publ. 33:25-30. Ernest, R. G., R. E. Martin, N. Williams-Walls, and J. R. Wilcox. 1989. Population dynamics of sea turtles utilizing shallow coastal waters off Hutchinson Island, Florida. In S. A. Eckert, K. L. Eckert, and T. H. Richardson (compilers), Proceedings of the ninth annual workshop on sea turtle biology and conservation. U.S. Dep. Commer., NOAA Tech. Memo. NMFS-SEFC-232:57-59. Fabens, A. J. 1965. Properties and fitting of the von Bertalanffy growth curve. Growth 29:265-289. Federal Register. 1987. 52(1241:24244-24262. Guseman, J. L., and L. M. Ehrhart. 1990. Green turtles on Sabellariid worm reefs: initial re- sults from studies on the Florida Atlantic coast. In T. I. Richardson, J. I. Richardson, and M. Donnelly (compilers), Proceedings of the tenth annual workshop on sea turtle biology and conservation. U.S. Dep. Commer., NOAA Tech. Memo. NMFS-SEFC-278:125-127. Hendrickson, J. R. 1980. The ecological strategies of sea turtles. Am. Zool. 20:597-608. Henwood, T. A. 1987a. Movements and seasonal changes in loggerhead turtle, Caretta caretta, aggregations in the vicinity of Cape Canaveral, Florida (1978-84). Biol. Conserv. 40:191-202. 1987b. Age, growth, survival and mortality in loggerhead turtles, Caretta caretta, estimated from tag and recapture experiments. In T. A. Henwood (ed. ), Sea turtles of the south- eastern United States, with emphasis on the life history and population dynamics of the loggerhead turtle, Caretta caretta, p. 40-71. Ph.D. diss., Auburn Univ., Auburn, Alabama. Henwood, T. A., and J. D. Moulding. 1987 Some morphometric relationships in the western At- lantic loggerhead turtle, Caretta caretta. In T A. Henwood (ed.), Sea turtles of the southeastern United States, with emphasis on the life history and population dynamics of the loggerhead turtle, Caretta caretta, p. 15-39. Ph.D. diss., Auburn University, Auburn, Alabama. Henwood, T. A., and L. H. Ogren. 1987. Distribution and migrations of immature Kemp's rid- ley turtles (Lepidochelys kempi) and green turtles (Chelonia mydas) off Florida, Georgia, and South Carolina. North- east Gulf Sci. 9:153-159. Henwood, T. A, and W. E. Stuntz. 1987. Analysis of sea turtle captures and mortalities dur- ing commercial shrimp trawling. Fish. Bull. 85:813-817. Kleinbaum, D. G., L. L. Kupper, and K. E. Muller. 1988. Applied regression analysis and other multivariable methods, second ed. PWS-KENT Publishing Company, Boston, MA, 718 p. Mendonca, M. T. 1981. Comparative growth rates of wild, immature Chelonia mydas and Caretta caretta in Florida. J. Herp. 15:447-451. 1983. Movements and feeding ecology of immature green turtles (Chelonia mydas) in Mosquito Lagoon, Florida. Copeia 1983:1013-1023. Schmid: Marine turtle populations of the east-central coast of Florida 151 Mendonca, M. T., and L. M. Ehrhart. 1982. Activity, population size, and structure of immature Chelonia mydas and Caretta caretta in Mosquito Lagoon, Florida. Copeia 1982:161-167. Ogren, L. H. 1989. Distribution of juvenile and subadult Kemp's ridley turtles: preliminary results from 1984-1987. In C. W. Caillouet Jr. and A. M. Landry Jr. (eds.), Proceedings of the first international symposium on Kemp's ridley sea turtle biology, conservation and management. Texas A&M Univ. Sea Grant College Program Publ. TAMU-SG-89- 105:116-123. Pritchard, P., P. Bacon, F. Berry, A. Carr, J. Fletemeyer, R. Gallagher, S. Hopkins. R. Lankford, R. Marquez M ., L. Ogren, W. Pringle Jr., H. Reichart, and R. Witham. 1983. Manual of sea turtle research and conservation tech- niques, second ed., K. A. Bjorndal and G. H. Balazs (eds.), 126 p. Center for Environmental Education, Washington, D.C. Pritchard, P. C. H., and R. Marquez. 1973. Kemp's ridley turtle or Atlantic ridley, Lepidochelys kempi. IUCN Monograph 2:1-30. Ross, J. P. 1982. Historical decline of loggerhead, ridley and leather- back sea turtles. In K. A. Bjorndal ( ed. ), Biology and con- servation of sea turtles, p. 189-195. Smithson. Inst. Press, Wash., D.C. SAS (SAS, Inc.). 1988. SAS/Statistical user's quide, release 6.03 ed. SAS, Inc., Cary, NC, 1028 p. Schmid, J. R., and L. H. Ogren. 1990. Results of a tagging study at Cedar Key, Florida, with comments on Kemp's ridley distribution in the southeastern U.S. In T. I. Richardson, J. I. Richardson, and M. Donnelly (compilers), Proceedings of the tenth annual workshop on sea turtle biology and conservation. U.S. Dep. Commer., NOAA Tech. Memo. NMFS-SEFC-278: 129-130. Sokal, R. R., and F. J. Rohlf. 1981. Biometry, second ed. W. H. Freeman & Co., San Francisco, CA, 859 p. Teas, W. G. 1993. Species composition and size class distribution of marine turtle strandings on the Gulf of Mexico and south- east United States coasts, 1985-1991. U.S. Dep. Commer., NOAA Tech. Memo. NMFS-SEFSC-315, 43 p. Wershoven, R. W., and J. L. Wershoven. 1989. Juvenile green turtles in a developmental habitat. Underwater Nat. 18:14-17. Wershoven, J. L., and R. W Wershoven. 1992. Juvenile green turtles in their nearshore habitat of Broward County, Florida: a five year review. In M. Salmon and J. Wyneken (compilers), Proceedings of the eleventh annual workshop on sea turtle biology and conser- vation. U.S. Dep. Commer., NOAA Tech. Memo. NMFS- SEFSC-302:121-123. Witzell, W. N. (ed.). 1987. Ecology of East Florida sea turtles: proceedings of the Cape Canaveral, Florida, sea turtle workshop. U.S. Dep. Commer., NOAA Tech. Rep. NMFS 53, 80 p. Zug, G. R., and H. Kalb. 1989. Skeletochronological age estimates for juvenile Lepido- chelys kempii from Atlantic coast of North America. InS.A. Eckert, K. L. Eckert, and T H. Richardson (compilers), Pro- ceedings of the ninth annual workshop on sea turtle biol- ogy and conservation. U.S. Dep. Commer, NOAA Tech. Memo. NMFS-SEFC-232:271-273. Growth rates of captive dolphin, Coryphaena hippurus, in Hawaii Daniel D. Benetti Rosenstiel School of Marine and Atmospheric Science Division of Marine Biology and Fisheries, University of Miami 4600 Rickenbacker Causeway. Miami, Florida 33149 The Oceanic Institute, Makapuu Point PO. Box 25280, Honolulu, Hawaii 96825 Edwin S. Iversen Rosenstiel School of Marine and Atmospheric Science Division of Marine Biology and Fisheries, University of Miami 4600 Rickenbacker Causeway, Miami, Florida 33 1 49 Anthony C. Ostrowski The Oceanic Institute, Makapuu Point PO. Box 25280, Honolulu, Hawaii 96825 Dolphin, Coryphaena hippurus, also known as mahimahi or dolphin fish, are pelagic, predatory fish dis- tributed in tropical and subtropical regions throughout the world (Johnson, 1978; Palko et al., 1982). They are an important resource, supporting commercial and sport fisheries throughout their range (Oxenford and Hunte, 1986) as well as having considerable potential for aquaculture (Hagood et al., 1981; Szyper et al., 1984; Kraul, 1989, 1991). Gibbs and Collette (1959) and Palko et al. (1982) reviewed the dis- tribution and biology of dolphin, including age and growth data on wild and captive fish. Age and growth of wild (Oxenford and Hunte, 1983) and captive (Uchi- yama et al., 1986) fish have been estimated from daily increments on otoliths and scale annuli (Beards- ley, 1967; Rose and Hassler, 1968), from modal progression in length- frequency distribution (Wang, 1979), and from fish of known age reared in captivity (Hassler and Hogarth, 1977; Hagood et al., 1981; Szyper et al., 1984; Ostrowski et al., 1989, 1992; Iwai et al., 1992). There is considerable variability in the data, reflecting environmental and nutritional differences associated with experimental designs for cap- tive fish, as well as differences in size, age, and origin of wild fish. In this paper, growth rates of dolphin reared in Hawaii are presented and compared with those of captive and wild dolphin from different popu- lations, as well as other teleost spe- cies. The data presented suggest that there are differences in growth rates and morphology between cap- tive and wild dolphin. Materials and methods Fish were reared in captivity at The Oceanic Institute, Hawaii, from eggs obtained from wild Hawaiian broodstock fish (Fjj first genera- tion) maintained at Anuenue Fish- eries, State of Hawaii. Up to 3 months-of-age juveniles were fed a semi-moist (27.86% moisture) manufactured diet (pellet) twice daily (4% of their body weight per day). The diet contained 53.75% crude protein, 21% crude fat, and a caloric content of 5.13 calmg -1 (dry matter basis). Between 3 and 9.5 months, fish were fed to satiation once a day on a mixed diet of ex- truded salmon pellet (Moore-Clarke), frozen squid, and fish. The feed con- version ratio (FCR) is expressed as a ratio between the dry weight of the total amount of food given and the weight gain of live fish. Up to 3 months-of-age juvenile fish were reared in an outdoor cir- cular tank of 18,800 L (4 m diam- eter x 1.5 m water column height). After 3 months, fish were trans- ferred to a 28,000-L tank (6 m di- ameter x 1 m water column height) used for broodstock maintenance. Both tanks had running ambient seawater (25-27°C and 33-35 ppt salinity) at high flow rates (water turnover rate was at 10 tank vol- umes per day) and under constant aeration. The initial population was 48 fish, stocked at approximately 3 fish per m 3 . Growth data presented correspond to pooled male and fe- male fish periodically sampled dur- ing the period studied (1-9.5 months). Data are of individually sampled fish and are not averages. Small fish (1—3 months) were sampled daily. Sampling frequency of intermediate (3-6 months) and large (6-9.5 months) fish was weekly and bimonthly, respectively, owing to difficulties in handling larger dol- phin and because there were fewer individuals available for sampling. Since dolphin metamorphosis oc- curs during the third week after hatching and one month-old fish are fully developed juveniles (Be- netti, 1992; Kim et al., 1993), all data corresponding to fish from 1 to 9.5 months-old were combined. Manuscript accepted 31 May 1994. Fishery Bulletin 93:152-157 (1995) 152 NOTE Benetti et al.: Growth rates of captive Coryphaena hippurus 153 Results are expressed as: Absolute growth Absolute growth rate Relative growth Relative growth rate Instantaneous growth rate Specific growth rate Length-weight relationship VGBM (length) VGBM (weight) AG = W 2 - Wj AGR = (W 2 -W 1 )/(t 2 -t 1 ) RG = (W 2 -W 1 )/W 1 RGR = (W 2 -W i )/W 1 (t 2 ~t 1 ) IGR = (In W 2 - In W x ) / (t 2 - tj) SGR = (In W 2 - In W x ) / {t 2 -t 1 )x 100 W = aL b L. = L (1 -Kit-t ; o>) W, = W (l-e- /f,( - < o ) ) b , where W r = initial wet weight offish; W 2 = final wet weight offish; t x = time at the beginning of an inter- val; t 2 = time at the end of an interval; L = fork length in cm; a and b are constants; L ( = fork length (cm) at time t; W t = total weight (kg) at time t; L m and W m = theoretical asymptotic length and weight, respec- tively; K = constant indicating the rate of change in length and weight (the Brody growth coefficient); t- time; t = time of hatching; and VBGM is the von Bertalanffy growth model (Ricker, 1975, 1979; von Bertalanffy, 1962; Fabens, 1965): Results Fish grew to 4.93 kg and 75.8 cm from hatching in 9.5 months. Absolute growth rates (AGR's) in weight and length were 19.18 g-d -1 and 0.227 cmd -1 , respec- tively (Table 1). Specific growth rate (SGR) of 1-3 month juveniles was 10% of their body weight per day, decreasing to 4.3% throughout the adult stage. Most of the data correspond to fish younger than 6 months. The calculation of separate growth curves for males and females was not legitimate because sexual dimorphism could not be detected before that age. Therefore, the growth curves and the von Bertalanffy growth parameters were calculated from combined data for all male and female fish. Growth in length of dolphin was best expressed by a linear relationship (r 2 =0.98), though an asymptotic curve also fit the data well (r 2 =0.90). From Figure 1 it ap- pears that a linear fit is better because of a weight- ing of the regression by the smaller fish. Growth in weight was best expressed as a quadratic equation (r 2 =0.98, Fig. 2). The length-weight relationship is expressed by the equation W = 0.00836 L 307 (r 2 =0.98; Fig. 3). The von Bertalanffy growth models (VBGM) were used to estimate dolphin growth beyond the scope of data measured and, therefore, should be interpreted Table 1 Growth rates of captive dolphin, Coryphaena hippurus, in Hawaii, fed a mixture of semi-moist manufactured diet 7 (1-3 months) and Moore-Clarke extruded salmon pellets, squid and fish (3-9.5 months). Parameter Value Absolute growth (g) 4,929 Absolute growth rate (g/day) 19.18 Relative growth 70,413 Relative growth rate 273.98 Instantaneous Growth Rate (g) 0.043 Specific Growth Rate (%/day) 4.33 VGBM 2 Asymptotic length [LJ (cm) 169.6 VGBM 2 Asymptotic weight (WJ (g) 58,417 t (yr) 0.068 K (annual) 0.72 b (constant; Brody coefficient) 3.07 ' Manufactured diet contained 27.86% moisture, 53.75% crude protein, 21% crude fat and caloric content of 5.13 calmg" 1 (dry-matter basis). 2 Von Bertalanffy growth model. fin 70- Y = 0.274 X-5 11 A r 2 = 0.98 /" ? b0- o £ 50- B> § 40- n=103 / Standard r\3 co o 1 1 s s° 10- jfl n S° u n i i i i i i . i i i i 60 120 180 240 300 3e >0 Age (days) Figure 1 Growth in length of captive dolphin, Coryphaena hippurus, in Hawaii. 154 Fishery Bulletin 93(1). 1995 with caution. The VBGM applied to length-at-age data for captive dolphin in Hawaii is L, = 169.6 cm [l^r - 72,( -° 068) ] (Fig. 4). The calculated VBGM for weight is W t = 58.41 kg [l-e-° 72 ,M)068) ] 307 . The feed conversion ratio (FCR) of juveniles up to three months of age was 1.1 (dry feed/live fish), and averaged 1.6 for the entire period studied. Discussion There have been several reports of growth rates of wild and captive dolphin, as well as of wild caught fish kept in captivity for various periods of time. Beardsley (1971) reported that a wild caught juve- nile kept in captivity grew from one to 35 lb in one year. Schekter (1983) recorded a growth rate of 4.3 kg (from 0.7 to about 5 kg) in 30 days. In Barbados, dol- phin may reach lengths of over 80 cm in 5.5 months and over one meter in less than one year (Oxenford and Hunte, 1986). In Hawaii, they also attain a length of over one meter at the end of the first year (Uchiyama et al., 1986). By applying the length-weight regression of Rose and Hassler (1968) to these data, it would cor- respond to a mass of about 8 kg in one year. The growth rates presented in this study (4.93 kg and 75.8 cm in 9.5 months) are lower than many of those reported for wild and cultured dolphin in the literature. This may be due to the diet fed to the ex- perimental fish. For instance, Kraul (1989) reported growth rates of 2 kg in 6 months and 9 kg in one year for dolphin that were fed fish and squid in tanks in Hawaii, and of 5.4 kg in 8.7 months for fish reared under identical circumstances but fed commercially available pellets (Kraul and Ako, 1993). The data suggest that captive dolphin grow slower than their wild counterparts. Yet, even when they are fed artificial diets, growth rates of captive dol- phin are among the fastest recorded for teleosts. The specific growth rate (SGR) of dolphin reported in this work (4.3%-10 body weightd -1 ), by Ostrowski et al. (1992) (10.7-13.3% bwd" 1 ), and by Iwai et al. (1992) (9.3-13.0% bw-d -1 ) are much higher than those of other marine and brackish water fish raised in cap- tivity. For instance, SGR of the common snook, Centropomus undecimalis; barramundi, hates calcar- ifer; hybrid sea bass, Morone spp. ; Nassau grouper, Epinephelus striatus; spotted seatrout, Cynoscion nebulosus; red drum, Sciaenops ocellatus (Tucker, 1989); three species of mullets, Liza ramada (El- Sayed, 1991), Mugil liza, and M. curema (Benetti and Fagundes Netto, 1991); and the common grouper, E. guaza (Fagundes Netto and Benetti, 1984) range from 0.55 to 3.46% of their body weight per day. The absolute growth rate (AGR) in length of wild and captive dolphin vary between 0.1-0.58 cmd -1 6000 5000 40004 -§,3000 5 2000- 1000 Y = 0.087 X 2 • 10.93 X + 321 .62 r ' = 0.98 n = 141 -i — T^ — i 1 1 — ' 1 ' 1 <~ 60 120 180 240 300 360 Age (days) Figure 2 Growth in weight of captive dolphin, Coryphaena hippurus, in Hawaii. 5000- W = 0.00836 L 3 07 r 2 = 0.98 4000- n= 103 Weight (g) ro co o o o o o o / 1000- J(' U | i | i | ' I ' 1 ' 1 ' 1 ' 1 ' 1 ' 10 20 30 40 50 60 70 80 90 Standard length (cm) Figure 3 Length-weight relationship of dolphin, Coryphaena hippurus, reared in captivity in Hawaii. NOTE Benetti et al.: Growth rates of captive Coryphaena hippurus 155 200 Loo 160 •0 72 (1 -0.06B) . 1 LI - 169.6 cm |1 - 8 ' ' ] - r 2 = 0.98 __---- Standard length (cm) * CD l\3 ) O O O S / / / / U 12 3 4 Age (years) Figure 4 The von Bertalanffy growth model applied to length-at- age data for 1-9.5 month-old captive dolphin, Coryphaena hippurus, in Hawaii. for the first year of life (Oxenford and Hunte, 1983). The AGR value reported in this study (0.227 cmd -1 ) is well within this range and the 0. 1-0.6 cmd -1 range reported by Brothers et al. (1983) for the Atlantic bluefin tuna, Thunnus thynnus, another pelagic te- leost. Only a few other pelagic teleosts exhibit growth rates comparable to or higher than dolphin. These include the Atlantic blue marlin, Makaira nigricans, and the Atlantic sailfish, Istiophorus platypterus, two of the largest North Atlantic pelagic teleosts. Prince et al. (1991) estimated the AGR of young Atlantic blue marlin from otolith microstructure as 1.66 cmd -1 , a value nearly three times higher than that reported for dolphin. From length frequencies of Atlantic sail- fish, de Sylva (1957) estimated a maximum absolute growth rate of 1.10 cmd -1 , twice as fast as that re- ported for dolphin. Although the scope of these com- parisons is limited owing to the different age classes of fish, both the blue marlin and Atlantic sailfish exhibit AGR's several times higher than those mea- sured in this work. In this study, the feed conversion ratio (FCR) was 1.6 (dry feed/live fish). Similarly, Kraul and Ako (1993) obtained a FCR of 1.6 with dolphin fed on a commercially available pellet. FCR's of about 1.0 have been reported for dolphin by Ostrowski et al. (1992), Kraul (1989), and Kraul and Ako (1993), indicating that they are efficient in converting the energy in- take from feeds into growth. Relative to other spe- cies, dolphin do not appear to require extraordinary food intake to sustain their high growth rates, simi- lar to blue marlin (Prince et al., 1991). In this study, cultured dolphin were fed 4% (dry feed) of their body weight per day. This feeding rate is commonly used for other fish species in captivity, which invariably ex- hibit slower growth rates and higher FCR. Dolphin appear to exhibit higher energetic efficiency than most other teleosts because they use a proportionally larger portion of the total gross energy ingested for growth and metabolism than for excretion (Benetti, 1992). Although no spawning was observed, the slight trend of decelerated growth after 180 days (Fig. 1) could be due to the onset of maturation, which in captive dolphin generally occurs in 6 months at 50— 55 cm and 2.0-2.5 kg (Kraul, 1991; Ostrowski et al., 1992), but has been observed to occur as early as 3- 4.5 months (Uchiyama et al., 1986). Somatic growth rates in teleosts usually decrease after the onset of maturation (Jones, 1976). For dolphin, however, the linear equation fitted the data for the period studied with the highest coefficient of correlation (r 2 =0.98). A reason for this may have been the larger sample size during the juvenile stage, when young fish grow very fast. For instance, Hassler and Rainville (1975) 1 found that the length-age relationship of larvae and early juvenile dolphin (13—83 days) was exponential. The VBGM's were used to model growth beyond the scope of the data and therefore must be consid- ered speculative. Although the data fitted both VBGM's (length and weight) with a high coefficient of determination (r 2 >0.98), the asymptotic sizes pre- dicted by the models can not be tested because it has not been possible to keep dolphin alive in captivity for longer than 18 months. In this respect, the age structure of the population should be considered. It is possible that the potential longevity of the Hawai- ian dolphin stock may not exceed this maximum age in captivity (about 18 months). For instance, the lon- gevity of dolphin from Florida was estimated to be 4 years, but only 2% of the population was found to be older than 2 years (Beardsley, 1967), and only 4% in North Carolina (Rose and Hassler, 1968). The maxi- mum life span of the Southern Caribbean dolphin stock does not appear to exceed 18 months, and few individuals of the North Caribbean stock live longer than 2 years (Oxenford and Hunte, 1986). The asymptotic length estimated by the VBGM (1,^=1.69 m) compares well with existing data for wild fish in the literature (L m =1.89 and 1.53 m for males and females, respectively) (Beardsley, 1967). The es- timated asymptotic weight (^=58. 4 kg), however, is much higher than the maximum weight of 46 kg reported for this species (Florida Sportsman, 1979). 1 Hassler, N. W., and R. P. Rainville. 1975. Techniques for hatch- ing and rearing dolphin, Coryphaena hippurus, through larvae and juvenile stages. Sea Grant Publ. UNC-SG-75-31, 17 p. 156 Fishery Bulletin 93(1). 1995 This may be explained by the higher value of the exponent (6) of the length-weight relationship cal- culated for captive dolphin in this study (3.07) com- pared with wild fish from North Carolina and Florida, 2.58 < b < 2.75 (Rose and Hassler, 1968). Oxenford and Hunte (1986) reported b values of 2.94 for male and 2.84 for female dolphin from Barbados. These differences indicate that dolphin tend to have shorter, deeper bodies in captivity than in the wild. Blaxter (1988) found that fish reared in captivity tend to be shorter and fatter and have a higher condition fac- tor than fish from the wild, possibly because fish are likely to swim less when confined, diminishing the effect of exercise on growth (Jobling 1990; Christ- iansen and Jobling, 1990; Benetti, 1992; Christiansen et al., 1992; Boisclair and Tang, 1993). This is con- sistent with the predictions of the VBGM's in this study, which indicate that it would take longer for dolphin to reach asymptotic length and weight in captivity (6 years) than in their natural environment (4 years or less). Results presented in this study suggest that cap- tive dolphin grow slower and are less streamlined than in the wild. However, morphological and growth disparities of wild dolphin have been attributed to genetic (Oxenford and Hunte, 1986) and environmen- tal (Rose and Hassler, 1968) differences in unit stocks. The larval development of dolphin from the Gulf of Mexico and from the western Pacific Ocean is similar, but both differ from that off Japan (Ditty et al., 1994). Although Benetti (1992) reported no sig- nificant differences between growth rates and devel- opment of dolphin larvae in Hawaii from F x and F 7 generations inbred in captivity, nothing is known about differences in growth during the juvenile and adult stages among offspring from brood fish from other stocks. Acknowledgments We thank Peter Lutz (Florida Atlantic University), Larry Brand (RSMAS, University of Miami), Eirik O. Duerr (The Oceanic Institute), Eric Prince and Victor Restrepo (Southeast Fisheries Science Cen- ter, NMFS, Miami Laboratory), and Syd Kraul (Waikiki Aquarium) for reviewing an early manu- script. The authors also thank two anonymous re- viewers and the Scientific Editor, Ronald Hardy, for comments which greatly improved the original manu- script. We also thank Arietta Venizelos for editorial help, and Thomas Capo for use of laboratory facili- ties (Experimental Hatchery, University of Miami). This work was part of the senior author's Ph.D. dis- sertation, funded by the Brazilian Conselho Nacional de Desenvolvimento Cientifico e Tecnologico (CNPq). Partial funding was also provided by U.S. Dept. of Agriculture, ARS, grant 59-91H2-9-218 to the Oce- anic Institute in Hawaii. Literature cited Beardsley, B. L. 1967. Age, growth and reproduction of the dolphin, Coryphaena hippurus, in the straits of Florida. Copeia 2:441-451 1971. Dolphin spectacular. Sea Front. 17:194-201 Benetti, D. D. 1992. Bioenergetics and growth of dolphin, Coryphaena hippurus. Ph.D. diss., Univ. Miami, 196 p. Benetti, D. D. , and E. B. Fagundes Netto. 1991. Preliminary results on growth of mullets (Mugil liza and M. curema) fed artificial diets. World Aquaculture 22 (4):55-57. Bertalanffy, L., von. 1962. Modern theories of development: an introduction to theoretical biology. Transl. and adapted by J. H. Woodger Jr., Harper and Row, New York, 204 p. Blaxter, J. H. S. 1988. Pattern and variety in development. In W. S. Hoar and D. J. Randall (eds.), Fish physiology, Vol. 11a, p. 1- 58. Acad. Press, NY. Boisclair, !)., and M. Tang. 1993. Empirical analysis of the influence of swimming pat- tern on the net energetic cost of swimming in fishes. J. Fish Biol. 42:169-183. Brothers, E. B., E. D. Prince, and D. W. Lee. 1983. Age and growth of young-of-the-year bluefin tuna, Thunnus thynnus, from otolith microstructure. In E. D. Prince and L. M. Pulos (eds.) Proceedings of the interna- tional workshop on age determination of oceanic pelagic fishes: tunas, billfish, and sharks, p. 49-59. U.S. Dep. Commer., NOAATech. Rep. NMFS 8. Christiansen, J. S., and M. Jobling. 1990. The behavior and relationship between food intake and growth of juvenile Arctic charr, Salvelinus alpinus L., subjected to sustained exercise. Can. J. Zool. 68: 2185-2191 Christiansen, J. S., Y. S. Svendsen, and M. Jobling. 1992. The combined effects of stocking density and sus- tained exercise on the behavior, food intake, and growth of juvenile charr (Salvelinus alpinus L.). Can. J. Zool. 70:115-122. De Sylva, D. P. 1957. Studies on the age and growth of the Atlantic sail- fish, Istiophorus americanus (Cuvier), using length-fre- quency curves. Bull. Mar. Sci. Gulf Carib. 7:345-362. Ditty, J. G., R. F. Shawn, C. B. Grimes, and J. S. Cope. 1994. Larval development, distribution, and abundance of common dolphin, Coryphaena hippurus, and pompano dol- phin, C. equiselis (family: Coryphaenidae), in the north- ern Gulf of Mexico. Fish. Bull. 92:275-291 El-Sayed, A. F. M. 1991. Protein requirements for optimum growth of Liza ramada fry (Mugilidae) at different water salinities. Aquat. Liv. Resour. 4:117-123. Fabens, A. J. 1965. Properties and fitting of the von Bertalanffy growth curve. Growth 29:265-289 NOTE Benetti et al.: Growth rates of captive Coryphaena hippurus 157 Fagundes Netto, E. B., and D. D. Benetti. 1984. Nocoes sobre o crescimento e perspectivas de cultivo da garoupa-verdadeira (Epinephelus guaza Linnaeus 1758, Pisces, Serranidae). In Anais III Simpdsio Brasileiro de Aquicultura, Sao Paulo, Brazil, p. 124—132. Florida Sportsman. 1979. In the wake. June, p. 123. Gibbs, R. H.. Jr., and B. B. CoUette. 1959. On the identification, distribution, and biology of dolphins, Coryphaena hippurus and C. equiselis. Bull. Mar. Sci. Gulf Caribb. 9 (2):117-152. Hagood, R. W., and G. N. Rothwell, M. Swafford, and M. Tosaki. 1981. Preliminary report on the aquaculture development of the dolphin fish, Coryphaena hippurus Linnaeus. J. World Maricult. Soc. 12(11:135-139. Hassler, N. W., and M. T. Hogarth. 1977. The growth and culture of dolphin, Coryphaena hippurus, in North Carolina. Aquaculture 12:115-122. Iwai, T., Jr., H. Ako, and L. E. Yasukochi. 1992. Use of beef liver in the diet of juvenile mahimahi, Coryphaena hippurus L. World Aquaculture 23(3):49-51. Jobling, M. 1990. Fulfilling the impossible dream. Fish Farmer, July/ Aug.:52-53. Johnson, G. D. 1978. Development of fishes of the Mid-Atlantic Bight. An atlas of egg, larval and juvenile stages. Vol. 4: Carangidae- Ephippidae. U.S. Dep. Interior, Fish. Wild. Service, FWS/ OBS 78/12:123-128. Jones, R. 1976. Growth in fishes. In D. H. Cushing and J. J. Walsh (eds.), The ecology of the seas, Chap. 11, p. 251-279. W B. Saunders Co. Kim, B. G., S. Monahan, E. Schaleger, and A. C. Ostrowski. 1993. Intensive hatchery culture of mahimahi (Coryphaena hippurus) at the Oceanic Institute. '93 World Aquacul- ture, European Aquae. Soc. Special Publ. 19, p. 401. KrauJ, S. 1989. Review and current status of the aquaculture poten- tial for the mahimahi, Coryphaena hippurus. Advances in tropical aquaculture, Tahiti. AQUACOP, IFREMER. Actes Colloq. Int. 9:445-459. 1991. Hatchery methods for the mahimahi, Coryphaena hippurus, at Waikiki Aquarium. In J. P. McVey (ed.), Handbook of mariculture. Vol. II: Finfish aquaculture, p. 241-250. CRC Press, FL. Kraul, S., and H. Ako. 1993. Successful methods for mahimahi aquaculture. '93 World Aquaculture, European Aquacult. Soc. Spec. Publ. 19, p. 403. Ostrowski, A. C, C. Brownell, and E. O. Duerr. 1989. Growth and feeding rates of juvenile dolphins (.Coryphaena hippurus) fed a practical diet through growout. World Aquaculture 20(41:104-105. Ostrowski, A- C, B. Kim, and E. O. Duerr. 1992. Preliminary studies on the dietary protein: energy needs of juvenile mahimahi (Coryphaena hippu- rus). Aquaculture 92. World Aquae. Soc. Abstract, No. 323, p. 176. Oxenford, H. A., and W. Hunte. 1983. Age and growth of dolphin (Coryphaena hippurus) determined by growth rings in otoliths. Fish. Bull. 84:906-909. 1986. A preliminary investigation of the stock structure of the dolphin, Coryphaena hippurus, in the western central Atlantic. Fish. Bull. 84:451-460. Palko, B. J., G. L. Beardsley, and W. J. Richards. 1982. Synopsis of the biological data on dolphin-fishes, Coryphaena hippurus Linnaeus and Coryphaena equiselis Linnaeus. U.S. Dep. Commer., NOAA Tech. Rep. NMFS Circ. 433, FAO Fish. Syn. 130, 28 p. Prince, E. D., D. W. Lee, J. R. Zweifel, and E. B. Brothers. 1991. Estimating age and growth of young Atlantic blue marlin Makaira nigricans from otolith microstructure. Fish. Bull. 89:441-459. Ricker, W. E. 1975. Computation and interpretation of biological statis- tics offish populations. Bull. Fish. Res. Board Can. Spec. Publ. 191. 1979. Growth rates and models. In W. S. Hoar and D. J. Randall (eds.), Fish physiology, Vol 8, p. 677-743. Acad. Press, NY. Rose, C. D., and W. W. Hassler. 1968. Age and growth of the dolphin, Coryphaena hippurus (Linnaeus), in North Carolina waters. Trans. Am. Fish. Soc. 97:271-276. Schekter, R. C. 1983. Mariculture of dolphin (Corypaena hippurus): is it feasible? Proc. Gulf Caribb. Fish. Inst.:27-32 Szyper, J. P., R. Bourke, and L. D. Conquest. 1984. Growth of juvenile dolphin fish, Coryphaena hippurus, on test diets differing in fresh and prepared components. J. World Maricult. Soc. 15:219-221. Tucker, J. W., Jr. 1989. Development of feeds for marine and brackishwater fish. World Aquaculture 20: 106. Uchiyama, J. H., R. K. Burch, and S. Kraul Jr. 1986. Growth of the dolphins, Coryphaena hippurus and C. equiselis in Hawaiian waters, as determined by daily increments on otoliths. Fish. Bull. 84:186-191. Wang, C. H. 1979. A study of the population dynamics of dolphin fish (Coryphaena hippurus) in waters adjacent to eastern Tai- wan. Acta Oceanogr. 10:233-251. Modification and comparison of two fluorometric techniques for determining nucleic acid contents of fish larvae Michael F. Canino Alaska Fisheries Science Center National Marine Fisheries Service, NOAA 7600 Sand Point Way NE. Seattle, Washington 981 1 5-0070 Elaine M. Caldarone Northeast Fisheries Science Center National Marine Fisheries Service, NOAA Narragansett, Rhode Island 02882-1 199 The ribonucleic acid (RNA) content and the ratio of RNA to deoxyribo- nucleic acid (DNA) have proven to be reliable indices of the nutritional condition of larval fish (Buckley, 1979, 1980, 1981, 1984; Wright and Martin, 1985; Buckley and Lough, 1987; Clemmesen 1987, 1988; Rob- inson and Ware, 1988; Canino et al., 1991; Richard et al., 1991; Canino, 1994). Cellular RNA content is cor- related with the rate of protein syn- thesis. DNA content, which re- mains relatively constant in so- matic tissues, may be used as an index of cell number (Bulow, 1987). The RNA/DNA ratio, therefore, re- flects the protein synthesizing ca- pability of larval fish and has been used for estimating recent in situ protein growth (see review by Bulow, 1987; Robinson and Ware, 1988; Hovenkamp, 1990; Hoven- kamp and Witte, 1991). Initial methods for determining RNA and DNA concentrations in tissue homogenates, based upon ultraviolet light absorption (Munro and Fleck, 1966; Buckley, 1979), were limited by sample size, requir- ing about 800 /ig dry weight of tis- sue for a single analysis. The re- quirement of pooled samples offish larvae precluded quantitation of variability among individuals. Re- cent development of highly sensi- tive fluorometric techniques for di- rect measurement of nucleic acid contents of marine phytoplankton (Berdalet and Dortch, 1991; Mordy and Carlson, 1991), bacteria (Mordy and Carlson, 1991), and individual fish larvae (Clemmesen, 1988, 1993; Caldarone and Buckley, 1991; Theilacker and Shen, 1993) now provides a greater choice of meth- ods. Several protocols are based upon the fluorescence of the dye ethidium bromide (EB), when bound to nucleic acids. Fluorescence of the nucleic acid-fluorochrome complex is measured before and after diges- tion of RNA by RNase (Karsten and Wollenberger, 1972, 1977; Robinson and Ware, 1988; Clemmesen, 1993), or after sequential additions of RNase and DNase (Bentle et al., 1981). Total fluorescence is then partitioned into DNA and RNA com- ponents and nucleic acid concentra- tions are calculated indirectly by dif- ference after enzymatic degradation. A two-dye fluorometric method for nucleic acid analysis of indi- vidual fish larvae (Clemmesen, 1988) utilized EB to measure total sample fluorescence and the DNA- specific dye, Hoechst dye H33258 (Hoechst), to measure DNA content directly. A recent modification of this method to a single-dye proce- dure yields higher DNA estimates and RNA estimates comparable to the previous two-dye method (Clemmesen, 1993). Both protocols require extraction and purification of crude homogenates before analy- sis. While substances that interfere with sample fluorescence may be reduced or eliminated, the washing and extraction steps of both meth- ods restrict the number of samples that can be processed in a day. Caldarone and Buckley ( 1991) de- veloped a two-dye method for deter- mining nucleic acid contents that was coupled with an automated flow- injection analysis (FLA) system in which EB is used to estimate total nucleic acid content and Hoechst is used to measure DNA. This method has the advantage of combining high sensitivity and sample throughput rate with a simple extraction proce- dure. Unfortunately, an FIA system may be too costly for many laborato- ries. In this paper, we present an adaptation of the FIA method for con- ventional static fluorometric analy- sis (CFA) and compare results using the two procedures. Methods Fish larvae and juveniles from labo- ratory culture and field samples from six species — Atlantic cod, Gadus morhua; inland silverside, Menidia beryllina; haddock, Melanogrammus aeglefinus; tautog, Tautoga onitis; winter flounder, Pleuronectes americanus; and walleye pollock, Theragra chalcogramma — were chosen to provide different species, ages, and nutritional histories for comparison (Table 1). Fish homo- genates, except those of walleye pollock, were prepared by homog- enizing between 1 and 12 previ- ously frozen individuals with deion- Manuscript accepted 23 May 1994. Fishery Bulletin 93;158-165 (1995). 158 NOTE Canino and Caldarone: Fluorometric techniques for determining nucleic acid contents of fish larvae 159 Table 1 Fish species, sample abbreviations, and sources homogenate at each age. (S) = starved. used for methods comparison. Fish sampled at discrete ages provided one Species Sample name Source Age (d) n Atlantic cod Gadus morhua C C(S) lab lab(S) 41-61 41-61 3 3 Inland silverside Menidia beryllina s S(S) lab lab(S) 104-108 104-108 3 3 Haddock Melanogrammus aeglefinus H lab 11,22,44 3 Tautog Tautoga onitis T lab 20 3 Winter flounder Pleuronectes americanus F lab 26,41,57 3 Walleye pollock Theragra chalcogramma P field <60 3 ized, distilled water in an Ultra-Turrax homogenizer (Tekmar Co.) with three 15-second pulses at maximum power (Caldarone and Buckley, 1991). Previously fro- zen walleye pollock larvae were homogenized in prechilled glass homogenizers. Six aliquots of homo- genate were pipetted into 1.5-mL polyethylene vials and immediately frozen at -80°C until analysis of three aliquots by FIA and three aliquots by CFA. Sample extraction procedures followed those out- lined by Caldarone and Buckley ( 1991). Homogenates were extracted in 1% sarcosine (N-lauroylsarcosine), TRIS-EDTA (5.0 mM TRIS-HC1, 0.5 mM EDTA, pH 7.5) buffer for 30 minutes at room temperature, mixed vigorously in a sample vortexer for 10—15 sec- onds, then extracted for another 30 minutes. Aliquots were diluted with TRIS-EDTA buffer to yield a final concentration of 0.1% sarcosine, then centrifuged at room temperature for 5 minutes at 2,500 times grav- ity (x g) for CFA and 12,000 x g for FIA. The super- natant was recovered for estimation of nucleic acid concentrations by FIA or CFA. Sarcosine, like other anionic detergents, fluoresces at excitation and emis- sion wavelengths used in the analyses. To reduce this effect, samples extracted in 1% sarcosine required a 10-fold dilution with TRIS-EDTA buffer before FIA (Caldarone and Buckley, 1991). In the modified CFA procedure, a final sample concentration of 0.0125% sarcosine produced an acceptable background fluo- rescence (blank) value of approximately 5% of the highest nucleic acid standard. Differences in the total sample volumes required by FIA and CFA procedures required modifications to the concentrations of nucleic acid standards, fluo- rochrome reagents, and sample volumes of fish homogenates. Nucleic acid standard ranges and homogenate sample volumes were chosen to encom- pass the typical range of concentrations encountered by each method during routine analysis of individal fish larvae. Working standards of RNA and DNA were prepared as described by Caldarone and Buckley (1991) by serial dilution of previously fro- zen stock solutions with 0.1% sarcosine in TRIS- EDTA buffer. RNA standards (Sigma Chemical Co., St. Louis, MO, Type IV, calf liver) ranged from 1.97 to 17.68 /ig-mL" 1 for FIA and from 0.41 to 13.14 /ig-mLr 1 for CFA. DNA standards (Boehringer-Mann- heim Corp., Indianapolis, IN, high molecular weight, calf thymus) ranged from 0.16 to 1.52 /ig-mLr 1 for FIA and from 0.07 to 2.37 jig-mL" 1 for CFA. Estimates of contamination of the calf liver RNA standard by DNA, determined by fluoresecence in Hoechst, was less than 1% by weight. A 100-//L "spike" of homogenate from walleye pollock larvae was added to serial dilu- tions of RNA and DNA standards in order to estimate the recovery efficiencies using the CFA protocol. Fluorochrome working reagents of EB (137.5 ng-mLr 1 ) and Hoechst (25 ng-mLr 1 ) prepared for FIA in TRIS-EDTA buffer according to Caldarone and Buckley ( 1991) were modified by reducing the sodium chloride (NaCl) concentration in the Hoechst reagent from 0.2 N to 0. 1 N and the pH from 7.5 to 7.0. Work- ing dye solutions of 2.0 pg-mL" 1 EB and 5.0 /ig-mLr 1 Hoechst prepared for CFA at the same pH and NaCl concentration as for FIA provided a sensitive linear response to the standards while maintaining a low background fluorescence. The RNA and DNA concentrations were estimated for each aliquot. In addition, the amount of endog- enous fluorescence (sample fluorescence in the ab- sence of fluorochrome dye) was determined for most homogenate samples (21 for FIA, 17 for CFA) by sub- stituting an equal volume of TRIS-EDTA buffer for the fluorochrome working reagent in the assay procedure. The FIA system for nucleic acid determination is fully described by Caldarone and Buckley (1991). A 50-/iL sample is injected into a reagent stream con- 160 Fishery Bulletin 93(1). 1995 taining one of the fluorochrome dyes. The injected sample is mixed and transported with the reagent to the fluorescence detector which continuously records the fluorescence at 525 nm excitation and 600 nm emission for EB, or 356 nm excitation and 458 emission for Hoechst. The sample fluorescence is displayed as a peak, whose area is proportional to the concentration (Caldarone and Buckley, 1991). Modification of this procedure for CFA required a minimal total volume (sample plus fluorochrome re- agent) of 2 mL in order to be measured accurately by the fluorometer (Shimadzu RF-540 spectro- fluorophotometer, Shimadzu Corp., Kyoto, Japan), which was adapted to use 12x75 mm borosilicate glass test tubes as cuvettes. For all samples, except the homogenates of larval pollock, a 0.1-mL aliquot of extracted sample was combined with 0.9 mL of TRIS-EDTA buffer and 1.0 mL of fluorochrome work- ing reagent (EB or Hoechst). For larval pollock homogenates, a 0.03-mL aliquot was combined with 0.97 mL of TRIS-EDTA buffer prior to addition of 1.0 mL of the fluorochrome reagents. The sample- fluorochrome mixture was incubated at room tem- perature for 15-30 minutes before fluorescence was measured at the same excitation and emission wave- lengths as in the FIA procedure. Initial trials indi- cated that maximum sample fluorescence was ob- tained within 15 minutes and was stable for more than 4 hours at room temperature. Calculations of nucleic acid concentrations were identical for both methods. First, endogenous sample fluorescence was subtracted from total sample EB or Hoechst dye fluorescence. Sample DNA concen- trations were estimated directly from fluorescence in Hoechst dye by using a DNA-Hoechst standard curve. The computed DNA concentration was used to estimate the fluorescence contribution by DNA to the total sample EB-fluorescence by using a DNA- EB standard curve. Fluorescence due to DNA-EB was subtracted from the total sample fluorescence and the remaining fluorescence was assumed to be due to RNA. The RNA concentration was then estimated by using an RNA-EB standard curve. The relationships between mean RNA and DNA con- centration and RNA/DNA ratios of the fish homo- genates predicted by FIA and CFA methods were ana- lyzed by using a geometric mean regression procedure (Ricker, 1984) that describes the linear central trend between two independent estimates of the variate. Results Standard calibration curves indicated that detection limits for CFA are about 0.07 /ig-mL -1 for RNA and 0.03 /igmL -1 for DNA, similar to the values detect- able with automated FIA (Caldarone and Buckley, 1991). The precision of both methods was comparable; mean coefficients of variation, V (standard devia- tion as a percentage of the mean), for triplicate de- terminations from each homogenate averaged 5 to 7% for RNA and 3 to 4% for DNA over a broad range of estimated sample concentrations. Recovery of DNA standards from six replicate "spikes" of larval pollock homogenate with the CFA method averaged 99.5 + 0.9% in Hoechst and 99.2 ± 2.9% in EB, and recovery of "spiked" RNA standards averaged 94.8 ± 6.0% in EB. Mean nucleic acid concentrations and RNA/DNA ratios offish homogenates were generally lower when estimated by CFA relative to FIA (Fig. 1). RNA con- centration was most strongly correlated between the two methods and DNA concentration less so (Table 2). The ratio of RNA to DNA was only moderately correlated between the two methods and provided the poorest basis for comparison. Intermethodological calibration between FIA and CFA results was achieved by the application of regression coefficients (Table 2) to mean nucleic acid concentrations and RNA/DNA ratios estimated by CFA (Fig. 2). Homogenates prepared from larval stages of the gadid species (Gadus morhua, Melanogrammus aeglefinus, and Theragra chalcogramma), tautog, Tautoga onitis, and winter flounder, Pleuronectes americanus, exhibited negligible endogenous fluores- cence, regardless of fluorochrome, over a 3- to 4-fold range of nucleic acid concentrations (Table 3). En- dogenous fluorescence was highest for juvenile in- land silverside and juvenile winter flounder. Discussion Modification of the FIA method described by Caldarone and Buckley (1991) to conventional fluo- rometry produced an assay protocol with comparable Table 2 Geometric mean functional regression coefficients describ- ing mean RNA and DNA concentrations (/jgmL 1 homogenate I and RNA/DNA ratios of 24 fish homogenates determined by conventional fluourometric analysis (CFA) regressed upon estimates obtained by flow injection analy- sis (FIA). Variate Y-intercept Slope RNA DNA RNA/DNA -5.318 -1.795 -0.309 0.652 0.991 0.733 0.972 0.808 0.569 NOTE Canino and Caldarone: Fluorometric techniques for determining nucleic acid contents of fish larvae 161 200 0- O c(S) • c - A S (S) A S D F V H ▼ P O T 150 0- .... -V" " 100 - 50.0- 00- ^«^t? AATJ T ■-D — i ..T- .-▼" — 1 1 0.0 100 o 150 RNA (/ig mL homogenate) - FIA DNA (/tg mL 12 5 15.0 17.5 homogenate) - FIA 25 0.0- 8 0- •-- 6 - 4 0- 20- - J^ AA- V V T 0.0- ^•-''' 1 — 1 — — i 1 1 2 40 60 RNA/DNA -FIA Figure 1 Mean RNA and DNA concentrations and RNA/DNA ratios of 24 crude fish homogenates obtained by flow injection analysis (FIA) versus conventional fluorometric analysis (CFA). Solid line represents a 1:1 correspondence be- tween the two methods. Dashed line is the geometric mean regression be- tween the two estimates. Species abbreviations as in Table 1. sensitivity, precision, and sample throughput. Mean coefficients of variation (V x ) for DNA concentration estimated by FIA and CFA in this study (3 to 4%) are similar to those reported for replicate assays of a pooled fish homogenate using FIA (Caldarone and Buckley, 1991), another two-dye procedure (Clem- mesen, 1988), and a single-dye method (Clemmesen, 1993). In this study, the mean V x values for RNA con- centration were 3 to 5% higher when determined by FIA and CFA for multiple homogenates than for FIA estimates of a single, pooled homogenate (Caldarone and Buckley, 1991) but are comparable to those re- ported by Clemmesen (1993) for RNA estimates of pooled fish homogenate using a single-dye technique. The RNA and DNA concentrations of fish homogenates were consistently lower when estimated by CFA compared with FIA. Calibration between the two methods by functional regression relationships established a reasonable basis for comparison of results (Fig. 2), although considerable differences in mean es- timated nucleic acid concentrations and RNA/DNA were still evident. We emphasize that sample homo- 162 Fishery Bulletin 93(1). 1995 250.0 150 -■ _, 100.0 50.0 O C (S) □ F • C V H A S (S) ▼ p AS O T 50 100 150 200 RNA (figmL"' homogenate) - FIA 1 1 1 2 5 5 7.5 10 12 5 15.0 17 5 20 22.5 25.0 DNA (figmL -1 homogenate) - FIA 6 8 RNA/DNA - FIA Figure 2 Mean RNA and DNA concentrations and RNA/DNA ratios of 24 crude fish homogenates obtained by flow injection analysis (FIA) versus values trans- formed from conventional fluorometric analysis (CFA) by functional regres- sion coefficients in Table 2. Solid line represents a 1:1 correspondence be- tween the two methods. Species abbreviations as in Table 1. genates for this study were chosen from six fish spe- cies and assayed across far greater ranges of age and nucleic acid concentrations than reported previously (Clemmesen 1988, 1993; Caldarone and Buckley, 1991; McGurk and Kusser, 1992) in order to broaden the scope of comparison and statistical inference. A comparative study of FIA and CFA techniques within the more lim- ited range of sample concentrations encountered dur- ing routine processing of individual larvae of a single species would have undoubtedly yielded higher corre- lations between estimates. The FIA and CFA procedures differ primarily in the choice of instrumentation as both use sample extraction by sarcosine. Caldarone and Buckley (1991) reported that nucleic acids in larval fish samples (<200 /ig dry weight) were completely ex- tracted in one hour at room temperature. Sample nucleic acid concentrations of fish homogenates in this study were prepared to be similar to those ob- tained from assays of individual larvae, suggesting that incomplete or differential extraction of homo- genates by sarcosine between FIA and CIA is un- NOTE Canmo and Caldarone. Fluorometnc techniques for determining nucleic acid contents of fish larvae 163 Table 3 Mean endogenous fluorescence' offish homogenates as a percentage of total fluorescence in Hoechst 33258 (Hoechst) bromide (EB) fluorochromes. Samples are from larvae unless otherwise noted. (S) = starved. or ethidium Species Sample name Age (d) Hoechst EB FIA CFA FIA CFA Atlantic cod C Atlantic cod (starved) C(S) Inland silverside (juvenile) S Inland silverside (juvenile, starved) S(S) Haddock H Tautog T Winter flounder F Winter flounder (juvenile) Walleye pollock P 41-61 41-61 104-108 104-108 11 22 44 20 26 41 57 <60 <3 <3 <2 <2 <1 <1 3 3 38 40 33 37 <1 <1 12 12 <3 <3 <3 <3 <3 <3 <2 <2 <2 <2 <2 <2 <1 <1 <1 <1 <1 <1 <2 <2 2 <2 <2 <2 19 14 <1 6 <3 <2 <1 2 ' Endogenous sample fluorescence occurs in the absence of fluorochrome dye. likely. The consistently lower estimates of nucleic acids with the CFA method, relative to the FIA method, implies a lower ratio of fluorescence yield of samples to standards. One possibility is that the ef- fective sample concentration at the detector may be greater in CFA compared with FIA. In FIA, the time between the mixing of dye and sample is precisely controlled but the ratio of dye to sample is unknown. The concentrations of the fluorochrome working re- agents used in FIA were increased ( 14x and lOOx for EB and Hoechst, respectively) in order to saturate the standards for the CFA modification. A higher ef- fective sample concentration at the detector (possi- bly making the samples less available to the dye), coupled with a longer pathlength, may explain the lower fluorescence yield of the CFA samples relative to the standards. The higher correlation between the methods for RNA estimates than for DNA was an unexpected result; RNA content is calculated indi- rectly (total sample fluorescence minus estimated fluorescence due to DNA) and, presumably, is more subject to measurement error than is direct fluoro- metric determination of DNA. Fluorescence by compounds other than nucleic ac- ids represents a potential source of interference in any fluorometric assay. The level of endogenous sample fluorescence should be determined by pre- liminary analyses when a new fish species or devel- opmental stage is being investigated. Crude tissue homogenates exhibit fluorescence characteristics not found in commercial preparations of nucleic acids that appear to be related to tissue type and develop- mental stage of the fish. Caldarone and Buckley (1991) found that winter flounder and American sand lance, Ammodytes americanus, larvae and the nucleic acids used as standards exhibited negligible amounts of endogenous or residual fluorescence, whereas win- ter flounder postlarvae and juvenile muscle and liver had levels ranging from approximately 5 to 55% of total fluorescence in EB or Hoechst dyes. Clemmesen ( 1993) reported endogenous fluorescence values rang- ing up to 40% in Hoechst determinations of the DNA content of herring, Clupea harengus, larvae. In this study, only homogenates of the juvenile inland sil- verside and juvenile winter flounder exhibited high levels of endogenous fluorescence in Hoechst dye or EB (Table 3), providing further evidence of an onto- genetic effect. Gadid larvae, of approximately the same age as the juvenile winter flounder, displayed negligible amounts of endogenous fluorescence, sug- gesting that systematic differences may also exist. Interference in nucleic acid estimation from con- taminants of crude homogenate preparations has been reported previously (Brunk et al., 1979; Mordy and Carlson, 1991; Clemmesen, 1993). McGurk and Kusser ( 1992) compared three fluorescence methods for quantitating nucleic acids in Pacific herring, Clupea pallasi, larvae. Of the three, the method in- corporating the most extensive purification steps (Clemmesen, 1988) resulted in higher estimates of RNA content and RNA/DNA ratios than the other two methods, suggesting that higher yields may have resulted from the elimination of substances interfer- ing with accurate fluorometric quantitation. How- ever, quenching of nucleic acid fluorescence by con- taminants in the samples does not appear to be sig- 164 Fishery Bulletin 93(1). 1995 nificant in either the CFA or FIA techniques using the sarcosine extraction procedure with larval fish. Recoveries of crude homogenate "spikes" added to nucleic acid standards by FIA (Caldarone and Buckley, 1991) and CFA (this study) are similar to those reported for more purified extracts (Clemmesen, 1993). McGurk and Kusser (1992) re- ported higher RNA contents and RNA/DNA ratios for yolk-sac herring larvae analyzed with the Clemmesen method (1988) and suggested that fluoresecence absorbance by yolk components may be reduced by the purification steps in that assay. However, when a homogenate of winter flounder yolk- sac larvae was "spiked" with nucleic acid standards and subjected to FIA with a sarcosine extraction pro- cedure, recoveries of calf thymus DNA standards remained unchanged and those for calf liver RNA standards only declined by 3 to 5% (Caldarone, Unpubl. data). RNA/DNA indices have proven useful as indica- tors of condition in a wide variety of fish species. When coupled with data on water temperature, and calibrated with laboratory-reared larvae, estimates of recent growth in the field can be obtained (Buckley, 1984). However, this study and others illustrate a common problem with the application of fluorescent techniques to estimation of nucleic acid levels in fish and other biosamples, and the need for inter- calibration. Given the disparity in estimates of RNA and DNA contents due to the method of analysis (McGurk and Kusser, 1992; this study) and choice of nucleic acid standards (Caldarone and Buckley, 1991), no direct intermethodological comparisons of data can be made without intercalibration between analytical methods, as done by McGurk and Kusser (1992), Clemmesen (1993), Mathers et al. (1994), and this study. It is inappropriate to compare RNA/DNA ratio values with published data unless the same methods and standards are used. Also, the general- ized growth equation in Buckley (1984) uses RNA/ DNA ratios determined with an ultraviolet light ab- sorption method that cannot be directly applied to ratios determined with other analytical procedures without running an intercalibration between the two methods. Alternatively, the relation between RNA/ DNA, temperature, and growth must be determined for laboratory-reared larvae by using the analytical method of choice before a growth equation can be applied to fish larvae collected in the field. A general assay protocol for FIA and CFA is pre- sented in Figure 3. For this study, fish larvae were pooled and homogenized to provide adequate repli- cates for methods comparison. On a routine basis, individual larvae may be frozen in 1.5-mL micro- centrifuge vials, then extracted in the same vial, re- ducing processing time and errors associated with sample transfer. The actual volumes of 1% sarcosine and TRIS-EDTA buffer may have to be determined empirically depending upon the larval fish size and sample volume required for spectrofluorometric analysis. A trained operator can process approxi- mately 80 samples for RNA and DNA determinations as well as standards in eight hours using CFA and in five hours with FIA. We do not routinely assay replicate sample aliquots or correct for endogenous sample fluorescence when preliminary estimates are less than 3% of total sample fluorescence. The "best" method for nucleic acid analysis of lar- val fish may well be determined by sample size, in- strumentation, the presence of interfering sub- stances, or the need to compare values to previously published data. Flow-injection analysis (Caldarone and Buckley, 1991) is a sensitive, precise assay with a simple extraction procedure and high sample throughput. The modified CFA protocol presented here retains those advantages, extends them to a more inexpensive method using static fluorometry, and pro- vides an intercalibration between the two methods. one larval fish J, add 1% sarcosine in TRIS-EDTA buffer i incubate 30 min at room temperature i vortex vigorously J, incubate 30 min at room temperature vortex vigorously I dilute with TRIS-EDTA buffer si centrifuge S min at 2,500 x g 0- replicate samples of supernatant r FIA Hoechst EB 4 CFA l/N Hoechst EB to spectrofluorometer Figure 3 Generalized flowchart of the sarcosine extraction, flow in- jection analysis (FIA), and conventional fluorometric analy- sis (CFA) procedures. NOTE Canino and Caldarone Fluorometnc techniques for determining nucleic acid contents of fish larvae 165 Acknowledgments The authors thank L. Buckley, G. Theilacker, D. Busch, A. Kendall Jr., and K. Bailey for their helpful comments on earlier versions of the manuscript and three anonymous reviewers for their critical reviews. S. Picquelle provided assistance in the statistical treatment of the data. This study was conducted as part of the Fisheries Oceanography Coordinated In- vestigations (NMFS, Seattle) and the GLOBEC Cod Recruitment Studies (NMFS, Narragansett) and rep- resents FOCI contribution 0195 and GLOBEC con- tribution 0194. Literature cited Bentle, L., S. Dutta, and J. Metcoff. 1981. The sequential enzymatic determination of DNA and RNA. Anal. Biochem. 116:5-16. Berdalet, E., and Q. Dortch. 1991. New double-staining technique for RNA and DNA measurement in marine phytoplankton. Mar. Ecol. Prog. Ser. 73:295-305. Brunk, C. F., K. C. Jones, and T. W. James. 1979. Assay of nanogram quantities of DNA in cellular homogenates. Anal. Biochem. 92:497-500. Buckley, L. J. 1979. Relationships between RNA-DNA ratio, prey density, and growth rate in Atlantic cod (Gadus morhua ) larvae. J. Fish. Res. Board Can. 36:1497-1502. 1980. Changes in ribonucleic acid, deoxyribonucleic acid, and protein content during ontogenesis in winter floun- der, Pseudopleuronectes americanus, and the effect of starvation. Fish. Bull. 77:703-708. 1981. Biochemical changes during ontogenesis of cod (Gadus morhua L.) and flounder (Pseudopleuronectes amerieanus) larvae. Rapp. P.-V. Reun. Cons. Int. Explor. Mer 178:547-552. 1984. RNA-DNA ratio: an index of larval fish growth in the sea. Mar. Biol. 80:291-298. Buckley, L. J., and R. G. Lough. 1987. Recent growth, biochemical compostion, and prey field of larval haddock (Melanogrammus aeglefinus) and Atlantic cod (Gadus morhua) on Georges Bank. Can. J. Fish. Aquat. Sci. 44:14-25. Bulow, F. J. 1987. RNA-DNA ratios as indicators of growth in fish: a review. In R. C. Summerfelt and G. E. Hall (eds.), Age and growth in fish, p. 45-64. Iowa State Univ. Press, Ames, Iowa. Caldarone, E. M., and L. J. Buckley. 1991. Quantitation of DNA and RNA in crude tissue extracts by flow injection analysis. Anal. Biochem. 199:137-141. Canino, M. F. 1994. Effects of temperature and food availability on growth and RNA/DNA ratios of walleye pollock Theragra chaleogramma (Pallas) eggs and larvae. J. Exp. Mar. Biol. Ecol. 175:1-16. Canino, M. F., K. M. Bailey, and L. S. Incze. 1991. Temporal and geographic differences in feeding and nutritional condition of walleye pollock larvae Theragra chaleogramma in Shelikof Strait, Gulf of Alaska. Mar. Ecol. Prog. Ser. 79:27-35. Clemmesen, C. 1987. Laboratory studies on RNA/DNA ratios of starved and fed herring (Clupea harengus) and turbot (Scophthalmus maid- mus) larvae. J. Cons. Int. Explor. Mer 43:122-128. 1988. A RNA and DNA fluorescence technique to evaluate . the nutritional condition of individual marine fish larvae. Meeresforsch. 32:134-143. 1993. Improvements in the fluorometric determination of the RNA and DNA content of individual marine fish larvae. Mar. Ecol. Prog. Ser. 100:177-183. Hovenkamp, F. 1990. Growth differences in larval plaice Pleuronectes platessa in the southern bight of the North Sea as indi- cated by otolith increments and RNA/DNA ratios. Mar. Ecol. Prog. Ser. 58:205-215. Hovenkamp, F., and J. IJ. Witte. 1991. Growth, otolith growth, and RNA/DNA ratios of lar- val plaice Pleuronectes platessa in the North Sea 1987 to 1989. Mar. Ecol. Prog. Ser. 70:105-116. Karsten, U., and A. Wollenberger. 1972. Determination of DNA and RNA in homogenized cells and tissues by surface fluorometry. Anal. Biochem. 46:135-148. 1977. Improvements in the ethidium bromide method for direct fluormetric estimation of DNA and RNA in cell tis- sue homogenates. Anal. Biochem. 77:461-470. Mathers, E. M., Houlihan, D. F., and L. J. Burren. 1994. RNA, DNA and protein concentrations in fed and starved herring Clupea harengus larvae. Mar. Ecol. Prog. Ser. 107:223-231. McGurk, M. D., and W. C. Kusser. 1992. Comparison of three methods of measuring RNA and DNA concentrations of individual Pacific herring, Clupea pallasi, larvae. Can. J. Fish. Aquat. Sci. 49:967-974. Mordy, C. W., and D. J. Carlson. 1991. An evaluation of fluorescence techniques for measur- ing DNA and RNA in marine microorganisms. Mar. Ecol. Prog. Ser. 73:283-293. Munro, H. N., and A. Fleck. 1966. The determination of nucleic acids. In D. Glick(ed.), Methods of biochemical analysis, volume 14, p. 423-524. Interscience Pubis., New York. Richard, P., J. P. Bergeron, M. Boulhic, R. Galois, and J. Person-Le Ruyet. 1991. Effect of starvation on RNA, DNA and protein con- tent of laboratory-reared larvae and juveniles of Solea solea. Mar. Ecol. Prog. Ser. 72:69-77. Richer, W. E. 1984. Computation and uses of central trend lines. Can. J. Zool. 62:1897-1905. Robinson, S. M. C, and D. M. Ware. 1988. Ontogenic development of growth rates in larval Pa- cific herring, Clupea harengus pallasi, measured with RNA- DNA ratios in the Strait of Georgia, British Columbia. Can. J. Fish. Aquat. Sci. 45:1422-1429. Theilacker, G. H., and W. Shen. 1993. Fish larval condition analyzed using flow cytometry. In B. T Walther and H. J. Fhyn (eds.), Physi- ological and biochemical aspects of fish development, p. 346-355. Univ. Bergen, Norway. Wright, D. A., and F. D. Martin. 1985. The effect of starvation on RNA:DNA ratios and the growth of larval striped bass, Morone saxatilis. J. Fish Biol. 27:479-485. The potential use of otolith characters in identifying larval rockfish [Sebastes spp.) Thomas E. Laidig Stephen Ralston Southwest Fisheries Science Center National Marine Fisheries Service. NOAA 3 1 50 Paradise Drive. Tiburon, California 94920 Rockfish of the genus Sebastes are commercially important in the northeast Pacific Ocean, where more than 60 valid species are rec- ognized (Eschmeyer et al., 1983). Although morphological and chro- matic characters are used routinely to identify adults of the genus, such traits are frequently ineffective for young of the year, especially larvae. Like most fish, early developmen- tal stages of Sebastes spp. have less pigmentation, fewer hard struc- tures (e.g. fin rays), and show less differentiation when compared with adults. However, an ability to discriminate among the larvae of the many rockfish species is criti- cal to the advancement of early life history studies in this group. A variety of methods have been used to identify larval and juvenile rockfish (Kendall, 1991). Although pigmentation is the most fre- quently used character (Moser et al., 1977; Laroche and Richardson, 1980; Moser et al., 1985; Kendall and Lenarz, 1987), size at extrusion (Moser et al., 1977), meristic counts (Moser et al., 1977), morphometries (Morris, 1956), size at specific life history events (Stahl-Johnson, 1985), time of parturition in conjunction with geographic location (Moser et al., 1977), and electrophoretic pat- terns (Seeb and Kendall, 1991) have all been used to identify lar- val and juvenile rockfish. A problem with many of these techniques, however, is that larval characters often undergo ontoge- netic change. To overcome this problem, the larvae of many species have been reared in captivity and sequentially sacrificed. This is not only technically demanding, expen- sive, and time consuming, but dif- ferences in development between laboratory and wild fish may affect the number, size, and distribution of the attributes under investiga- tion. Thus, permanent identifiable characters would be useful. A static trait, which retained its character- istics throughout early life, would increase our ability to positively identify rockfish larvae. Otoliths, being acellular aragonitic concre- tions, are good candidates to retain features produced during the lar- val stage. Likewise, otoliths have been shown to contain sufficient variation among species (Hecht and Appelbaum, 1982; Akkiran, 1985; Victor, 1987) and stocks (Messieh, 1972; Postuma, 1974; McKern et al, 1974; Neilson et al., 1985; Smith, 1992) to assign with accuracy group membership to individuals. This study investigates the po- tential of using otolith microstruc- ture to assist in the identification of larval rockfish. We assume that no change occurs to early larval otolith microstructure once it is deposited (Brothers, 1984; Steven- son and Campana, 1992). Otolith characteristics (nuclear shading patterns, nuclear radius, and first increment width) produced during the early larval period were de- scribed and measured from late lar- val and pelagic juvenile stage speci- mens of eight species of rockfish: Sebastes auriculatus, S. entomelas, S. flavidus, S. goodei, S. jordani, S. mystinus, S. paucispinis, and S. saxicola. These species were the most numerous rockfish species collected off the central California coast during the study period. Methods Field collections Samples of young-of-the-year pe- lagic juveniles and late larvae were collected with a midwater trawl ( 12 x 12 m) from the National Oceanic and Atmospheric Administration RV David Starr Jordan. From 1983 to 1989 nine cruises were conducted off central California (lat. 36°30- 38°10'N) during the months of April-June. Pelagic juvenile rock- fish were frozen at sea and re- turned to the laboratory for final identification. Wyllie Echeverria et al. (1990) have described cruise sampling methodology in detail. Laboratory procedures Pelagic juveniles were identified to species from external characteris- tics, including pigmentation, fin- ray counts, and gill-raker counts (Laidig and Adams, 1991). The sag- ittal otoliths were removed and af- fixed whole to microscope slides and were prepared for viewing with the methods outlined in Laidig et al. (1991). Otoliths were examined with a video image interfaced with a digi- tizer (Laidig et al., 1991). Distinct reoccurring shading patterns in the Manuscript accepted 15 June 1994. Fishery Bulletin 93:166-171 (1995). 166 NOTE Laidig and Ralston. Use of otolith characters in identifying larval Sebastes spp. 167 nucleus (i.e. the otolith core) were noted for each spe- cies. Increment counts were made beginning at the first clearly defined mark that completely encircled the primordium (see also Penney and Evans, 1985). This "extrusion" check forms at parturition (Ralston, unpubl. data) and defines the outer edge of the nucleus; the distance from the primordium to this mark is the nuclear radius (Fig. 1), and the incre- ment immediately following the extrusion check is the first growth increment. Data analysis The mean radius of the nucleus and the mean width of the first growth increment were compared among species and years. An overall analysis of variance (ANOVA), incorporating separate pairwise £-tests, equivalent to Fisher's least-significant difference, was performed to detect differences in the size of the nuclear radius and the width of the first increment among species and years. We used a two-way facto- rial analysis and calculated least square means (Searle et al., 1980) to evaluate treatment effects among species, years, and the interaction of species and years. A parametric discriminant analysis, as- suming a multivariate normal distribution with pooled covariance matrix, was used to determine the percentage of each species that was correctly classi- fied by nuclear radius and first increment width, alone and in combination with each other. To further evaluate species-specific differences in nuclear radius and first increment width, the data were pooled over years; however, we recognized the difficulty in isolating the effect of species alone. Sebastes auriculatus and S. saxicola were only sampled in one year; therefore they were not included in the annual variation analysis. For comparison, we treated these single-year studies as the pooled data for the other species. A blind test was performed to determine the accu- racy of the otolith characters in distinguishing be- tween the eight rockfish species used in this study. One hundred otoliths representing all eight species (S. auriculatus [n=5]; S. entomelas [n=13]; S. flauidus [n = 15]; S. goodei [n = 14]; S. jordani [n=25]; S. mystinus [n=9]; S. paucispinis [re=ll]; and S. saxicola [n-8]) were given to a reader. No other information (e.g. species, fish length, etc.) about the individual samples was provided. The reader then attempted to identify the correct species of rockfish, using both measured distances and shading patterns. The re- sults of the tentative classification were compared with the actual species identities to determine per- cent agreement. The significance of this result was evaluated against a null multinomial distribution, by assuming assignments at random to species. Figure 1 A Sebastes goodei otolith displaying the characteristic dark inner ring (DIR) around the primor- dium (PR). NE = nuclear edge. 168 Fishery Bulletin 93(1), 1995 Results Seven specific nuclear shading characters were iden- tified (Table 1): 1) the opacity of the primordium; 2) the opacity of the markings inside the nucleus; 3) the opacity of the increments directly outside the nucleus; 4) the opacity of the nuclear edge; 5) the existence of a dark inner band near the nuclear edge; 6) the existence of a light inner band near the nuclear edge; and 7) the existence of a dark inner ring encir- cling the primordium. In some cases, combinations of the shading pat- terns were sufficient to characterize a species. For example, 84% of the otoliths of S. goodei were found to have a dark primordium, a dark nuclear edge, and a dark inner ring surrounding the primordium, while this combination was never found in the other spe- cies examined (Fig. 1). Likewise, in S.jordani, a light penumbra was regularly found (76% occurrence) adjacent to the inner edge of the nucleus, along with a dark primordium and many inner rings (faint mi- crostructure occurring inside the nucleus). In S. paucispinis and S. flavidus, there was usually a dark inner band next to the edge of the nucleus (87% and 73% occurrence, respectively) . No annual variation was observed for the nuclear shading patterns. How- ever, in the remaining species, the shading patterns were too variable to establish consistent identifiable character states that would distinguish species. Annual variations in nuclear radius and the width of the first increment were examined (Fig. 2). An- nual variation in nuclear radius among the species was not significant; however, annual variability in the width of the first increment was significant (P<0.05). In addition, there was a significant inter- action (P<0.05) between year and species. The mean width of the first increment of S. paucispinis, for example, declined from 1984 to 1989, whereas that of S. flavidus increased (Fig. 2A). Sebastes jordani was found to have the largest average nuclear radius (Table 2; Fig. 2B). The rank order for the remaining species, from largest to small- est average nuclear radii, was S. goodei, S. auriculatus, S. paucispinis, S. flavidus, S. entomelas, S. saxicola, andS. mystinus. Individually, the nuclear radii of S. jordani, S. goodei, S. auriculatus, and S. mystinus were significantly different (P<0.05) from all other species and from each other. Sebastes jordani was also found to have the larg- est average first increment of all species studied (Table 2; Fig. 2A). The rank order of the other spe- cies, from largest to smallest average widths of the first increment, was S. paucispinis, S. goodei, S. auriculatus, S. saxicola, S. flavidus, S. entomelas, and S. mystinus. Sebastes jordani and S. paucispinis had significantly larger average first increment widths (P<0.05) than all other species studied (0.97 //m and 0.91 /im, respectively) (Table 2). A discriminant analysis was performed on the clas- sification of species by using nuclear radius and the width of the first increment as predictor variables (Table 3). Sebastes goodei, S. jordani, S. mystinus, and S. paucispinis were correctly identified from 57 to 83% of the time; Sebastes auriculatus and S. flavidus were classified correctly 33.9% and 41.8% of the time, respectively. Although these values are less than 50% correct, they represent the largest single classification for each species. Two species, S. entomelas and S. saxicola, were not often classified correctly (9.5% and 0%, respectively). In a blind test, the reader correctly classified 70 of the 100 otoliths (70% correct; Table 4), demonstrating that otoliths provide useful information in species iden- tification (P<0.001). Greater than 90% of Sebastes Table 1 Observed shading patterns of otolith nuclei for the eight species studied. An F means the attribute was faint, a D means it was dark, and a blank means that it was either variable or did not exist. For the last three attributes, an X means the character was present, aur = S. auriculatus, ent = S. S. paucispinis, and sax = S. saxicola. entomelas, fla = S. flavidus, goo = S. goodei, jor = S. jordani, mys = S. mystinus, pau = Attribute Species aur ent fla goo jor mys pau sax Primordium opacity Inner ring opacity Outer increment opacity Nuclear edge opacity Dark inner band D F F F F F F F X D D D D F F D D D F F F D X Light inner band Dark primordial ring X X X NOTE Laidig and Ralston: Use of otolith characters in identifying larval Sebastes spp. 169 goodei and S. paucispinis were correctly clas- sified, whereas the remaining species showed lower accuracy varying from 56 to 68%. Discussion Otolith characteristics have been shown to vary among species and among stocks. Rybock et al. (1975) and Postuma (1974) used nuclear dimensions to identify differ- ent fish stocks. McKern et al. (1974) used otolith dimensions to separate seasonal stocks of steelhead trout, and Victor ( 1987) used otolith dimensions to separate differ- ent species of pomacentrids and labrids. Postuma (1974) related otolith opacity to nuclear size and compared this relationship between stocks. Messieh (1972) used otolith shape to distin- guish among stocks of herring. Hecht and Appelbaum (1982) and Gago (1993) also used otolith shape to distinguish between species. We have found that otolith characteristics can effec- tively distinguish certain species of Sebastes. Four of the species examined, S. jordani, S. goodei, S. auri- Table 2 Mean nuclear radi us and first increment width of otoliths (all years combined) of Sebastes. SD = standard deviation n = sample size Nuclear First Species n radius (/Jm) SD increment ipm) SD S. auriculatus 56 14.07 1.48 0.82 0.20 S. entomelas 147 11.81 0.94 0.72 0.13 S. flavidus 122 12.09 0.69 0.72 0.16 S. goodei 230 15.15 0.89 0.85 0.17 S. jordani 541 16.96 0.99 0.97 0.23 S. mystinus 106 10.93 1.05 0.65 0.14 S. paucispinis 277 12.20 1.14 0.91 0.18 S. saxicola 12 11.58 0.90 0.73 0.23 d 110 ^ ' \ A 0--N ^**A \ fi 10 ° ---. \ • a.„ fc.C5 0.90 a £ 5 °- 80 C^^^»-* ^ •« aJSt^^ A n £ 0.70 A \ • E 0.80 ^*» X. 0.50 w Figure 2 Annual variation in average nuclear radius and first increment width for the six species of Sebastes that had multiple year observations, ent = S. entomelas. fla = S. flavidus, goo = S. goodei, jor = S. jordani. mys = S. mystinus, and pau = S. paucispinis. culatus, and S. mystinus, had significantly different nuclear radii from each other and from the other spe- cies examined. Sebastes jordani, S. goodei, S. pauci- spinis, and S. flavidus each had unique shading pat- terns that may help in species identifications. Sebastes jordani and S. paucispinis were correctly classified over 90% of the time in the blind test, displaying the useful- ness of otolith characteristics for identification. The specificity of otolith characters gives research- ers an opportunity to separate larvae using these characters alone. Without otolith data, the separa- tion of S. mystinus larvae from other rockfish larvae is difficult. Although larval S. jordani are relatively easy to identify on the basis of pigmentation (Moser et al., 1977), identifications can be confirmed with a few additional otolith measurements. We suggest from these findings that the difficult task of identifying rockfish larvae can be facilitated in some cases by employing otolith characters in com- bination with more traditional traits like pigmenta- tion. Of the eight species examined, six species (S. auriculatus, S. flavidus, S. goodei, S. jordani, S. mystinus, and S. paucispinis) had distinctive otolith characters that allowed separation from other spe- cies. Many of the larval stages of the more than 60 species of rockfish found in the northeast Pacific Ocean are very similar, and pigmentation alone cannot always reliably separate species. Otolith character examina- tion may be one further method that can aid research- ers in accurately identifying species in this group. Acknowledgments We would like to thank the crew of the RV David Starr Jordon and all the scientists who participated in the collection of samples. We also thank all of the reviewers for their informative comments. 170 Fishery Bulletin 93(1), 1995 Table 3 Discriminant analysis for nuclear radius and first increment width of otoliths for all years each species of Sebastes. aur = S. auriculatus, ent = S. entomelas, fla = S. flavidus, goo mystinus, pau = S. paucispinis, and sax = S. saxicola. combined showing percent classified as = S. goodei, jor = S. jordani, mys = S. Species Classification aur ent fla goo jor mys pau sax aur 33.9 0.0 17.9 23.2 10.7 0.0 12.5 1.8 ent 1.4 9.5 38.8 1.4 0.0 22.5 12.9 13.6 fla 5.7 14.8 41.8 0.0 0.0 11.5 18.9 7.4 goo 23.5 0.0 0.9 59.6 14.4 0.0 1.7 0.0 jor 0.9 0.0 0.0 15.9 83.2 0.0 0.0 0.0 mys 0.9 4.7 6.6 0.0 0.9 72.6 6.6 7.6 pau 7.6 2.5 13.7 4.3 0.7 6.5 57.4 7.2 sax 0.0 8.3 25.0 0.0 0.0 33.3 33.3 0.0 Table 4 Results of blind test showing classification rates of Sebastes by classifications, aur = S. auriculatus, ent = S. entomelas, fla = S = S. paucispinis, and sax = S. saxicola. species category. Bold numbers along the diagonal flavidus, goo = S. goodei, jor = S. jordani, mys = S ndicate correct mystinus, pau Actual Classified as: AUR ENT FLA GOO JOR MYS PAU SAX % Correct AUR 3 2 60% ENT 2 8 1 2 61% FLA 1 9 1 2 1 60% GOO 1 13 92% JOR 2 1 17 3 1 1 68% MYS 1 1 1 5 1 56% PAU 10 1 91% SAX 2 1 5 63% Literature cited Akkiran, N. 1985. A systematic study on Carangidae (Pisces) employing the otolith characters in the eastern Mediterranean. Bilj. Notes Inst. Oceanogr. Ribar., Split. 63:1-9. Brothers, E. B. 1984. Otolith Studies. In W. J. Richards, D. M. Cohen, M. P. Fahay, A. W. Kendall, and S. L. Richardson (eds.), On- togeny and systematics of fishes, p. 50-57. Spec. Publ. 1, Amer. Soc. Ich. Herp. Allen Press, Inc., Lawrence, KS. Eschmeyer, W. N., E. S. Herald, and H. Hammann. 1983. A field guide to Pacific coast fishes of North Amer- ica. Houghton Mifflin Co., Boston, MA, 336 p. Gago, F. J. 1993. Morphology of the saccular otoliths of six species of lanternfishes of the genus Symbolophorus (Pisces: Mycto- phidae). Bull. Mar. Sci. 52(3):949-960. Hecht, T-, and S. Appelbaum. 1 982. Morphology and taxonomic significance of the otoliths of some bathypelagic Anguilloidei and Saccopharyngoidei from the Sargasso Sea. Helgolander Meeresunters 35:301-308. Kendall, A. W., Jr. 1991. Systematics and identification of larvae and juveniles of the genus Sebastes. Environ. Biol. Fishes 30:173-190. Kendall, A. W., Jr., and W. H. Lenarz. 1987. Status of early life history studies of northeast Pa- cific rockfishes. In Proceedings of the international rock- fish symposium; October, 1986, Anchorage, Alaska, p. 99- 128. Univ. Alaska, Alaska Sea Grant Rep. 87-2. Laidig, T. W., and P. B. Adams (eds.). 1991. Methods used to identify pelagic juvenile rockfish (genus Sebastes) occurring along the coast of central California. U.S. Dep. Commer., NOAA Tech. Memo., NOAA-TM- NMFS-SWFSC-166, 180 p. NOTE Laidig and Ralston: Use of otolith characters in identifying larval Setosres spp. 171 Laidig, T. E., S. Ralston, and J. R. Bence. 1991. Dynamics of growth in the early life history of shortbelly rockfish, Sebastesjordani. Fish. Bull. 89:611-621. Laroche, W. A., and S. L. Richardson. 1980. Development and occurrence of larvae and juveniles of the rockfishes Sebastes flavidus and Sebastes melanops (Scorpaenidae) off Oregon. Fish. Bull. 77:901-923. McKern, J. L., H. F. Horton, and K. V. Koski. 1974. Development of steelhead trout (Salmo gairdneri) otoliths and their use for age analysis and for separating summer from winter races and wild from hatchery stocks. J. Fish. Res. Board Can. 31:1420-1426. Messieh, S. N. 1972. Use of otoliths in identifying herring stocks in the southern Gulf of St. Lawrence and adjacent waters. J. Fish. Res. Board Can. 29:1113-1118. Morris, R. W. 1956. Early larvae of four species of rockfish, Sebastodes. Calif. Fish Game 42:149-153. Moser, H. G., E. H. Ahlstrom, and E. M. Sandknop. 1977. Guide to the identification of scorpionfish larvae (Family Scorpaenidae) in the eastern Pacific with compara- tive notes on species of Sebastes and Helicolenus from other oceans. U.S. Dep. Commer., NOAATech. Rep. NMFS Circ. 402, 71 p. Moser, H. G., E. M. Sandknop, and D. A. Ambrose. 1985. Larvae and juveniles of aurora rockfish, Sebastes aurora, from off California and Baja California. In De- scriptions of early life history stages of selected fishes: the 3rd international symposium on the early life history of fishes and 8th annual larval conference, p. 55-64. Can. Tech. Rep. Fish. Aquat. Sci. 1359, 82 p. Neilson, J. D., G. H. Geen, and B. Chan. 1985. Variability in dimensions of salmonid otolith nuclei: implications for stock identification and microstructure interpretation. Fish. Bull. 83:81-89. Penney, R. W., and G. T. Evans. 1985. Growth histories of larval redfish {Sebastes spp. ) on an offshore Atlantic fishing bank determined by otolith incre- ment analysis. Can. J. Fish. Aquatic Sci. 42:1452-1464. Post uma. K. H. 1974. The nucleus of the herring otolith as a racial charac- ter. J. Cons. Cons. Int. Explor. Mer 35:121-129. Rybock, J. T., H. F. Horton, and J. L. Fessler. 1975. Use of otoliths to separate juvenile steelhead trout from juvenile rainbow trout. Fish. Bull. 73:654-659. Searle, S. R., F. M. Speed, and G. A Milliken. 1980. Population marginal means in the linear model: an alternative to least squares means. Am. Statistician 34:216-221. Seeb, L. W., and A. W. Kendall Jr. 1991. Allozyme polymorphism permit the identification of larval and juvenile rockfishes of the genus Sebastes. Environ. Biol. Fishes 30:191-201. Smith, M. K. 1992. Regional differences in otolith morphology of the deep slope red snapper Etelis carbunculus. Can. J. Fish. Aquat. Sci. 49:795-804. Stahl-Johnson, K. L. 1985. Descriptive characteristics of reared Sebastes caurinus and S. auriculatus larvae. In Descriptions of early life history stages of selected fishes: the 3rd interna- tional symposium on the early life history of fishes and 8th annual larval fish conference, p. 65-76. Can. Tech. Rep. Fish. Aquat. Sci. 1359. Stevenson, D. K., and S. E. Campana (eds.). 1992. Otolith microstructure examination and analysis. Can. Spec. Publ. Fish. Aquat. Sci. 117, 126 p. Victor, B. C. 1987. Growth, dispersal, and identification of planktonic labrid and pomacentrid reef-fish larvae in the eastern Pa- cific Ocean. Mar. Biol. 95:145-152. Wyllie Echeverria, T., W. H. Lenarz, and C. Reilly. 1990. Survey of the abundance and distribution of pelagic young-of-the-year rockfishes, Sebastes, off central California. U.S. Dep. Commer., NOAA NMFS Tech. Memo. NOAA-TM-NMFS-SWFC-147, 125 p. Changes in the spatial patchiness of Pacific mackerel. Scomber japonicus, larvae with increasing age and size Yasunobu Matsuura Instituto Oceanografico da Universidade de Sao Paulo Cidade Universitaria, Butantan, Sao Paulo 05508, Brasil Roger Hewitt Southwest Fisheries Science Center National Marine Fisheries Service, NOAA RO. Box 271, La Jolla, California 92038 terpreted in terms of species-spe- cific differences in life history traits such as adult reproductive behav- ior and larval feeding ecology, size, growth, and mortality (Smith, 1973; Hewitt, 1981; Koslow et al., 1985; McGurk, 1987). Insight into the function of patchiness may be im- proved by comparing how patchi- ness changes with age and size for species with different life histories. In this note, we present patchi- ness-at-age and patchiness-at-size curves for Pacific mackerel, Scom- ber japonicus, larvae and compare them with similar curves for other pelagic fish larvae. Several investigators have sug- gested that the spatial patchiness of fish eggs and larvae may be an important factor in the recruitment process (Smith, 1973; Lasker, 1978; Hewitt, 1981; Houde and Lovdal, 1985; McGurk, 1986). Patchiness has been linked to success in for- aging (Hewitt, 1981), ontogeny of schooling behavior (Hewitt, 1981), and predation mortality (McGurk, 1986, 1987). Contagion in the dis- persion of ichthyoplankton has been described for Pacific sardine, Sardinops sagax, eggs (Smith, 1973); northern anchovy, Engraulis mor- dax, and jack mackerel, Trachurus symmetricus, larvae (Hewitt, 1981); haddock, Melanogrammus aegle- finus, eggs (Koslow et al., 1985); sev- eral taxa found in Biscayne Bay including bay anchovy, Anchoa mitchilli, eggs and larvae (Houde and Lovdal, 1985); Atlantic herring, Clupea harengus harengus, larvae (Henri et al., 1985); Pacific herring, Clupea harengus pallasi, larvae (McGurk, 1987); bluefin tuna, Thun- nus maccoyii, larvae (Davis et al., 1990); Brazilian sardine, Sardinella brasiliensis, larvae; and scaled sar- dine, Harengula jaguana, larvae (Spach, 1990). The patchy distribution of fish eggs and larvae is initially intro- duced by the spawning behavior of adult fish. In order to guarantee successful fertilization in a pelagic environment, eggs must be laid when the adults are highly aggre- gated, and spawning and fertiliza- tion must occur almost simulta- neously (Hewitt, 1981). Alternately, demersal spawners may deposit their eggs in batches that incubate on a substrate before releasing a cohort of larvae into the pelagic environment (McGurk, 1987). Thereafter, eggs or hatching larvae, or both, disperse, principally in horizontal directions; distribution patterns during this period are pri- marily influenced by dispersal, dif- fusion, and transport (Smith, 1973). After a few days or weeks, larvae begin to reaggregate, an ac- tivity that becomes more evident in the juvenile stages of most school- ing pelagic fishes. Patchiness-at-age curves for sev- eral species of pelagic schooling fishes have been shown to exhibit a characteristic "U" shape: high initial patchiness, followed by a rapid decline as the eggs or newly hatched embryos, or both, passively disperse, followed by an increase in patchiness as the developing fish begin to aggregate in schools (Hewitt, 1981; McGurk, 1987; Spach, 1990). Patchiness-at-age curves for fish eggs and larvae have been in- Material and methods Data base The data used in this work came from the California Cooperative Oceanic Fisheries Investigations (CalCOFI) ichthyoplankton data base. These data are available from the CalCOFI on-line data system (Anon., 1988). Details of station and ichthyoplankton data were published in a series of CalCOFI ichthy- oplankton data reports (NOAA Tech. Memo., NMFS, SWFSC, numbers 70-88, 92-100, and 102-105). Size- specific catches of Pacific mackerel larvae, collected from 1953 through 1981, were extracted and summa- rized for the analyses reported here. Pacific mackerel larvae were col- lected with 1-m ring nets from 1953 through 1975 and with bongo nets thereafter. Sampling methods and laboratory procedures were de- scribed by Kramer et al. (1972). Out of 23,963 CalCOFI stations sam- pled from 1953 to 1981, plankton samples from 1,011 stations con- tained at least one Pacific mackerel larva. The 1,011 stations where larva were collected were assumed to define the Pacific mackerel's Manuscript accepted 15 June 1994. Fishery Bulletin 93:172-178 (1995). 172 NOTE Matsuura and Hewitt: Changes in the spatial patchiness of Scomber japonicus 173 habitat, and these stations comprised the data set used in the analyses. Size-frequency analysis Frequency distributions of larval catches by size were assembled and a negative binomial model was fit to each distribution. The negative binomial has been used to describe aggregated distributions of ichthyo- plankton (Hewitt, 1981; Zweifel and Smith, 1981; Smith and Hewitt, 1985). The model is specified by the mean (m) and the index of dispersion (k); the variance (o 2 ) is related to m and k as m + m Lloyd's (1967) index of patchiness (P) was used to describe the intensity of the distribution pattern at various larval sizes where P=l + m m The index has been used by several investigators to describe ichthyoplankton patchiness (Smith, 1973; Hewitt, 1981; Houde and Lovdal, 1985; McGurk, 1987) and may be considered as a measure of how many times more crowded an average individual is relative to an individual in a population with the same mean density, but one which is randomly dis- persed. The index is independent of density and the scale of sampling (Pielou, 1977; Hewitt, 1982) which allows comparisons of patchiness between relatively abundant yolk-sac larvae and less abundant older larvae. By substituting the expression for the vari- ance of the negative binomial, P=l + 1 — ' k where k was estimated by using a maximum likeli- hood estimate expression (Bliss and Fisher, 1953; Smith and Hewitt, 1985). The standard error of the sample estimate of patchiness was estimated by fol- lowing Lloyd (1967): se (P),±4 2 Vvar(&)> where var(&) is the sampling variance of k. Adjusting for shrinkage and converting to age Initial size measurements were obtained from lar- vae preserved in 5% buffered formalin. Preserved size was converted to live size by using the shrinkage rate obtained for jack mackerel larvae from Theilacker (1980). To convert from larval size to larval age, we used the growth curve obtained from laboratory reared larvae with water temperature ranging from 16.8 to 19.2°C (Hunter and Kimbrell, 1980): t = In {SLI 3.4432) 0.05968 where t = age in days since hatching (= age), and SL = standard length in live size (mm). The incuba- tion period (from spawn to hatch) was assumed to be 2.3 days. Results and discussion Frequency distributions of larval catches by size are presented in Table 1. The corresponding live sizes, ages, mean abundances per tow, and patchiness pa- rameters are also presented in Table 1. Larvae less than 3.5 mm in length appear to be undersampled in comparison to larger sizes. Pacific mackerel lar- vae grow rapidly through the first two size classes and therefore are vulnerable to capture for a rela- tively short period of time; small larvae are also more likely to be extruded through the meshes of the sam- pling net (Smith and Richardson, 1977). The change in patchiness with age suggests that re- cently hatched Pacific mackerel larvae were highly aggregated and dispersed rapidly until approximately five days after spawning (Fig. 1). Patchiness gradually increased with age until 9.2 days, then decreased slightly and continued to increase with age thereafter. Morphological and behavioral changes of develop- ing Pacific mackerel larvae are summarized in Table 2 and illustrated in Figure 2. Afunctional visual sen- sory organ is formed in Pacific mackerel larvae at 6.0-6.5 mm and completed at approximately 8 mm. 1 Although caudal and pectoral fins begin development at 3.5 mm, swimming speed increases rapidly with size only after the pelvic, anal, and dorsal fins are formed at approximately 9.6 mm (Watanabe, 1970; Hunter and Kimbrell, 1980). Hunter and Kimbrell (1980) reported that schooling behavior did not be- gin until 14 mm, although an increase in patchiness at 4.6 mm is apparent from the plankton catches. It may be that the ontogeny of schooling behavior in Pacific mackerel involves a prolonged period of con- tact between larvae that is necessary for the success- ful integration of approach- withdraw and approach- orient behaviors (Shaw, 1960, 1970; Williams and Shaw, 1971). This phenomenon may be statistically recognizable as an increase in patchiness but not visually recognizable as coordinated social behavior. 1 O'Connell, C. Southwest Fisheries Science Center, Nat. Mar. Fish. Serv., NOAA, P.O. Box 271, La Jolla, California. 174 Fishery Bulletin 93(1). 1995 Table 1 Size-specific catch statistics for Scomber japonicus larvae collected during CalCOFI surveys from 1953 through 1981. \ total of 8,396 larvae were caught at 1,011 stations out of a total of 23,963 CalCOFI stations Preserved size (mm Live size (mm) Catch Age since spawn (days) 2.00 2.50 3.00 3.50 4.00 4.50 5.00 5.75 6.75 7.75 8.75 9.75 3.10 3.30 3.50 4.00 4.60 5.20 5.70 6.50 7.70 8.50 9.60 10.70 2.3 3.0 3.3 5.0 7.2 9.2 10.7 13.0 15.7 17.5 19.5 21.3 Number of larvae/sample 825 671 571 698 774 806 849 836 908 970 980 995 1 93 149 195 143 112 113 90 99 80 26 28 13 2 34 66 81 63 56 35 34 39 9 10 2 2 3-4 28 42 70 52 36 29 23 17 5 3 1 1 5-8 18 31 42 29 18 16 11 15 6 2 9-16 5 30 27 15 11 8 3 4 2 17-32 4 15 14 10 2 2 1 1 1 33-64 3 4 5 1 1 2 65-128 1 2 4 1 129-256 1 2 Total larvae 709 1,823 2,334 1,088 762 762 350 400 193 67 36 21 Number of samples 1,011 1,011 1,011 1,011 1,011 1,011 1,011 1,011 1,011 1,011 1,011 1,011 Mean per sample 0.701 1.803 2.309 1.076 0.754 0.754 0.346 0.396 0.191 0.066 0.036 0.021 Variance 13.101 67.540 97.629 10.823 13.885 7.421 1.415 1.936 0.933 0.155 0.050 0.036 k 0.092 0.152 0.209 0.189 0.140 0.102 0.139 0.139 0.097 0.048 0.106 0.030 Patchiness 11.91 7.57 5.79 6.30 8.15 10.76 8.21 8.19 11.33 21.98 10.42 34.28 SE (patchiness) 1.09 0.48 0.32 0.44 0.67 0.94 0.91 0.86 1.71 18.42 4.54 39.78 70 60 50 in » 40 c 1 30 0- : l / i 20 10 %*r~^Z^ i / A rrachurus symmetricus icomber japonicus — e— . -^^^ ^B^_^___-*--- _ ( > 5 10 15 20 25 30 35 4 Time since spawn (days) Figure 1 Lloyd's index of patchiness as a function of larval age for Scomber japonicus and Trachurus symmetricus in the California Current region. NOTE Matsuura and Hewitt: Changes in the spatial patchiness of Scomber japonicus 75 5.7mm 8.5mm 18.1mm Figure 2 Developmental stages of Scomber japonicus larvae (from Matarese et al. 1989). Sizes shown are estimated live sizes. Table 2 Behavioral and morphological changes in developing Scomber japonicus larvae. Measurements Live size 3.1 3.3 3.5 4.0 4.6 5.2 5.7 6.5 7.7 8.5 9.6 10.7 11.8 12.9 14.0 15.1 16.2 17.3 Swimming speed (cm/sec)' 0.4 0.6 0.7 0.9 1.0 1.3 1.8 2.1 2.6 3.1 3.7 4.4 5.0 5.7 6.5 7.3 Cannibalism' Schooling' Patchiness sibling cannibalism between 8 and 15 mm oriented 11.9 7.6 5.8 6.3 8.2 10.8 8.2 8.2 11.3 22.0 10.4 34.3 swimming Feeding ability 2 Mouth opening and yolk absorption at 4 mm Fin formation 2 CF, PF at 3.5 mm PvF, AF, DF at 9.6 mm Visual sensory organ 3 developed between 6.5 and 7.7 mm 1 Hunter and Kimbrell (1980). 2 Watanabe (1970); CF = caudal fin, PF = pectoral fin, PvF = pelvic fin, AF = anal fin, DF = dorsal fin. 3 O'Connell (unpub. data). 176 Fishery Bulletin 93(1). 1995 Patchiness-at-age curves for six species (Engraulis mordax and Trachurus symmetricus, Hewitt, 1981; Clupea harengus pallasi, McGurk, 1987; Sardinella brasiliensis and Harengula jaguana, Spach, 1990; and Scomber japonicus, reported here) describe a similar sequence: a high index is observed at the youngest larval ages, a low index is observed at one or two weeks after spawn, and thereafter the index increases suggesting the onset of schooling behavior (Fig. 3). The highest index of patchiness at early lar- val age was observed for S. brasiliensis (P=14.5). This can be attributed to intensive spawning behavior of adult sardine, short incubation time (Matsuura, 1983), and fast larval growth (Yoneda, 1987) rela- tive to the other species. The lowest index of patchi- ness was observed for C. harengus pallasi (P=3.5) collected in a small inlet on the west coast of Vancouver Island, British Columbia; McGurk (1987) noted that this may be a reflection-dispersed prey. Houde and Lovdal (1985) reported that fish larvae in Biscayne Bay, Florida, were only slightly more patchy (P=1.3) than their prey, which was abundant and not aggregated (P=1.06). Henri et al. (1985) also Time since spawn (days) Figure 3 Patchiness-at-age curves for three species from the California Current (Engraulis mordax, Trachurus symmetricus, and Scomber japonicus), two species from southern Brazil (Sardinella brasiliensis and Harengula jaguana), and one species from British Columbia (Clupea harengus pallasi). reported low patchiness values (P=1.63-3.52) for Clupea harengus harengus larvae collected in the St. Lawrence estuary, Quebec. Hewitt (1981) discussed differences in patchiness-at-age curves forE. mordax and T. symmetricus in terms of their prey availabil- ity and foraging strategies. In contrast to T. sym- metricus, E. mordax exhibited an initial high degree of patchiness and slowly dispersed before showing a rapid increase in patchiness at about 18 days of age. Trachurus symmetricus larvae were approximately 1/10 as abundant, exhibited lower initial patchiness, and achieved maximum dispersion at an earlier age. E. mordax depend on small, but abundant, prey; they have poorly developed swimming capabilities and can effectively forage only through a small volume of water. In contrast, T. symmetricus depend on large, but rare, prey items; they have well-developed swim- ming capabilities and are able to search through rela- tively large volumes of water. In comparison to the four clupeoid species, the in- crease in patchiness was observed to occur at an early age for both S. japonicus and T. symmetricus. Scom- ber japonicus and T. symmetricus larvae share simi- lar morphologies and life his- tory traits. Hunter and Kimbrell (1980) noted that Pacific mackerel larvae may be characterized as having fast growth, rapid swimming abilities, high metabolism, a dependence on increasingly larger prey, and a tendency for cannibalism. Sibling can- nibalism may be an impor- tant survival strategy for mackerel larvae, where larger individuals prey on smaller ones. Grave (1981) reported that by the time Atlantic mackerel, Scomber scombrus, larvae were 12 mm long, 83% of the food items in their diet were other mack- erel larvae. High initial dis- persal, followed by aggrega- tion of similar-sized larvae may be mechanisms for re- ducing sibling cannibalism. Although the patchiness-at- age curves for S. japonicus and T. symmetricus are dis- tinct (Fig. 1), the patchiness- at-size curves are almost co- incident (Fig. 4), suggesting that change in patchiness Scomber japonicus Trachurus symmetricus Engraulus mordax Clupea harengus pallasi Sardinella brasiliensis Harengula jaguana NOTE Matsuura and Hewitt: Changes in the spatial patchiness of Scomber japonicus 77 may be a size-dependent phenomenon!. Acknowledgments The senior author received a research fellowship from the Coordenacao de Aperfei- coamento de Pessoal de m'vel Superior (CAPES) dur- ing his stay at the Southwest Fisheries Science Center in La Jolla, where this publi- cation was prepared. This study, like many others on the ecology offish larvae in the California Current, was inspired and encouraged by the late Reuben Lasker. 60 50 Cfl 40 e 30 20 10 -Sb^- 5 **^ J > — e — Scomber japonicus Trachurus symmetricus \ N ^^***i*^ _L 2 3 4 5 6 7 8 9 10 11 12 Live size (mm) Figure 4 Lloyd's index of patchiness as a function of larval size for Scomber japonicus and Trachurus symmetricus. Literature cited Anon. 1988. CalCOFI on-line data system, user's manual. NOAA, SWFSC, La Jolla, p. 1-9. Bliss, C. I., and R. A. Fisher. 1953. Fitting the negative binomial to biological data and a note on the efficient fitting of the negative binomial. Biometrics 9:176-200. Davis, T. L. O., G. P. Jenkins, and J. W. Young. 1990. Patterns of horizontal distribution of the larvae of southern bluefin (Thunnus maccoyii) and other tuna in the Indian Ocean. J. Plankton Res. 12(6):1295-1314. Grave, H. 1981. Food and feeding of mackerel larvae and early juve- niles in the North Sea. Rapp. P.-V. Reun. Cons. Int. Explor. Mer 178:454-459. Henri, M., J. J. Dodson, and H. Powles. 1985. Spatial configurations of young herring iClupea harengus harengus) larvae in the St. Lawrence estuary: importance of biological and physical factors. Can. J. Fish. Aquat. Sci. 42 (Suppl. 1):91-104. Hewitt, R. P. 1981. The value of pattern in the distribution of young fish. Rapp. P.-V. Reun. Cons. Int. Explor. Mer 178:229-236. 1982. Spatial pattern and survival of anchovy larvae: impli- cations of adult reproductive strategy. Ph.D. diss., Scripps Institution of Oceanography, Univ. Calif., San Diego. Houde, E. 1).. and J. D. A. Lovdal. 1985. Patterns of variability in ichthyoplankton occurrence and abundance in Biscayne Bay, Florida. Estuarine Coastal Shelf Sci. 20:79-103. Hunter, J. R., and C. A. Kimbrell. 1980. Early life history of Pacific mackerel, Scomber japonicus. Fish. Bull. 78:89-101. Koslow, J. A., S. Brault, J. Dugas, and F. Page. 1985. Anatomy of an apparent year class failure: the early life history of the Browns Bank haddock Melanogrammus aeglefinus. Trans. Am. Fish. Soc. 114:478-489. Kramer, D., M. Kalin, E. Stevens, J. Thrailkill, and J. Zweifel. 1972. Collecting and processing data on fish eggs and lar- vae in the California Current region. U.S. Dep. Commer., NOAA Tech. Rep. NMFS Circ. 370:1-38. Lasker, R. 1978. The relation between oceanographic conditions and larval anchovy food in the California current: identifica- tion of factors contributing to recruitment failure. Rapp. P.-V Reun. Cons. Int. Explor. Mer 173:212-230. Lloyd, M. 1967. Mean crowding. J. Anim.Ecol. 36:1-30. Matarese, A. C, A. W. Kendall Jr., D. M. Blood, and B. M. Vinter. 1989. Laboratory guide to early life history stages of north- east Pacific fishes. U.S. Dep. Commer., NOAA Tech. Rep. NMFS 80, 652 p. Matsuura, Y. 1983. Estudo comparativo das fases iniciais do ciclo de vida da sardinha-verdadeira, Sardinella brasiliensis, e da sardinha-cascuda. Harengula jaguana , (Pisces: Clupeidae) e nota sobre a dinamica da populacao da sardinha-verda- deira na regiao sudeste do Brasil. Assoc. Professorship thesis, Univ. Sao Paulo. McGurk, M. D. 1986. Natural mortality of marine pelagic fish eggs and larvae: role of spatial patchiness. Mar. Ecol. Prog. Ser. 34: 227-242. 1987. The spatial patchiness of Pacific herring larvae. Environ. Biol. Fish. 20(21:81-89. Pielou, E. C. 1977. Mathematical ecology. J. Wiley and Sons, New York, 385 p. Shaw, E. 1960. The development of schooling behavior in fishes. Physiol. Zoo. 33(2):79-86. 1970. Schooling in fishes: critique and review. In L. R. Aronson et al. (ed.), Development and evolution of behav- ior: essays in memory of T. C. Schneirla, p. 452^180. Free- man, San Francisco. 178 Fishery Bulletin 93(1). 1995 Smith, P. E. 1973. The mortality and dispersal of sardine eggs and larvae. Rapp. P.-V. Reun. Cons. Int. Perm. Explor. Mer 164: 282-292. Smith, P. E., and S. L. Richardson. 1977. Standard techniques for pelagic fish egg and larva surveys. FAO Fish. Tech. Pap. 175, 100 p. Smith, P. E., and R. P. Hewitt. 1985. Anchovy egg dispersal and mortality as inferred from close-internal observations. CalCOFI Rep. 26:97-110. Spach, H. L. 1990. Estudo comparativo da distribuicao espaco-temporal e de padroes de agregacao de ovos e larvas de Harengula jaguana, Sardinella brasiliensis (Clupeidae: Osteichthyes) eEngraulis anchoita (Engraulidae: Osteiththyes) na costa sudeste do Brasil. Ph. D. diss., Univ. Sao Paulo. Theilacker, G. H. 1980. Changes in body measurements of larval northern anchovy, Engraulis mordax, and other fishes due to han- dling and preservation. Fish. Bull. 78:685-692. Watanabe, T. 1970. Morphology and ecology of early stages of lfe in Japa- nese common mackerel, Scomber japonicus Houttuyn, with special reference to fluctuation of population. Bull. Tokai Reg. Fish. Res. Lab. 62:1-283. Williams, M. M ., and E. Shaw. 1971. Modifiability of schooling behavior of fishes: the role of early experience. Am. Mus. Novit. 2448:1-18. Yoneda, N. T. 1987. Criacao em laboraterio de larvas da sardinha-verda- deira, Sardinella brasiliensis e estudo dos incrementos diarios nos otolites. M.S. thesis, Univ. Sao Paulo. Zweifel, J. R., and P. E. Smith. 1981. Estimates of abundance and mortality of larval an- chovies (1951-75): application of a new method. Rapp. P.-V. Reun. Cons. Int. Explor. Mer 178:248-259. Growth and morphology of larval and juvenile captive bred yellowtail snapper, Ocyurus chrysurus* Cecilia M. Riley G. Joan Holt Connie R. Arnold Marine Science Institute The University of Texas at Austin RO. Box 1267, Port Aransas, Texas 78373 The snappers (Lutjanidae) are ma- jor components of the reef fish fish- ery in the Gulf of Mexico (Naka- mura, 1976), and recent declines in their populations have prompted interest in a number of manage- ment practices including limited catches, size limits, area closures, and additions of artificial reef habi- tat to improve survival of wild stocks (Leis, 1987; Munro, 1987). Studies on the spawning, distribu- tion, larval and juvenile ecology, and stock assessment of new re- cruits are crucial to the develop- ment of management strategies for reef species since little is known about their early life history (Grimes, 1987). During most devel- opmental stages, snapper larvae are pelagic and widely dispersed, limiting the numbers of specimens to be found in taxonomic collections (Munro, 1987). The similarity in size and pigmentation of small lar- val lutjanids (<5 mm) and the pau- city of species-specific details of size at age and morphological develop- ment has made identification of in- dividuals in ichthyoplankton samples difficult (Leis, 1987). Of the fourteen species of snappers that are found in the Gulf of Mexico, 1 larval development has been fully described for only three species: red snapper, Lutjanus campechanus , from both laboratory spawned (Rabalais et al., 1980) and wild caught larvae (Collins et al., 1980); gray snapper, L. griseus, from wild eggs reared in the labora- tory (Richards and Saksena, 1980); and vermilion snapper, Rhomboplites aurorubens, from wild preserved specimens (Laroche, 1977). A recent NOAA report by Richards et al. 2 summarizes the larval lutjanid de- scriptions listed above and intro- duces some newly available descrip- tive material for several additional species of snappers including some stages of yellowtail snapper, Ocyurus chrysurus. In their report, the yellow- tail snapper is included in the genus Lutjanus, a change suggested as a result of two recent treatments by Loftus ( 1992) and Domeier and Clark (1992). The commercial and recreational importance of snappers has also been recognized by the aquaculture industry, and efforts are underway to culture several of these species in captivity. In this paper we de- scribe the development and growth of laboratory spawned and reared yellowtail snapper. This species is found from Massachusetts through the Caribbean and south to Brazil (Hoese and Moore, 1977). Labora- tory culture allowed us to document growth and development of the critical larval and juvenile stages of yellowtail snapper that will aid identification and ageing of larval snappers collected in the field. We have also included information on the effects of a commonly used pre- servative (ethyl alcohol) on length measurements and pigmentation characteristics of laboratory-cul- tured larvae for purposes of compara- tive use with wild-collected larvae. Materials and methods Young adult Ocyurus chrysurus were collected by hook and line in July 1990 from the Florida Keys and were transported to the laboratory where they were matured and cycled for one year following the methods described by Arnold (1988). Adults began spawning in July 1991 and contin- ued to March 1994. Eggs were stocked at a density of 50/L in fiberglass tanks (300 and 600 L) with internal biofilters. Lar- vae were reared at 27-28°C with 12 hours light at salinities of 33-38 ppt on a diet of zooplankton (col- lected from the Corpus Christi Ship Channel), rotifers (Branchionus plicatilis) and brine shrimp nauplii (Artemia salina). The description of larval devel- opment is based on larvae from multiple spawns of two different groups of broodstock (15 adults/ tank). Larvae were measured live (SL=tip of snout to posterior tip of notochord) to the nearest 0.01 mm on a stereomicroscope equipped with a drawing tube and digitizing * Contribution 907 of the Marine Science Institute, University of Texas at Austin. 1 Lyczkowski-Shultz, J., and B. H. Comyns. 1992. Early life history of snappers in coastal and shelf waters of the northcentral Gulf of Mexico (late summer/ fall months, 1983-1989). Final Rep. to MARFIN, NA90AA-H-MF730. 2 Richards, W. J., K. C. Lindeman, J. L. Shultz, J. M. Leis, A. Ropke, M. E. Clark, and B. H. Comyns. 1994. Preliminary guide to the identification of the early life history stages of lutjanid fishes of the western central Atlantic. U.S. Dep. Commer., NOAA Tech. Memo. NMFS- SEFSC-345, 49 p. Manuscript accepted 29 August 1994. Fishery Bulletin 93:179-185 (1995). 179 180 Fishery Bulletin 93(1). 1995 pad. Drawings were made with a dissecting scope and camera lucida attachment of live, anesthetized larvae before they were preserved in 80% ethyl alco- hol (ETOH). To determine laboratory shrinkage rates, the larvae were remeasured after at least one month in ETOH, and preserved lengths were com- pared to those of the previous, live measurements. Since larvae were drawn from living specimens, no staining or special preparations were required for observation of spines, rays, or other details of morphology. Results Pigmentation and overall development Daily measurements and developmental milestones are presented in Table 1. The pelagic eggs were spherical, averaged 0.96 mm diameter, had a single oil globule, and hatched in 22-24 hours at 27°C. Eggs were essentially transparent, the only pigment ob- served was a series of small chromatophores on the dorsal surface of the embryo (Fig. 1A). After hatch- Figure 1 Early developmental stages of yellowtail snapper, Ocyurus chrysurus, illustrated from live specimens. (A) late embryo egg, 0.96 mm diameter; (B) 2.23 mm SL newly hatched larva; (C) 3.36 mm, 3 days posthatch. Dark arrows indicate location of yel- low chromatophore. ing and through the two day yolk-sac stage, larvae possessed a single unpigmented oil globule in the anterior end of the yolk-sac, an unpigmented finfold, and 24 myomeres. Within 12 hours after hatching (Fig. IB), the dorsal chromatophores of the embryo had migrated to form a series along the ventral sur- face of the body and tail; a single stellate chromato- phore was present on the gut anterior to the anus, and a light scattering of dark pigment was found on the yolk-sac and lateral surfaces of the head. Exog- enous feeding coincided with development of eye pig- mentation, functional jaws, and gas bladder infla- tion at 3.36 mm (age 3 days, Fig. 1C). Pigmentation at this stage included a large dark chromatophore on the ventral surface of the gut, four chromatophores over the dorsal surface of the gut and gas bladder, and a single, dark chromatophore on the ventral tip of the notochord. In live specimens at this stage, we first observed the development of a yellow chromato- phore (indicated by arrow on Fig. 1C) located on the lateral surface of the body at about midgut. Larvae 3.67-3.82 mm (Fig. 2A) showed dramatic develop- mental changes. The development of numerous yel- low chromatophores (indicated on illustrations by solid arrows) scattered on the lateral surfaces of the head, gut, and upper body near the base of the pectoral fin, as well as dark stellate chro- matophores on the hindbrain and on the ven- tral edge of the cleithrum coincided with erup- tion of the pelvic fin buds and the appearance of preopercular spination. Larvae 4. 10^.53 mm (Fig. 2, B-D) were characterized by daily in- creases in the number of dorsal spines and by elongation of the pelvic fins, as well as by an increase in the density of yellow chromato- phores on the lateral head region. Notochord flexion occurred when larvae reached 4.40 mm at 15-16 days posthatch (Fig. 3A) and was fol- lowed by full fin formation. Changes in pigmen- tation consisted primarily of increasingly dense concentrations of yellow pigment on the lateral upper body and head, dark web-like pigment in the membranes of developing fins, and dif- fuse internal pigment over the gut surface (Fig. 3B). The first indication of adult coloration was visible on early juveniles approximately 14.00 mm SL (Fig. 3C) where yellow chromatophores formed a horizontal line through the eye onto the snout and were also interspersed with the dark chro- matophores lining the dorsal and ventral mar- gins of the body at the fin bases. Yellow pigment was also present along the lateral midline of the tail. Near-adult pigmentation was present by 16.00 mm (age 62 days) at which time juveniles were fully scaled (Fig. 3D). NOTE Riley et al. : Growth and morphology of captive Ocyurus chrysurus Figure 2 Developmental stages and mean live lengths of yellowtail snapper. Dark arrows indi- cate location of yellow chromatophores. (A) 3.67-3.82 mm SL, days 7-9 posthatch; (B) 4.10-4.53 mm SL, days 10-11 posthatch; (C) 4.51 mm SL, day 12 posthatch; (D) 4.11 mm SL, day 13 posthatch. Head spination One or two paired, smooth spines on the posterior edge of the preoperculum first occurred in larvae 3.67-3.82 mm (Fig. 2A). Preopercular spination in- creased to four and a supraocular ridge with one spine was present at 4.10 mm (Fig. 2B). At 4.50 mm (Fig. 2C), 5 or 6 elongated preopercular spines were present, the longest of which occurred at the preopercal angle. Larvae at 4.80 mm and 16 days of age (Fig. 3A) had a fully formed supraocular ridge with 4 short, smooth spines and 3 supracleithral spines. A reduction in the length of all head spines began at approximately 6.00 mm, but some short, opercular spines remained on the oldest juveniles. Fin formation The adult meristic complement of O. chrysurus is X+12-14 dorsal, 9 + 8 caudal, I + 5 pelvic, III + 8-9 anal, and 15 or 16 pectoral (Hoese and Moore, 1977). In laboratory-reared larvae, fin development oc- 182 Fishery Bulletin 93(1). 1995 curred in the following sequence: pel- vic and dorsal spines, caudal, dorsal and anal soft rays, pectoral rays (Table 1). The spinous pelvic and dorsal fin for- mation occurred simultaneously at 4. 10 mm. Dorsal and anal fin analage were first visible at 4.51 mm and ray bases were fully formed by 5.35 mm. Caudal flexion and caudal ray formation oc- curred in larvae between 4.40 and 4.75 mm and was followed by development of the soft rays of the dorsal and anal fins (Fig. 3A); additionally, the spines of the dorsal and pelvic fins were strongly serrated. By 6.23 mm SL, all juveniles had the full adult complement of fin spines and rays (Fig. 3B); however, serrated spines, characteristic of larvae, were still present on juveniles 14.66 mm. Growth and shrinkage Laboratory-reared yellowtail snapper showed large variation in size among larvae of the same age (Table 1), and key developmental events were tightly linked to larval size more than to age. Growth rates prior to flexion averaged 0.31 mm/day and decreased to only 0.18 mm/day during the process of transfor- mation to juveniles (4.83-7.00 mm SL, ages 14-28 days). During the last month and a half of recorded development, ju- venile growth averaged 0.25 mm/day. Mean daily lengths of postpreser- vation larvae are listed on Table 1. Shrinkage after preservation was great- est in larvae prior to any fin develop- ment (<4.00 mm), averaging 10.36% through the first 13 days. Larvae with partial fin development (4.83-5.72 mm SL) shrank an average of 9.32%. Once larvae attained complete development of the dorsal and pelvic fins (>5.00 mm); shrinkage was reduced to an average of 7.24% throughout the remaining ju- venile stages examined. Figure 3 Late developmental stages and mean lengths of yellowtail snapper. Dark arrows indicate location of yellow chromatophores. (A) 4.64-4.80 mm SL, days 15-16; (B) 6.23-6.73 mm SL, days 18-28; (C) 14.66 mm SL, day 31, drawn from preserved specimen; (D) 16.05 mm SL, day 62, from preserved specimen. Discussion Ocyurus chrysurus have similar larval characteris- tics to the previously described snappers Lutjanus campechanus (Collins et al., 1980), L. griseus (Richards and Saksena, 1980), and Rhomboplites aurorubens (Laroche, 1977). Preflexion larvae of each of the four species have a series of chromatophores along the ventral midline and have pigment cover- ing the dorsum of the gut and gas bladder. All have NOTE Riley et al.: Growth and morphology of captive Ocyurus chrysurus 183 a CO co ►J do c cd co c 3 * 72 co S co ~ CO •- - cu 2 -° I | "8 c ° ii u C co TJ * — CO w •c « •o & c to co c CO II " NH to z CO a> Pm T3 „ £co I j DO cu cu I* 3 X J= J= J3 X J3 -C X X J2 J3 X X J= i bo bo 00 bo bo bo bo bo bo bo bo bo bo bn X 1 CO co CO CO CO CO CO a CO co 00 CO cd crt cu u u frH u ki L. u fc. u u u ■*-» -u +1 -*-> -*-> -t-> -4J +-> CO CO CO CO CO CO CO CO CO CO to m CO CO CO >> en o o O O O O O o O o o o o o o OS « c a - cd a x cd CO cd o. DO Q DO d a 3 M cd CD 3 o o o o o o o o o o o d 05 d CM o CO 05 05 Si q CM X CN CM d o o LO CO 05 O CO CM t-H rt ,-H CO co co re ct; it in d CO CO 00 CO X CO ~ - — j ~. ~ > o: ~ r z ~ 000000000000505050)050! OOOOOCOCOCOCOCOCO o o o o o O O O CO CO CO LO lo LO CO CO CO I CO Tf 05 CO o t- LO CM CN d d CN 05 co CO co CN CM X CO co CO CO t-H o CO CO CO CO CN 00 CN CO LO LO CN CO o o o o o o o o •- 1 ^ T-H CO CO C~ c~ o 05 LO CO CO CO LO o LO 05 r-i la - CO CO o CO i-H LO LO CO d d 05 LO LO r-4 LO d 05 CO co i— i 0- CO o oc CN CN d CO CN CO t-< O) CO d CO CM CO co i-i CM CO •-< CO o CO CM CD LO CM 05 CO CO CN o CM CO CM It CO ■M O O X ■z ,_, CM CO ■* LO CO C~ co 2 l X CO co CM 05 CM CN CO •<* oo CO CO CO T-H LO o CN LO CD LO co -* co 00 CM CO CO CO r~ co CO CO Tj- It It t LO LO LO LO LO CD C~ CO 05 ■* t~ N CM CO CO 00 LO It 05 LO CO CO o LO LO 05 o 00 o o CO T-H CO X CO o X X CO CO CO CO CO CO CO CO CO CO CO CO LO rt LO LO t» ^r 184 Fishery Bulletin 93(1). 1995 large solitary chromatophores on the cleithral sym- physis, gut ventrum, anus, and on the notochord at the point of flexure, and all undergo flexion within a narrow size range of 4.2-5.2 mm SL. There are, however, a few distinctive characteris- tics that can be used to separate the larvae of these species. Immediately following flexion at 4.40 mm, larvae of O. chrysurus andi?. aurorubens (flexion at 4.7 mm, Laroche, 1977) possess large serrations on both the anterior and posterior margins of the dor- sal spines, but these are not present on larvae of L. campechanus (Collins et al., 1980) or L. griseus (Richards and Saksena, 1980). Preopercular spina- tion is also a useful character in that the longest spine (located at the preopercle angle in each described species) is serrated in R. aurorubens but not in L. campechanus, L. griseus (Laroche, 1977), or O. chrysurus (present study). Lyczkowski-Shultz and Comyns 1 compared small, preserved larval R. aurorubens and L. campechanus , and found that both species had two dorsal spines and 4 or 5 preopercular spines at 3.3 to 3.9 mm SL. Yellowtail snapper differ in having fewer or no dorsal spines and only three preopercular spines at the same preserved sizes (cor- responding to days 7-11, Fig. 2, Aand B). Lyczkowski- Shultz and Comyns 1 also examined pigmentation differences in <4.0 mm larvae and identified a char- acteristic pigment spot in R. aurorubens located on the branchial chamber and visible through the oper- culum; they also observed pigment on the anterior surface of the gut (at the level of the pectoral fin base) inL. campechanus. Larval O. chrysurus of the same size range were devoid of pigment in either of these locations. Larval R. aurorubens (Laroche, 1977) had numerous, dark chromatophores located on both the midbrain and hindbrain regions in all sizes of larvae examined, however, the two species of Lutjanus and O. chrysurus had head pigment only on the hindbrain area. The yellow chromatophores found on live or recently preserved specimens of O. chrysurus are definitive characteristics for identification of this species; unfortunately, this light-colored pigment was not visible after the 30-day preservation period in larvae <7.00 mm SL and would not likely be detected in ichthyoplankton samples preserved in ETOH. The yellow chromatophores were faintly visible on the snout, operculum, and lateral line of the larger pre- served individuals. Larval O. chrysurus can be dis- tinguished from the other described lutjanid species by utilizing combinations of the above characteris- tics including the presence of heavy serrations on both the anterior and posterior margins of the dor- sal spines at the time of flexion, lack of serrations on the longest preopercle spine, reduced number of preopercle spines and dorsal spines at comparable sizes, and lack of internal pigment on the anterior surface of the gut or branchial chamber. Newly hatched and early developmental stages of larval fishes are rarely collected or retained in net samples. 3 Those larvae that are collected show sig- nificant handling effects (Theilacker, 1980; Hay, 1981; McGurk, 1985), including distortion and size reduc- tion that result in less than optimal depictions of size at critical stages of development. In contrast, labo- ratory-reared specimens provide more realistic size values and information on age and pigmentation not available to studies with field-caught larvae. The shrinkage rates at each age and phase of morpho- logical development in O. chrysurus are conserva- tive measures because field-collected larvae show additional shrinkage from net damage. In small unossified larvae, reduction in SL as a result of net collection alone increased shrinkage rates of labora- tory-preserved northern anchovy by 19% (Theilacker, 1980) and in Pacific herring by about 8% (Hay, 1981). From these results it is clear that some additional allowance for net shrinkage should be applied to the laboratory-preserved lengths of O. chrysurus when compared to those of field-caught individuals; how- ever, shrinkage rates may be variable between spe- cies; therefore the value to be used is unclear. Shrink- age rates have been shown to decrease with increas- ing age and size of larvae (Theilacker, 1980; McGurk, 1985) and to become equivalent to that of larvae ex- posed to laboratory handling only (e.g. no net dam- age) once larvae are completely ossified. Shrinkage rates of laboratory O. chrysurus also decreased in postflexion larvae, stabilizing at <10% in early juve- niles. Therefore, to make predictions regarding the live size or age of field-collected larval snappers, an additional, though unknown, rate of shrinkage due to net damage should be taken into account in preflexion stages but not in postlarvae and juveniles. The nomenclatural status of the yellowtail snap- per has come under review recently. After describing the morphology of the natural hybrid between O. chrysurus and Lutjanus synagris (Loftus, 1992) and the laboratory-produced hybrids of O. chrysurus and L. synagris (Domeier and Clarke, 1992), the authors of these studies concluded that the morphological and meristic data indicated that Ocyurus is probably not a distinct genus from Lutjanus. The larval morphol- ogy described in this study of O. chrysurus also con- firms the very similar size and developmental char- acteristics of this species with the previously de- scribed members of the genus Lutjanus. 3 Lyczkowski-Shultz, J. Southeast Fish. Sci. Cent. NOAA, NMFS, Pascagoula, MS. Personal commun., Jan. 1994. NOTE Riley et al.: Growth and morphology of captive Ocyurus chrysurus 185 Acknowledgments We would like to thank Joanne Lyczkowski-Shultz and Scott Holt for their comments and suggestions on the original draft of this manuscript. This work was funded in part by Grant NA16RGO457-03 from the National Oceanic and Atmospheric Administra- tion through the Texas Sea Grant College Program. Literature cited Arnold, C. R. 1988. Controlled year-round spawning of red drum Sciaenops ocellatus in captivity. Contrib. Mar. Sci. (Suppl.) 30:65-70. Collins, L. A., J. H. Finucane, and L. E. Barger. 1980. Description of larval and juvenile red snapper, Lutjanus campechanus. Fish. Bull. 77:965-974. Domeier, M. L., and M. E. Clark. 1992. A laboratory produced hybrid between Lutjanus synagris and Ocyurus chrysurus and a probable hybrid between L. griseus and O. chrysurus (Perciformes: Lutjanidae). Bull. Mar. Sci. 50:501-507. Grimes, C. B. 1987. Reproductive biology of the Lutjanidae: a review. In J. Polovina and S. Ralston (eds.), Tropical snappers and groupers: biology and fisheries management, p. 230- 294. Westview Press, Boulder, Colorado. Hay, D. E. 1981. Effects of capture and fixation on gut contents and body size of Pacific herring larvae. Rapp. P.-V. Reun. Cons. Int. Explor. Mer 178:395-400. Hoese, H. D., and R. H. Moore. 1977. Fishes of the Gulf of Mexico, Texas, Louisiana, and adja- cent waters. Texas A&M Univ. Press, College Station, 327 p. Laroche, W. A. 1977. Description of larval and early juvenile vermilion snap- per, Rhomboplites aurorubens. Fish. Bull. 75:547-554. Leis, J. M. 1987. Review of the early life history of tropical groupers (Serranidae) and snappers (Lutjanidae). In J. Polovina and S. Ralston (eds.), Tropical snappers and groupers: bi- ology and fisheries management, p. 189-237. Westview Press, Boulder, CO. Loft us, W. F. 1992. Lutjanus ambiguus (Poey), a natural intergeneric hybrid of Ocyurus chrysurus (Bloch) and Lutjanus synagris (Linnaeus). Bull. Mar. Sci. 50:489-499. McGurk, M. D. 1985. Effects of net capture on the postpreservation mor- phometry, dry weight, and condition factor of Pacific her- ring larvae. Trans. Am. Fish. Soc. 114:348-355. Munro, J. L. 1987. Workshop synthesis and directions for future research. In J. Polovina and S. Ralston (eds), Tropical snappers and groupers: biology and fisheries management, p. 639-659. Westview Press, Boulder, Colorado. Nakamura, F. I. 1976. Recreational fisheries for snappers and groupers in the Gulf of Mexico. In H. R. Bullis Jr. and A. C. Jones (eds.), Proceedings of the colloquium on snapper-grouper fish- ery resources of the western central Atlantic Ocean, p. 77- 85. Florida Sea Grant Program Rep. 17, Gainsville, FL. Rabalais, N. N., S. C. Rabalais, and C. R. Arnold. 1980. Description of eggs and larvae of laboratory reared red snapper (Lutjanus campechanus Poey). Copeia 1980:704-708. Richards, W. J., and V. P. Saksena. 1980. Description of larvae and early juveniles of labora- tory-reared gray snapper, Lutjanus griseus (Linnaeus) (Pi- sces, Lutjanidae). Bull. Mar. Sci. 30:515-521. Theilacker, G. H. 1980. Changes in body measurements of larval northern anchovy, Engraulis mordax, and other fishes due to han- dling and preservation. Fish. Bull. 78:685-692. Validation of otolith-based ageing and a comparison of otolith and scale-based ageing in mark- recaptured Chesapeake Bay striped bass, Morone saxatilis David H. Secor T. Mark Trice Chesapeake Biological Laboratory Center for Estuarine and Environmental Sciences The University of Maryland System RO. Box 38. Solomons, Maryland 20688-0038 Harry T. Hornick Maryland Department of Natural Resources, Fisheries Division C2 Tawes State Office Building 580 Taylor Avenue, Annapolis, Maryland 21401 Anadromous striped bass, Morone saxatilis, populations in the mid- Atlantic region comprise important commercial and recreational fish- eries (ASMFC 1 ). Stock assessments for these fisheries depend upon age estimates using annular structures of scales (Merriman, 1941; Man- sueti, 1961; Kahnle et al. 2 ; Hornick et al. 3 ). Age estimation for large adults (>91 cm) has been problem- atic owing to the presence of false annuli and to difficulty in interpret- ing narrow annuli in peripheral fields of the scale (Scofield, 1928a; Merriman, 1941; Tiller, 1950; Mansueti, 1961). Recent work on otolith microchemistry to decipher environmental histories of migra- tory striped bass has provided age estimates that were considerably greater than those previously re- ported (Secor, 1992). Longevity of female Chesapeake striped bass was estimated to exceed 31 years based on examination of otolith mi- crostructure (Secor et al. 4 ). An investigation of the rate of annulus formation in the otoliths of Chesapeake Bay striped bass was performed to verify estimates of growth and longevity (Secor et al. 4 ). For otolith microchemistry applications (Secor, 1992), it also was critical to verify that annuli formed at a yearly rate so that sea- sonal patterns in Sr/Ca ratio (ex- posure to varying salinity) could be interpreted. Heidinger and Clod- felter (1987) reported yearly rates of annulus formation in otoliths of striped bass from one to four years in age in a midwest reservoir, but no specific measurements of accu- racy or precision were presented. No other studies have been pub- lished on annulus formation in striped bass otoliths. A mark-recapture study on hatchery-produced striped bass (Rago et al., 1993; Hornick et al. 3 ) provided samples of known-age resident and migratory fish that were 3 to 7 years old. From 1985 to 1992, approximately 5.5 million juvenile striped bass were stocked in Chesapeake Bay tributaries (Rago et al., 1993). All fish were implanted with a binary-coded wire tag which indicated year of origin and provided information on their hatchery source and release date and site. The objective of this study was to verify the rate of annulus formation by comparing annulus counts with the known age of re- captured hatchery fish. A second objective was to compare scale and otolith ages of large striped bass (>91 cm, total length [TL]) to de- termine the accuracy of age esti- mates derived from scales. Methods Known-age study Striped bass otolith ageing tech- niques were verified by using two sets of known-age, coded-wire tagged (CWT) adults. Agroup of 24 CWT fish was obtained from a col- laborative study of migratory striped bass conducted by the Maryland Department of Natural Resources (DNR); the National Marine Fisheries Service; the North Carolina Department of En- 1 ASMFC (Atlantic States Marine Fisher- ies Commission). 1990. Source document for the supplement to the striped bass FMP-Amendment No. 4. Atlantic States Marine Fisheries Commission. Prepared by Versar, Inc., Columbia, MD, 414 p. 2 Kahnle, A. W., D. Stang, K. Hattala, and W. Mason. 1988. Haul seine study of American shad and striped bass spawn- ing stocks in the Hudson River estuary. New York State Dep. of Environmental Conservation, Albany, NY. 3 Hornick, H. T., R. K. Schaefer, D. T. Cosden, K. J. Booth, J. L. Markham, C. B. McCollough, D. M. Goshorn, M. L. Gary, W. S. Barbour, and R. J. Dickinson. 1992. Investigations of striped bass in Chesa- peake Bay. USFWS Federal Aid Perfor- mance Report. Project F-42-R-5. Maryland Dep. Natural Resources, Tidewater Ad- ministration, Fisheries Div., 219 p. 4 Secor, D. H., H. T. Hornick, and J. Mark- ham. Lost and found generations of Chesa- peake Bay striped bass: improvement in year-class representation of Chesapeake Bay striped bass due to the 1985-1991 Maryland striped bass moratorium. Unpubl. manuscr. Manuscript accepted 23 May 1994. Fishery Bulletin 93:186-190 ( 1995). 186 NOTE Secor et al.: Validation of otolith-based ageing in Morone saxatilis 187 vironment, Health, and Natural Resources; and the U.S. Fish and Wildlife Service. Between 6 and 8 Feb- ruary 1993, migratory fish were captured off the North Carolina coast by the crew of the NOAA ves- sel Chapman by means of a 90-ft, 2-seam fish trawl that was towed for a maximum of 30 minutes (Laney and Cole, 1993). A second group of 13 CWT fish was obtained from DNR commercial drift gillnet and poundnet surveys between 5 October 1992 and 23 February 1993. Pound nets and drift nets were lo- cated in shoal areas of the upper Chesapeake Bay, off Kent Island, MD. Fish in the study group had been tagged with bi- nary coded wire tags as age-0+ juveniles. Tags were removed from recaptured fish and decoded by per- sonnel at the U.S. Fish and Wildlife Service labora- tory in Annapolis, MD, to determine their ages. Otoliths were extracted, soaked in 10% sodium hypochlorite solution, rinsed with deionized water, and embedded within a Spurr epoxy (Secor et al., 1991). Transverse sections, approximately 1 mm thick, were then cut through the otolith cores with a Buehler Isomet saw. The sections were mounted on glass slides, polished on 600-grain sandpaper, and polished again on a slurry of 0.3-fum alumina until their surfaces were free of pits and abrasions. Pol- ished sections were viewed under a light microscope, and otolith annuli were counted by two independent readers. Annuli comprised a narrow opaque zone and a wide translucent zone under transmitted light mi- croscopy (magnification at 60 or 150x). Annuli were counted along the sulcal ridge in transverse sections. The otolith ages were compared with each other and with the known age of the fish. Results Known-age study Striped bass collected in pound nets and drift gill nets in Upper Chesapeake Bay were 3- to 7-year-old males and females. The migratory hatchery striped bass from offshore samples tended to be older, rang- ing in age from 4 to 7 years old (Fig. 1). Agreement between known and estimated age for resident striped bass was 100% for both otolith read- ers (rc=13). Exact agreement between estimated and known age for migratory fish (n=24) was 79% and 87% for reader 1 and reader 2, respectively. All mi- gratory fish were estimated to be within one year of their true age. The mean age difference between read- ers for migratory fishes was not significantly differ- ent from (paired £-test: rc=37; P=0.66). The mean absolute difference between ages estimated by reader 1 and known-age, a measure of precision, was esti- mated at 0.13 years. Precision estimated for reader 2 was 0.08 years. Error in age estimates was not re- lated to fish length or age. Scale vs. otolith study Age estimates from scales and otolith sections were not significantly different for fish with otolith-esti- mated ages of 5 to 11 years (Fig. 2; paired £-test: n-30; P=0.41). However, fish with otolith-estimated ages of 22 to 31 years had scale-estimated ages which were, on average, 9 years less than otolith age esti- mates (Fig. 2; paired t-test: n=30; P<0.0001). Scale vs. otolith study Scales and otoliths were sampled from recreational landings of striped bass (>91 cm TL) during the May 1992 Maryland "Trophy Striped Bass Fishery." These fish were assumed to have spawned recently in up- per Chesapeake Bay tributaries. Five additional fish, large females (>100 cm) collected in 1991 and 1992 from the Patuxent and Nanticoke Rivers by DNR for hatchery propagation purposes, were included in the comparisons. Scales and otoliths were aged indepen- dently by a reader at Chesapeake Biological Labora- tory (otoliths) and at DNR (scales). Otoliths were prepared and aged as described above. Scale samples for ageing had been removed from the left side of the fish above the lateral line and below the first dorsal fin. Age was determined from either direct interpre- tation of the scale's annuli or from acetate impres- sions of the scales. Otoliths and scales were coded so that fish length was unknown to readers. 3 4 5 6 7 Age (yr) Figure 1 Age-frequency distribution of known-age striped bass from Upper Chesapeake Bay, Maryland (MD) and coastal North Carolina (NC). 188 Fishery Bulletin 93(1), 1995 Discussion Annulus formation in otoliths and scales We verified age estimates of striped bass from an- nuli observed in sectioned otoliths offish 3 to 7 years old. Annuli precisely and accurately reflected ages in both resident and migratory Chesapeake Bay striped bass. Annulus appearance at 6 and 7 years was similar to that of annuli from otoliths of much older individuals (Fig. 1 in Secor, 1992). Therefore, we believe that annuli also are formed at a yearly rate in older individuals (e.g. >20 years). Tagged hatchery striped bass represent over 5% of the striped bass population which over-winters in coastal wa- ters off North Carolina (Laney and Cole, 1993). Thus, 30 20 10 Scole Age = Otolith Age 10 20 Otolith age (yr) 30 40 i 2 -4 B 10 20 Otolith age (yr) 40 Figure 2 (A) Scale-estimated age vs. otolith-estimated age for Maryland Trophy striped bass (>91 cm TL). Scale age = 4.55 + 0.46 otolith age; rc=45; ^=0.85. For reference, a line corresponding to scale age = otolith age has been plotted. (B) Discrepancy between otolith-estimated and scale-estimated age vs. otolith-estimated age for Maryland Trophy striped bass (>91 cm TL). (Otolith age- Scale age) = -4.55 + 0.54 otolith age; re=45; r*= 0.88. these fish will continue to provide a pool of known- age material to verify age estimates in older fish. In the next decade it will be possible to verify annulus formation in the oldest fish of the population. The timing of annulus formation in otoliths was not quantitatively evaluated; samples among months of the year were insufficient to conduct a marginal in- crement analysis (see Beckmanetal., 1988, 1990, 1991). However, we did consistently observe that samples col- lected during the Maryland Trophy Striped Bass Sea- son in May 1991 and 1992 (see Secor, 1992) contained a newly formed annulus and that no such annulus was observed in otoliths of resident or migratory fish col- lected in February 1993. Therefore, annulus formation probably occurs during the February-April period. This observation agrees with observations on season of an- nulus formation in striped bass scales (Merriman, 1941; Heidinger and Clodfelter, 1987). On the basis of evidence that annuli in otolith ages represent true age in older fish, we believe that scales significantly underestimate age in fish older than 20 years. Scale ages were not signifi- cantly different from otolith ages for fish aged 5 to 11 years, ages that corresponded to fish 91 to 110 cm TL. Scale ages were, on average, 9 years less than otolith ages in fish older than 20 years that corresponded to fish >120 cm TL. Because samples were unavailable for ages 12 to 19 years owing to the scarcity of individuals from these year classes (Secor et al. 4 ), we could not determine the accuracy of scale ages for this period. In a similar study on southeastern U.S. riverine and reser- voir striped bass, Welch et al. ( 1993) observed that scale ages were in good agreement with otolith ages for fish <90 cm TL but that scale ages were significantly lower than otolith ages for fish 90- 10 cm TL. For Sacramento-San Joaquin striped bass, Scofield ( 1928a) found good agreement be- tween age estimates made from either hardpart for the first eight years offish life. Ageing in striped bass stock assessments Errors in ageing can result in large biases in stock assessments and in mismanagement of fishery resources (Beamish and McFarlane, 1983; Richards et al., 1992). Scientists at the turn of the century recognized that otoliths of- ten provide more accurate and precise estimates of age than do other hard parts (Heinke, 1904; Cunningham, 1905; Haempel, 1910). Indeed, early verification of age estimation based on scales of striped bass relied upon comparisons of age estimates with those based on otoliths NOTE Secor et al.: Validation of otolith-based ageing in Morone saxatilis 189 (Scofield, 1928, a and b). However, the popularity and ease of age estimations using scales caused investi- gators to overlook the importance of verifying age- ing methodology (Beamish and McFarlane, 1983). All stock assessments on migratory populations of striped bass currently rely on interpreting annular fea- tures on scales, a largely unvalidated method. Annu- lus formation in scales of striped bass has been veri- fied for fish up to age three (Humphreys and Kornegy, 1985) and four years (Heidinger and Clodfelter, 1987) in nonmigratory striped bass. Our data indicated that annuli in scales may adequately estimate age for fish less than 12 years of age. Thereafter, scales provided a continuous age distribution between 11 and 20 years of age, and otolith ageing indicated an absence offish corresponding to these ages (Fig. 2). Therefore, we in- ferred that otolith-based age determination will pro- vide more accurate estimates after 12 years of age. A major disadvantage of using otoliths for age de- terminations is that fish must be sacrificed. Because large and old members of coastal populations have potentially high reproductive values and may be important contributors to annual recruitments (Rago and Goodyear, 1987; Zastrow et al., 1989; Secor et al., 1992; Cowan et al., 1993), it may be undesirable to sacrifice large numbers of these individuals for stock assessment purposes. An alternative approach would be to correct the age estimates from scales by using an otolith vs. scale calibration curve (Fig. 2). Our reported relationship was somewhat variable (^=0.85), but with additional otolith samples, reliable prediction of age from scale annuli may be possible. Acknowledgments Jim Van Tassel, Jorgen Skjeveland, Rick Schaefer, Jim Markham, Don Cosden, Marty Gary, David Goshorn, and Scott Barbour provided samples of CWT adults. Ken Booth provided samples of CWT adults and aged scale samples for this study. Bunky^ Charter Boat Service provided samples of migratory Chesapeake Bay striped bass. Mike Mangion assisted in interpretation of CWT-tags and annuli in scales, respectively. This research was supported by the U.S. Fish and Wildlife Service Emergency Striped Bass Study (F&W Contract 14-48-0009-92-934 to Chesa- peake Biological Laboratory) and Maryland Depart- ment of Natural Resources. Literature cited Beamish, R.J., and G.A. McFarlane. 1983. The forgotten requirement for age validation in fish- eries biology. Trans. Am. Fish. Soc. 112:735-743. Beckman, D. W., C. A. Wilson, and A. L. Stanley. 1988. Age and growth of red drum, Sciaenops ocellatus, from offshore waters of the Northern Gulf of Mexico. Fish. Bull. 87:17-28. Beckman, D. W., A. L. Stanley, J. H. Render, and C. A. Wilson. 1990. Age and growth of black drum in Louisiana waters of the Gulf of Mexico. Trans. Am. Fish. Soc. 119:537-544. 1991. Age and growth-rate estimation of sheepshead Archosargus probatocephalus in Louisiana waters using otoliths. Fish. Bull. 89:1-8. Cowan, J. H., Jr., K. A. Rose, E. S. Rutherford, and E. D. Houde. 1993. Individual-based models of young-of-the-year popu- lation dynamics. II: Factors affecting recruitment in the Potomac River, Maryland. Trans. Am. Fish. Soc. 122: 439-458. Cunningham, J. T. 1905. Zones of growth in the skeletal structures of Gadidae and Pleuronectidae. In 23rd annual report of Fisheries Board of Scotland, 1905, Part II: Scientific investigations, p. 125-140. Haempel, O. 1910. Ueber das Wachstum des Huchens (Salmo hucho L.). Ein Beitrag zur Altersbestimmung der Teleostier. Int. Rev. Hydrobiol. Hydrogr. 3:136-155. Heidinger, R. C, and K. Clodfelter. 1987. Validity of the otolith for determining age and growth of walleye, striped bass, and smallmouth bass in power plant cooling ponds. In R. C. Summerfelt (ed.), Age and growth offish, p. 241-252. Iowa State Univ. Press, Ames, LA Heinke, F. 1904. Occurrences and distributions of the eggs, larvae and various age-groups of the food fishes in the North Sea. J. Cons. Int. Explor. Mer, General Report, 1902-1904:1-39. Humphreys, M., and J. W. Kornegy. 1985. An evaluation of the use of bony structures for aging Albermarle Sound-Roanoke River striped bass (Morone saxatilis). North Carolina Wildlife Resources Commission Report, Raleigh, NC, 17 p. Kimura. D. K. 1977. Statistical assessment of the age-length key. J. Fish. Res. Board Can. 34:317-324. Laney, R. W., and W. W. Cole. 1993. Tagging summary for mixed striped bass stocks off- shore North Carolina and Virginia. In Abstracts, 1993 striped bass study, striped bass workshop, p. 144-147. Natl. Mar. Fish. Serv., Silver Spring, MD. Mansueti, R. J. 1961. Age, growth and movements of the striped bass, Roccus saxatilis, taken in size selective fishing gear in Maryland. Chesapeake Bay Sci. 2:9-36. Merriman, D. 1941. Studies of the striped bass (Roccus saxatilis) of the Atlantic coast. U.S. Fish Wildl. Serv., Fish. Bull. 50: 1-77. Rago, P. J., and C. P. Goodyear. 1987. Recruitment mechanisms of striped bass and Atlan- tic salmon: comparative liabilities of alternative life histories. Am. Fish. Soc. Symp. 1:402^116. Rago, P. J., H. Upton, and P. I. Washington. 1993. Estimated contribution of hatchery-reared striped bass to commercial and recreational fisheries of Maryland 1991-1992. In Abstracts, 1993 striped bass study, striped bass workshop, p. 177-184. Natl. Mar. Fish. Serv., Silver Spring, MD. 190 Fishery Bulletin 93(1). 1995 Richards, I. J., J. T. Scbnute, A. R. Kronlund, and R. J. Beamish. 1992. Statistical models for the analysis of ageing error. Can. J. Fish. Aquat. Sci. 49:1801-1815. Scofield. E. C. 1928a. Preliminary studies on the California striped bass. Trans. Am. Fish. Soc. 1928:139-144. 1928b. Striped bass studies. Calif. Fish and Game 14:29-37. Secor, D. H. 1992. Application of otolith microchemistry analysis to in- vestigate anadromy in Chesapeake Bay striped bass Morone saxatilis. Fish. Bull. 90:798-806. Secor, D. H., J. M. Dean, and E. H. Laban. 1991. Manual for otolith removal and preparation for mi- crostructural examination. Belle W. Baruch Institute, Univ. South Carolina Press, Columbia, SC, 85 p. Secor, D. H., J. M. Dean, T. A. Curtis, and F. W. Sessions. 1992. Effect of female size and propagation methods on lar- val production at a South Carolina striped bass (Morone saxatilis) hatchery. Can. J. Fish. Aquat. Sci. 49:1778-1787. Tiller, R. E. 1950. A five-year study of the striped bass fishery of Mary- land, based on analyses of scales. Chesapeake Biological Lab. Publ. 85, 30 p. Welch, T. J., M. J. Van den Avyle, R. K. Bet si 11, and E. M. Driebe. 1993. Precision and relative accuracy of striped bass age estimates from otoliths, scales, and anal fin rays and spines. N. Am. J. Fisheries Manage. 13.616-620. Zastrow, C. E., E. D. Houde, and E. H. Saunders. 1989. Quality of striped bass (Morone saxatilis) eggs in re- lation to river source and female weight. Rapp. P.-V. Reun. Cons. Int. Explor. Mer 191:34-^42. An evaluation of six marking methods for age-0 red drum, Sciaenops ocellatus* Stephen T. Szedlmayer Jeffrey C. Howe Department of Fisheries and Allied Aquacultures Auburn University Marine Extension and Research Center 41 70 Commanders Drive, Mobile. Alabama 3661 5 Mark-recapture studies of fishes can reveal valuable information on move- ment, mortality, and growth rate (Parker et al., 1990). Despite the many successful methods that have been developed for adult fish, mark- ing of small juvenile fishes is prob- lematic (Chapman and Bevan, 1990). Age-0 fish are typically too small and delicate for many marking methods. A few methods for marking age- fishes have been developed: coded wire microtags (Thrower and Smoker, 1984; Brodziak et al., 1992; Bumguardner et al., 1992); spray paint marking (Phinney et al., 1967; Pierson and Bayne, 1983); fluorescent staining (Hettler, 1984; Secor et al., 1991a; Szedlmayer and Able, 1992); and external plastic minitags (Floy Tag and Mfg. Co., Inc., Seattle, WA). All of these methods have advantages and dis- advantages based on the attributes of each species. Thus, there is a need to test different marking methods on small size classes of different species to determine the most suitable methods. Two marking methods have been reported for age-0 red drum, Sciae- nops ocellatus: 1) spray paint mark- ing, 1 and 2) coded wire microtags (Bumguardner et al., 1992). Fluo- rescent staining is another method that may be useful for age-0 S. ocellatus and has been successfully applied to juvenile red sea bream, Pagrus major (Tsukamoto et al., 1989), and to larval and juvenile striped bass, Morone saxatilis (Secor et al., 1991a). However, it is not possible from these studies to de- termine the most useful marking method for age-0 S. ocellatus. Hence, we examined mortality, mark retention, and growth in age- S. ocellatus that were marked by one of six different methods: 1) coded wire microtags, 2) external plastic minitags, 3) alizarin com- plexone, 4) oxytetracycline dihydrate [OTC], 5) red fluorescent spray paint, and 6) green fluorescent spray paint. Materials and methods We marked 614 cultured age-0 S. ocellatus (mean standard length [SL] ± standard deviation [SD]=67.4 ± 8.7 mm; range=48— 95 mm SL) on 4—5 February 1993. Fish were anesthe- tized with tricane methanol sulfate (50 mg MS222/L seawater), weighed, measured, and randomly assigned to one of the following treatments: red fluorescent paint (red), green fluo- rescent paint (green), external plas- tic tags (plastic), binary coded wire microtags (wire), oxytetracycline- dihydrate (250 mg OTC/L 25 ppt sea- water for 15 h), and alizarin-complex- one (250 mg alizarin/L 25 ppt sea- water for 15 h). Wire tags were injected into the left epaxial muscle with a specially designed hypodermic needle (North- west Marine Technology, Shaw Is- land, WA). The plastic tags (num- bered disk: 0.5x3x7 mm) were at- tached posterior to the dorsal fin with elastic thread sewn through the left and right epaxial muscles. Red and green paints were applied at a pressure of 70 to 100 psi from a distance of 30 to 50 cm (Phinney et al., 1967). Atotal of 614 fish were marked and classified as follows: 100 OTC, 114 alizarin, 100 red, 100 green, 100 plastic, and 100 wire. All fish were held in a 7,570-L closed seawater system, and differentially marked fish were separated by flow through partitions. Ammonia, ni- trite, and nitrate levels were con- trolled with an oyster shell biologi- cal filter (mean ± standard error [SE]: NH 3 =0.018 ±0.003 ppm; NO 2 =0.253 ± 0.047 ppm; N0 3 =47.4 ±1.9 ppm). Particulates were re- moved with a sand filter. Salinity was held constant by addition of artificial seasalts or freshwater (mean salinity ± SE=25.0 ± 0.2 ppt). Temperature was held constant with three 1,000-W heaters (mean temperature ± SE=20.8 ± 0.2°C). Fish mortalities were counted and removed daily for 68 days. All fish were fed daily at 5% body weight per day with Zeigler salmon crumbles no. 2 pellet food (Zeigler Bros. Inc., Gardners, PA). At 25, 48, and 68 days, all fish from each treatment were anesthetized, weighed, measured, and food was adjusted for growth to maintain the daily 5% body weight ration. Red and green paint marks were veri- fied with an ultraviolet light (paint was not visible under white light). Fish were considered marked if at least one granule of pigment was observed. Also, when fish were anesthetized and measured, we randomly sacrificed 20 fish from * Contribution 8-944903 of the Alabama Agricultural Experiment Station, Auburn University, Mobile, Alabama 36615. 1 McMichael, Robert H., Jr. Florida Depart- ment of Natural Resources, St. Peters- burg, FL. Personal commun., 1992. Manuscript accepted 29 August 1994. Fishery Bulletin 93:191-195 (1995). 191 192 Fishery Bulletin 93(1), 1995 each treatment: from OTC and alizarin treatments for otolith mark examination, from wire treatments for wire removal, and from other treatments for fu- ture otolith analysis. All samples were preserved by freezing. In estimating percent survival, it was as- sumed that all fish that were sacrificed (alive and healthy at time of sample) would have survived the 68-d experimental period. The actual survival of sac- rificed fish would be lower than 100%, but the differ- ence in survival rate among treatments would be expected to increase if actual survival rates for all fish were known. Whole sagittal otoliths were removed from OTC and alizarin treatments and viewed with an Olympus BH- 2 compound microscope under 100-W ultraviolet light. When fluorescent marks were not visible on whole otoliths, they were sectioned and polished for in- creased resolution (Secor et al., 1991b; Szedlmayer and Able, 1992). Wire tags were located by mak- ing a sagittal incision of the epaxial muscle and examined under a Nikon stereo-microscope. If wire tags were not located by dissection, fish were X-rayed to locate tags. We compared instantaneous mortality rates with analysis of covariance (ANCOVA) and per- cent tag retention with a randomized block analysis of variance (ANOVA) with day as blocks and marking method as the factor (Zar, 1984). We compared standard lengths (SL) and weights over marking method with ANOVA for each sample date. If significant differences (P<0.05) were detected, we compared the means (ANOVA) or slopes (mortality; ANCOVA) with Newman-Keuls range test (Zar, 1984). Results Instantaneous mortality rates (log per- cent survival=-Zrf + Y) for OTC (-Z=0.0013, r 2 =0.92), alizarin (-Z=0.0014, r 2 =0.80), and wire (-Z=0.0016, ^=0.78) marking were sig- nificantly less than those for plastic (-Z=0.0023, ^=0.90), red (-Z=0.0025, r 2 =0.96), and green treatments (-Z=0.0033, r^O.92; Fig.l). Survival curves showed similar patterns with higher mortality in the first 40 days; thereafter mortality was reduced (Fig. 1). Percent mark retention of alizarin, OTC, and wire tags were signifi- cantly greater than those of other treatments. The highest mark reten- tion was observed for OTC- and alizarin-marked fish (100%; Table 1). Wire-marked fish also showed high retention rates (85-100 %). Red-, green-, and plas- tic-marked fish showed significant declines in tag re- tention over the 68 days (Table 1). Mean SL and weight showed no significant differ- ence among treatments on day 1, 25, 48, and 68 (Tables 2 and 3). Growth rates were similar among all treatments: 1.0-1.1 mm SlVd and 0.5-0.6 g wet wt/d (Tables 2 and 3). Discussion Wire tags provided the best overall performance of the marking methods tested over this two-month 100- ^S>^ N^\\ *-^ NjjsS ^ Survival % 00 o \?S>»_ Alizarin 3 \ "■---»»_ Wire 3 60- Green" ■-. ( ) 10 20 30 40 50 60 70 Day Figure 1 Percent survival of age-0 red drum, Sciaenops ocellatus, marked by six methods. Treatments with different letters were signifi- cantly different (P<0.05). Table 1 Percent mark retention among sample days of age-0 red drum, Sciaenops ocellatus, marked by one of six methods: wire = coded wire microtag; plastic = external plastic tag; red = red fluorescent paint; green = green fluorescent paint; OTC = oxytetracycline dihydrate; and Ali = alizarin complexone. Num- bers in parenthesis are sample sizes. Treatments with different letters are significantly different (P<0.05). Marking method Day OTC Ali" Wire" Red 6 Plastic* Green 6 25° 48 a6 68 c 100.0(21) 100.0(20) 90.0(20) 80.5(82) 78.2(78) 42.3(78) 100.0(20) 100.0(20) 100.0(20) 55.8(52) 49.1(53) 39.1(46) 100.0(19) 100.0(21) 85.0(20) 14.8(27) 24.1(29) 16.0(25) NOTE Szedlmayer and Howe: Six marking methods for age-0 Sciaenops ocellatus 193 study. Wire-marked fish showed low mortality and high tag retention compared with those marked by the plastic and paint methods. Also, individual fish are identifiable with wires which can be more useful than batch marking with OTC and alizarin. Of par- ticular interest were the high tag-retention rates of wires (85-100 %). In past studies of wire tags injected in the cheek muscle of age-0 S. ocellatus, consider- able tag loss was shown over the first 114 d: 67.3% tag retention after 24 h, 47% from 2 to 23 d, and 45% Table 2 Mean standard lengths and growth rates of age-0 red drum, Sciaenops ocellatus, marked by one of six methods: wire = coded wire microtag; plastic = external plastic tag; red = red fluorescent paint; green = green fluorescent paint; OTC = oxytetracycline dihydrate; and Ali = alizarin complexone. Treatments were not significantly different (P<0.05). SL=standard length, SE=standard error, n=sample size. Day Measure Mark method Wire Plastic Red Green OTC Ali 1 SL (mm) 65.9 66.9 66.8 67.1 68.9 67.6 SE 0.8 0.9 0.9 0.9 0.9 0.7 n 100 100 100 100 100 114 25 SL(mm) 90.5 91.6 88.8 90.5 90.7 91.6 SE 1.0 1.1 1.1 1.1 1.1 1.0 n 80 78 82 78 88 95 48 SL (mm) 116.7 117.9 112.5 118.1 117.5 114.0 SE 1.3 1.7 2.0 1.6 1.6 1.4 n 57 53 52 46 64 71 68 SL (mm) 131.1 134.7 134.4 134.3 128.7 129.1 SE 2.2 2.9 2.0 2.3 1.8 2.1 n 37 29 27 25 44 50 Growth (mm/d) 1.1 1.1 1.1 1.1 1.0 1.0 r 2 0.86 0.83 0.83 0.85 0.80 0.83 Table 3 Mean wei ghts and standard error (SE)of age red drum, Sciaenops ocellatus. marked by one of six methods: wire = coded wire microtag; plastic = external plastic tag; red = red fluorescent paint ; green = green fluorescent paint OTC = oxytetracycline dihydrate ; and Ali = alizarin complexone Treatments were not significantly different (P<0.05) WT= =we ght, n= sample sizes. Day Measure Mark method Wire Plastic Red Green OTC Ali 1 WT(g) 4.9 5.2 5.2 5.2 5.7 5.2 SE 0.2 0.2 0.2 0.2 0.2 0.2 n 100 100 100 100 100 114 25 WT(g) 12.9 13.5 14.0 13.5 13.4 13.1 SE 0.4 0.5 1.1 0.5 0.5 0.4 n 80 78 82 78 88 95 48 WT(g) 30.1 29.5 27.9 28.2 27.8 27.2 SE 1.1 1.3 1.4 1.1 1.1 1.0 n 57 53 52 46 64 71 68 WT(g) 41.9 44.7 45.1 42.2 37.6 38.1 SE 2.1 2.8 2.2 2.5 1.7 2.0 n 37 29 27 25 44 50 Growth (g/d) 0.6 0.6 0.6 0.6 0.5 0.5 r 2 0.80 0.77 0.69 0.80 0.74 0.72 194 Fishery Bulletin 93(1). 1995 from 24 to 114 d (Bumguardner et al., 1992). A simi- lar wire tag loss rate was observed in striped bass tagged horizontally in the cheek muscle (22.2-30.7% retention over the first 70 d; Dunning et al., 1990). However, Dunning et al., (1990) also reported that wire retention rates substantially increased when stripped bass were tagged in the snout (63-98.5%), nape (93.8-99.3%), or vertically in the cheek (82.7- 87.0%) over the first 70 days. Also, Klar and Parker (1986) showed 99% tag retention after 90 days if wires were injected into the epaxial muscle of striped bass. Our results agree with the higher tag retention rates reported by Dunning et al., (1990) and Klar and Parker (1986); there was little indication of tag loss in the first days after marking. We suggest that higher wire retention resulted from mark location, because current wires were injected deep (4—5 mm) into the epaxial muscle and had little chance of expulsion. Although wire tags showed the best overall per- formance compared with other tags, the method was the most labor intensive of all methods, because of the required dissection, removal, and reading of wires. If individual growth rates are needed and both personnel and budget are limiting, plastic tags may be useful. Plastic tags can be read directly without harm to the fish, but they also showed significant tag loss compared with other methods and should be limited to short experiments of no more than 25 days. Paint marking methods showed greater mortali- ties and lower retention times compared with other methods but are useful in situations where fish can only be held for short periods (1-2 h, see Weinstien et al., 1984). However, paint marking methods should also be limited to short-term experiments because of significant mark loss after 25 days. If fish movements or survival are the objectives and fish can be held for long (=15 h) marking peri- ods, then OTC or alizarin may be the best marking methods. Both methods showed higher tag retention ( 100%) and lower mortality rates compared with plas- tic minitags or paint methods. Other studies have shown long-term retention for these chemicals: for example, OTC marks in chum salmon, Oncorhynchus keta (Bilton, 1986) and alizarin marks in P. major (Tsukamoto et al., 1989) were both detected two years after marking. Another advantage of OTC and al- izarin staining was that handling was minimal and probably caused the least amount of stress among all the marking methods, as reflected in the lower mortality rates. Therefore, these fluorescent stains would be most suitable for long-term studies where individual growth rates are not needed and for batch marking large numbers of fish, for example prior to release of hatchery reared fish (Tsukamoto et al., 1989;Secoretal., 1991a). One difference in the present study was the use of oxytetracycline-dihydrate instead of oxytetracycline- hydrochloric acid (HCL), as used in other studies. (Hettler, 1984; Tsukamoto and Shima, 1990; Secor et al., 1991a). The dihydrate form of OTC was ad- vantageous in that it did not cause a reduction in pH as observed with the HCL form. This difference may account for the low mortality observed after 15 hours in the OTC bath (i.e. no fish died during the 15-h mark- ing period). One advantage of the alizarin stain over the OTC marker was the ease in detecting the fluores- cent marks. When whole otoliths were examined only 2 of 91 alizarin otoliths needed further cutting and pol- ishing to detect the stain, whereas 23 of 83 OTC otoliths needed sectioning before OTC marks were visible. As indicated by growth rates, fish acclimated well to the closed seawater system. Although we did not have a control group of fish, growth rates in the present study (1.0-1.1 mm SL/d) were similar to or greater than previous studies of unmarked S. ocellatus of similar sizes and temperatures as the current study: 0.8 mm/d from Tampa Bay (Peters and McMichael, 1987), 0.8 mm/d from Charleston Har- bor (Daniel, 1988), and 1.0 mm/d for reared fish in Texas (Colura et al., 1990). Also, we were not attempt- ing to compare growth rates of marked fish with those of wild populations or those of unmarked laboratory fish but rather to determine the most useful tag of the methods tested. Thus, we recommend wire tags when individual marks are needed because of lower mortality and higher mark retention compared with those from plastic minitags. We recommend alizarin when batch- marking methods are needed and individual growth rates are not critical, because of lower mortality and higher retention compared with those from paint methods and because of ease of detecting mark com- pared with OTC marking. Acknowledgments We thank J. Lindstrom and J. Mang for help in rear- ing and sampling S. ocellatus. We thank L. Collins for review of an early draft. This research was funded through a Saltonstall-Kennedy grant USDC- NA27FD0063-01, National Marine Fisheries Service, National Oceanic and Atmospheric Administration. Literature cited Bilton, H. T. 1986. Marking chum salmon fry vertebrae with oxytetra- cycline. N. Am. J. Fish. Manage. 6:126-128. NOTE Szedlmayer and Howe: Six marking methods for age-0 Saaenops ocellatus 195 Brodziak, J., B. Bentley, D. Bartley, G. A. E. Gall, R. Gomulkiewicz, and M. Mangel. 1992. Tests of genetic stock identification using coded wire tagged fish. Can. J. Fish. Aquat. Sci. 49:1507-1517. Bumguardner, B. W., R. L. Colura, and G. C. Matlock. 1992. Long-term coded wire tag retention in juvenile Sciaenops ocellatus. Fish. Bull. 90:390-394. Chapman, L. J., and D. J. Bevan. 1990. Development and field evaluation of a mini-spaghetti tag for individual identification of small fishes. Am. Fish. Soc. Symp. 7:101-108. Colura, R. L., B. W. Bumguardner, A. Henderson- Arzapalo, and J. D. Gray. 1990. Culture of red drum fingerlings. Texas Parks and Wildl. Dep., Manage. Data Ser. 22, Austin, Texas. Daniel, L. B., III. 1988. Aspects of the biology of juvenile red drum, Sciaenops ocellatus, and spotted seatrout, Cynoscion nebulosus (Pi- sces: Sciaenidae) in South Carolina. M.S. thesis, College of Charleston, Charleston, SC. Dunning, D. J., Q. E. Ross, B. R. Friedmann, and K. L. Marcellus. 1990. Coded wire tag retention by, and tagging mortality of, striped bass reared at the Hudson River Hatchery. Am. Fish. Soc. Symp. 7:262-266. Hettler, W. F. 1984 Marking otoliths by immersion of marine fish larvae in tetracycline. Trans. Am. Fish. Soc. 113:370-373. Klar, G. T., and N. C. Parker. 1986. Marking fingerling striped bass and blue tilapia with coded wire tags and microtaggants. N. Am. J. Fish. Man- age. 6:439-444. Parker, N. C, A. E. Giorgi, R. C. Heidinger, D. B. Jester Jr., E. D. Prince, and G. A. Winans (eds.). 1990. Fish-marking techniques. Am. Fish. Soc. Symp. 7. Am. Fish. Soc, Bethesda, MD, 879 p. Peters, K. M., and R. H. McMichael Jr. 1987. Early life history of the red drum, Sciaenops ocellatus (Pisces: Sciaenidae), in Tampa Bay, Florida. Estuaries 10:92-107. Phinney, D. E., D. M. Miller, and M. L. Dahlberg. 1967. Mass-marking young salmonids with fluorescent pigments. Trans. Am. Fish. Soc. 96:157-162. Pierson, J. M., and D. R. Bayne. 1983. Long-term retention of fluorescent pigment by four fishes used in warmwater cultures. Prog. Fish-Cult. 45:186-188. Secor, D. H., M. G. White, and J. M. Dean. 1991a. Immersion marking of larval and juvenile hatch- ery-produced striped bass with oxytetracycline. Trans. Am. Fish. Soc. 120:261-266. Secor, D. H., J. M. Dean, and E. H. Laban. 1991b. Manual for otolith removal and preparation for mi- crostructural examination. Electric Power Res. Inst, and the Belle W. Baruch Inst, for Marine Biology and Coastal Res., Columbia, SC, 85 p. Szedlmayer, S. T., and K. W. Able. 1992. Validation studies of daily increment formation for larval and juvenile summer flounder, Paralichthys dentatus. Can. J. Fish. Aquat. Sci. 49:1856-1862. Thrower, F. P., and W. W. Smoker. 1984. First adult return of pink salmon tagged as emergents with binary-coded wires. Trans. Am. Fish. Soc. 113: 803-804. Tsukamoto, K., and Y. Shima. 1990. Otolith daily increment in sandfish. Bull. Jpn. Soc. Sci. Fish. 56:1083-1087. Tsukamoto, K., H. Kuwada, J. Hirokawa, M. Oya, S. Sekiya, H. Fujimoto, and K. Imaizumi. 1989. Size-dependent mortality of red sea bream, Pagrus major, juveniles released with fluorescent otolith-tags in News Bay, Japan. J. Fish Biol. 35(A):59-69. Weinstein, M. P., L. Scott, S. P. O'Neil, R. C. Siegfried II, and S. T. Szedlmayer. 1984. Population dynamics of spot, Leiostomus xanthurus, in polyhaline tidal creeks of the York river estuary, Virginia. Estuaries 7(4A):444— 450. Zar, J. H. 1984. Biostatistical analysis, 2nd ed. Prentice-Hall, Englewood Cliffs, NJ, 718 p. Stranding and mortality of humpback whales, Megaptera novaeangliae, in the mid-Atlantic and southeast United States, 1985-1992 David N. Wiley Regina A. Asmutis International Wildlife Coalition 70 East Falmouth Highway, East Falmouth, Massachusetts 02536 Thomas D. Pitchford Virginia Marine Science Museum 7 1 7 General Booth Boulevard, Virginia Beach, Virginia 2345 1 Present address: Florida Department of Natural Resources Florida Marine Research Institute, Marine Mammal Section Southwest Field Station, 1 4 1 8-G Market Circle, Port Charlotte, Florida 33954 Damon P. Gannon Plymouth Marine Mammal Research Center RO. Box 1131. Plymouth, Massachusetts 02362 Marine mammal strandings are a result of, or result in, mortality that may be attributed to natural or an- thropogenic factors. As such, strand- ing data can provide insight on spa- tial distribution, seasonal move- ments, and mortality factors pertain- ing to marine mammal populations (Woodhouse, 1991; Mead 1 ). The general distribution and mi- gratory movements of humpback whales, Megaptera novaeangliae, in the western North Atlantic are well known from numerous studies based on the identification of indi- vidual animals and on other tech- niques. Humpbacks feed in high latitude areas during the summer months, including waters of the Gulf of Maine, eastern Canada, West Greenland, and Iceland (Hain et al., 1982; Martin et al., 1984; Perkins et al., 1984; Katona and Beard 1990). In the winter, whales from all populations migrate to breeding grounds in the West Indies (Balcomb and Nichols, 1982; Mattila and Clapham, 1989; Mattila et al., 1989; Katona and Beard 1990). Between these migra- tory end points, little is known of the distribution of the species. In recent years, however, there has been an apparent increase in the frequency of sightings of humpback whales off the mid- Atlantic coast of the United States (Swingle et al., 1993). Furthermore, a considerable number of strandings have been documented along the mid-Atlan- tic and southeast coasts, many in midwinter, a time when the major- ity of humpbacks are thought to be located in tropical waters. In this paper, we analyze data from these strandings, discuss implications regarding distribution and possible spatial segregation by age class, and examine apparent causes of mortality. Methods Study area and period The study covers the coastal area of eastern North America extend- ing from New Jersey(40°28'5N, 74°00'0W) to southern Florida (25°12'N, 80°13'W), consisting of 2,319 km of coastline (Fig. 1). The eight-year period from 1 January 1985 through 31 December 1992 was investigated. Stranding data were obtained from the United States Museum of Natural History, Smithsonian Institution's Marine Mammal Events Program (MMEP). This information was confirmed and augmented by comparison with data from stranding response per- sonnel involved with the Northeast and Southeast Regional Stranding Networks and with data published in newspaper reports. Organiza- tions involved in the regional stranding networks operate under a permit issued by the National Marine Fisheries Service. The names and organizations of inves- tigators responding to specific stranding events are on file. Analyses The following data were recorded for each stranding: date, location, sex, body length, and the presence or absence of body markings that may indicate a possible anthropo- genic cause of mortality (e.g. ship strike or fishery interaction). Stranding incidents among states were compared by using a ratio of the number of strandings in the state to 1 Mead, J. G. 1979. An analysis of cetacean strandings along the eastern coast of the United States. In J. R. Geraci and D. J. St. Aubin (eds.), Biology of marine mam- mals: insights through strandings, p. 54- 68. Report to U.S. Marine Mammal Comm. Contract MM7AC020. U.S. Dep. of Commer, Natl. Tech. Info. Serv. PB-293 890. Manuscript accepted 15 June 1994. Fishery Bulletin 93:196-205 (1995). 196 NOTE Wiley et al.: Stranding and mortality of Megaptera novaeangliae 197 the length of coastline along the state. This is referred to as the stranding incidence ratio (SIR). Length of coastline was calculated from Ringold and Clark ( 1980). *ANJ MD Chesapeake '. Bay VA , Ca P e . oa «»\Hatteras * NC "X ->• /"* sc \ 1 Atlantic \^ GA U Ocean \" a \ J \ FL * 1985- 1988 •1989- 1992 .8 Figure 1 Locations of humpback whale, Megaptera nov- aeangliae, strandings from New Jersey to south- ern Florida, 1985 through 1992. Reproductive class was inferred from body-length data. Animals of less than 8 m in length were con- sidered to be dependent, nursing calves (Nishiwaki, 1959; Rice, 1963). We considered newly independent calves to be animals greater than 8.0 m but less than 9.9 m (calculated from Katona et al., 1983 2 ). Males between 9.9 m and 11.6 m and females between 9.9 m and 12.0 m were considered sexually immature but not newly independent. Animals greater than 11.6 m (males) and 12.0 m (females) were considered sexually mature (Nishiwaki, 1959; Rice, 1963). The Mann-Whitney [/-test (Sokal and Rohlf, 1981) was used to test for differences between the number of strandings that occurred in the period 1985—88 versus 1989-92. Time periods were chosen to coin- cide with reported changes in observations of live animals in the same region (Swingle et al., 1993). The hypothesis that strandings occurred randomly throughout the study area was tested by chi-square analysis in a 2x2 contingency table (Sokal and Rohlf, 1981). The hypothesis that stranding events were not influenced by season was tested by chi-square analy- sis. Seasons were winter (January-March), spring (April-June), summer (July-September) and fall (October-December). Seasonal groupings were con- structed so that the winter season would approxi- mately coincide with the period of peak humpback occupancy of the breeding grounds, as reported by Mattila and Clapham (1989). The hypothesis that stranding occurrence was not influenced by sex was tested by chi-square analysis in a 2x2 contingency table. Factors relating to mortality were taken from the written reports of on-site stranding response person- nel from the Northeast and Southeast Regional Stranding Networks or, when not available, from the synthesis of such reports contained in the MMER The experience of stranding network response per- sonnel is variable, and factors contributing to death or interpretation of bodily injury can be subject to debate. If on-site investigators recorded references to rope marks, propeller marks, broken bones, large gashes, etc., or directly suggested ship strike or en- tanglement as a potential cause of death, we attrib- uted the death to possible anthropogenic causes. All mortality not suggesting anthropogenic trauma were grouped into a "natural" mortality category. This in- cluded animals that were euthanized but showed no other indications of human interaction. If a necropsy was conducted and no mention was made of body trauma, we assumed natural mortality. Carcasses that were reported to be in advanced stages of de- composition were eliminated from consideration. 2 Calculated as length at birth, 4.5 m; growth rate, 45 cm per month; 12 month growth period = 9.9 m. 198 Fishery Bulletin 93(1), 1995 Results Mortality A total of 38 stranded humpback whales were re- corded between 1 January 1985 and 31 December 1992 (Table 1). One animal (4/14/85) was not included in the analyses because body condition ("mummifi- cation") indicated death or stranding, or both, oc- curred prior to the study period. The number of strandings by year was as follows: in 1985, 2 in 1986, in 1987, 1 in 1988, 3 in 1989, 8 in 1990, 7 in 1991, and 16 in 1992. Significantly more animals stranded during the period 1989 to 1992 (n=34), than from 1985 to 1988 (n=3) (Mann- Whitney U: Z=-2.32, P=0.02). Of the strandings recorded in our database, 92% (34/37) occurred after January 1989. Significantly more strandings occurred along 170 km of coastline between Chesapeake Bay, Virginia, and Cape Hatteras, North Carolina (x 2 =70.67, df=l, P<0.01), than occurred in the rest of the study area. In this region, which represents 7.3% (170 km/2,319 km) of the coastline within the study area, 43% (16/ 37) of all strandings occurred. A second cluster of strandings occurred along the coast of northern Florida; however, this grouping was not found to be significant (x 2 =5.98, df=l, P=0.25). The region, which represents 4.7% (110 km/2319 km) of the study area's coastline, contained 13.5% (5/37) of all strandings. The number of strandings per state was highly variable (Table 2). Numerically, the highest number of strandings occurred in North Carolina (n-15), but the incidence of strandings (strandings per kilome- ter of coastline) was greatest in Virginia (SIR=0.055, n=10), followed by North Carolina (SIR=0.031). South Carolina had the lowest incidence of strandings (SIR=0.003, n=l). The stranding incidence ratio for the entire study area was 0.016. All states recorded at least one stranding. There were no significant differences in stranding occurrence by season (x 2 =4.22, df=3, P=0.24) (Fig. 2). However, only 8% (3/37) of all strandings occurred during the summer (July-September). Strandings oc- curred with the greatest frequency in April (n=6) fol- lowed by February, March, and October (n=5 each), and least in July and August (n=0 each). In 1992 (the most recent year of the study), strandings were spread over a greater number of months than any of the seven previous years. Data on body length were available for 25 animals. Body length indicated all animals were sexually im- mature but none were dependent calves. Sixty-eight percent (17/25) of the animals were considered newly independent calves. Information on gender was avail- able for 26 animals. Fifty percent (13/26) were fe- male and 50% (13/26) were male. Of the 37 animals, an advanced stage of decomposi- tion eliminated 13 from analysis for potential cause of death. Four additional animals were insufficiently examined or information was inadequately reported to determine a cause of death or the presence or ab- sence of injury or scars. Of the 20 remaining ani- mals, 30% (6/20) had major injuries potentially at- tributable to a ship strike and 25% (5/20) had inju- ries consistent with possible entanglement in fish- ing gear. One animal exhibited scars consistent with past entanglement or ship strike, or both, and was emaciated at the time of stranding. Thus, up to 60% (12/20) of the sufficiently inspected animals showed signs that anthropogenic factors may have contrib- uted to or been directly responsible for their death. However, the possibility that some animals sustained body trauma after death can not be ruled out. Unfor- tunately, few animals were sufficiently necropsied to establish an unequivocal cause of death. Discussion These results suggest that stranding of humpback whales along the mid-Atlantic and southeast coastal areas of the United States has increased. All stranded animals were sexually immature and males and fe- males stranded with equal frequency. However, natu- ral mortality may show a gender bias that has been obscured by the high number of deaths potentially due to anthropogenic factors. Strandings occurred throughout the fall, winter, and spring seasons, but few strandings occurred during the summer months. There are several possible explanations for the apparent increase in strandings, including changes I .hi JA FE MA AP MY JU JL AU SP OC NO DE MONTH Figure 2 Humpback whale, Megaptera novaeangliae, strandings by month, 1985 through 1992. NOTE Wiley et al. . Stranding and mortality of Megaptera novaeangliae 199 Table 1 Humpback estimated. whale, Megaptera novaeangliae, strandings. New Jersey to south Florida, 1985-1992. unk = unknown; est = Date Location Sex Length Necropsy Carcass analyses Potential cause of death 14 Apr 85 Carolina Beach, NC 34°02'--" N 078°53'--" W unk unk no old carcass (mummy or skeleton) not included in analyses unknown 15 Feb 86 Cobb Island, VA 37°2-'--" N 075°4---" W F 10.8 m partial fresh, no obvious sign of external trauma or disease natural 07 Mar 86 N. Myrtle Beach, SC 33°48'-" N 078°44'--" W F 11.7 m yes live stranding; euthanized natural 08 Dec 88 St. Johns, FL 29°54'-" N 081°20'--" W(est) unk 7.8 m (est) no advanced decomposition unknown 14 Jan 89 St. Augustine, FL 29°55'3-" N 081°17'3" W F 7.6 m (est) unknown advanced decomposition unknown 18 Sep 89 Monmouth Beach, NJ 40°19'55" N 073°57'17" W unk 8.0 m (est) no entangled in gear, apparently anchored by gear to bottom entanglement 18 Dec 89 Assateague Island, VA 37°50'-" N 075°20'--" W F 8.7 m' yes live stranding, no external injuries noted natural 27 Jan 90 New Smyrna Beach, FL 29°00'0-" N 080°522-" W M 7.9 m yes advanced decomposition unknown 05 Feb 90 Nags Head, NC 35°56'5-" N 075°36'5-" W unk 2 11.1 m partial broken jaw bone, head damaged 3 ship strike 24 Feb 90 Corolla Beach, NC 36°15'-" N 075°46'-" W unk 9.0 m (est) unknown fresh, insufficient information unknown 24 Mar 90 Sanderling, NC 36°115-"N 075°45'2-" W unk 7.6 m - 8 m (est) no advanced decomposition unknown 01 Apr 90 Virginia Beach, VA 36°4-'~" N 075°5-'--" W F 9.6 m yes fresh, net/line marks on tail stock, right half of fluke had line marks entanglement 19 Jun 90* Virginia Beach, VA 36°56'15" N 076°03'30" W F 8.3 m yes fresh, no evidence of scars or injuries natural 20 Jun 90 Virginia Beach, VA 36°45'15" N 075°5630" W F 8.2 m yes live stranding; euthanized, rope marks on flukes, emaciated entanglement 200 Fishery Bulletin 93(1). 1995 Table 1 (continued) Date Location Sex Length Necropsy Carcass analyses Potential cause of death 19 Nov 90 Norfolk, VA 36°56'00" N 076°11'30" W M 9.5 m no various rope burns, abrasions on tail stock, rope scars on left flipper entanglement 05 Feb 91 St. Johns, FL 29°59'06" N 081°18'48" W M 9.4 m partial moderately decomposed, no external injuries noted natural 02 Mar 91 Bald Head Island, NC 33°55'0-" N 077°56'4-" W M 8.5 m no inaccessible unknown 15 Oct 91 Kill Devil Hills, NC 36°01'--" N 075°39'--" W unk 5 9.3 m 6 partial no external injuries noted natural 25 Oct 91 Nags Head, NC 35°56'5-" N 075°37 , 0-" M 9.1 m(est) no no external injuries noted natural 27 Oct 91 Bodie Island, NC 35°46'0-" N 075°29'1-" W unk 10.0 m no advanced decomposition unknown 08 Nov 91 Island Beach State Park, NJ 39°50'00" N 074°0512"W M 9.0 m yes four propeller cuts, one through the occipital condyle, were cause of death vessel strike 25 Dec 91 Carolina Beach, NC 34°01'~" N 077°54'-" W F 9.9 m no insufficient information unknown 03 Jan 92 Salvo, NC 35°20'9-" N 075°21'8-" W M 10.4 m no no external injuries noted natural 30 Jan 92 Oregon Inlet, NC 35°46'5-" N 075°31'9-" W unk unk no inaccessible unknown 14 Feb 92 Virginia Beach, VA 37-01'-" N 076°07'--" W (est) M 8.5 m ; yes left eye socket and left mandible fractured, signs of healing from injuries at point of fractures vessel strike 10 Mar 92 Avon, NC 35°20'--" N 075°21'-" W F 10.7 m partial left fluke "scalloped" possibly due to ship strike or entanglement, evidence of healed rope/net scars on caudal peduncle past entanglement or ship strike 19 Mar 92 North Core Banks, NC 35°01'1-" N 076°060-" W M 11.0 m no advanced decomposition unknown NOTE Wiley et al.: Stranding and mortality of Megaptera novaeangliae 201 Date Location Sex 14 Apr 92 St. Johns, FL 29°45--" N 081°10--" W (est) unk 16 Apr 92 Assateague Island, MD F 38°12'~" N 075°08'--" W 18 Apr 92 Southport, NC M 33°42'8-" N 77°55'4-" W 22 Apr 92 Hatteras, NC F 35°11'4-" N 075°46'3-" W 30 Apr 92 Nags Head, NC unk 35°22'--" N 075°29--" W 16 May 92 Ossabaw Island, GA M 31°45'7-" N 081°050-" W 17 May 92 St. Catherines Island, GA unk 31°38'2-" N 081°08'2-" W 22 Sep 92 Prime Hook National Wildlife Refuge, DE F 38°55'--' - N 075°05--" W 28 Sep 92 Assateague Island, VA M 37°53'--" N 075°22'~" W 09 Oct 92 Metompkin Island, VA F 37°46'-" N 075°32'--" W 22 Oct 92 Virginia Beach, VA M 36°46'15" N 075°57'02" W Table 1 (continued) Length Necropsy Carcass analyses Potential cause of death 8.6 m existing length 8.9 m 9.5 m 8.9 m yes yes 9.2 m (est) no > 7.2 m unk partial 8.3 m (est) yes 8.9 m (est)- part of head buried yes 8.7 m 9.1m yes yes advanced decomposition unknown no external trauma, but skull disarticulated, blunt trauma to left side vessel strike advanced decomposition unknown no external trauma, but extensive skeletal damage, "probably struck by boat" vessel strike advanced decomposition inaccessible unknown advanced decomposition advanced decomposition advanced decomposition unknown unknown unknown advanced decomposition "probably boat strike," 3 areas of hemorrhage noted unknown vessel strike "obvious entaglement scars" on leading edge of fluke and around caudal peduncle entanglement 1 Animal towed prior to measurement, therefore measured length may be greater than actual length. 2 Discrepancy in reported gender. Original stranding report stated female. MMEP reported male. 3 Discrepancy in reported body condition. Original stranding report stated broken jaw bone and head damage. MMEP had no report of body condition. 4 Discrepancy in reported date. Original stranding report stated 19 June 1990. MMEP reported 19 May 1990. 5 Discrepancy in reported gender. Original stranding report stated female. MMEP reported as unknown. 6 Discrepancy in reported body length. Original stranding report stated 9.3 m. MMEP reported an estimated length of 660 cm. 202 Fishery Bulletin 93(1), 1995 Table 2 Humpback whale, Megaptera novaeangliae, strandings by state; 1985 through 1992. Number of Kilometers of SIR: Number of strandings State strandings coastline km of coastline Virginia 10 180.6 0.055 North Carolina 15 485.5 0.031 Delaware 1 45.2 0.022 Maryland 1 50.0 0.020 Georgia 2 161.3 0.012 New Jersey 2 209.7 0.010 Florida 5 935.5 0.005 South Carolina 1 301.6 0.003 in observer effort, mortality factors, and whale dis- tribution. That increased observer effort could ac- count for the increase seems unlikely. The size of stranded humpback whales and both the public and media interest in such events results in few carcasses escaping notice. Additionally, strandings of finback whales, Balaenoptera physalus, over the same time period have remained relatively constant (1985 to 1988, n=10; 1989 to 1992, n=9)) (calculated from MMEP, Smithsonian Institution). An increase for this large baleen species might also be expected if the reported humpback change were due solely to in- creased observer effort. If the reported increase in strandings is not an artifact of observer effort, it may be due to an in- crease in factors resulting in mortality, an increase in the number of animals inhabiting the study area, or both. While the tonnage of cargo moving through Atlantic ports in 1989 showed a 9% increase over the mean of the previous four years (calculated from Anon., 1991), the number of vessels using the Chesa- peake Bay area, and probably the rest of the Atlan- tic coast, has decreased because ships capable of car- rying greater tonnage are being used (Pringer 3 ). While a decline in vessel traffic may result in a de- creased risk to whales, it is possible that these larger, faster, deeper draft vessels pose a greater danger than the slower, shallower draft vessels of the past. In addition to commercial shipping, some areas, such as near Chesapeake Bay and northern Florida, are subject to substantial use by military vessels. How- ever, data pertaining to trends in military vessel traf- fic were not available. Evidence also indicates that as much as 25% of the reported mortality may be attributable to inter- action with commercial fishing activ- ity, such as gill netting. North Carolina's coastal sink gillnet fishery expanded dramatically during the 1980's (Ross 4 ). South Carolina, the state with the lowest SIR, banned the commercial use of gill nets in 1987 (with the exception of a tended shad net fishery) (Moran 5 ). However, fish- ing effort in the entire study area is inadequately monitored to determine trends (Read, in press; Bisack 6 ). While changes in shipping and commercial fishing activity may rep- resent increased hazards to animals inhabiting the study area, they seem inadequate to account for the dra- matic change in stranding levels reported. Each of these hazards existed prior to 1989, the period when strandings began to increase. The most likely expla- nation for the reported increase in mortality appears to be increased use of this area by juvenile hump- back whales that are then exposed to such hazards. Although few standardized marine mammal sur- veys consistently cover the study area, anecdotal and published observations point to a recent increase in live sightings of humpback whales in coastal waters of Florida and Georgia (Kraus 7 ), North Carolina (Barrington 8 ), Virginia (Swingle et al., 1993), and Maryland (Driscoll 9 ). Although reliable estimation of the length of free-swimming whales is difficult, there is general agreement among observers that most, if not all, of the animals frequenting the area are small. Changes in humpback whale distribution in rela- tion to changes in prey composition and abundance have been demonstrated elsewhere (Payne et al., 1986; Piatt et al., 1989; Payne et al., 1990), and such a prey shift may account for or be an important fac- 3 Pringer, Captain M. Association of Maryland Pilots, Baltimore, MD 21228. Personal commun., January 1993. 4 Ross, J. L. 1989. Assessment of the sink net fishery along North Carolina's Outer Banks, fall 1982 through spring 1987, with notes on other coastal gill net fisheries. Special Sci. Rep. 50, North Carolina Dep. of Environ., Health and Nat. Resour., Moorehead City, NC, 54 p. 5 Moran, J. South Carolina Wildlife and Marine Resource De- partment, Charleston, SC 29422. Personal commun., Septem- ber 1993. 6 Bisack, K. 1992. Sink gill net fishing activity in the North At- lantic as reflected in the NEFSC weightout database: 1982- 1991. U.S Dep. Commer, NOAA, Natl. Mar. Fish.Serv. North- east Fish. Sci Cent., Woods Hole, MA 02543. Unpubl. manuscr., 4 p. 7 Kraus, S. New England Aquarium, Boston, MA 02 110. Personal commun., March 1993. 8 Barrington, P. North Carolina Aquarium, Fort Fisher, Kuri Beach, NC 28449. Personal commun., April, 1993. 9 Driscoll, C. NMFS, Office of Protected Resources, Silver Spring, MD 20910. Personal commun., March 1993. NOTE Wiley et al.: Stranding and mortality of Megaptera novaeangliae 203 tor in the change in whale distribution suggested here. While data on changes in prey distribution were not available, the first observations of winter feed- ing humpbacks were documented in the nearshore waters of Maryland (deGroot 10 ) and Virginia (Swingle et al., 1993), during the winters of 1991 and 1992. An additional possibility is that the humpback whale population in the western North Atlantic may be increasing and expanding its range such that habi- tats historically occupied are being recolonized. Sev- eral authors (Katona and Beard, 1990; Sigurjonsson and Gunnlaugsson, 1990) have reported numerical increases for this population, although this may be due to increased effort resulting in more accurate estimates of abundance. Humpback whales may have always been present during winter in offshore waters of the study area, but a shift in prey abundance or distribution, or both, may have brought them into areas where death would result in stranding, rather than have caused them to be lost at sea. However, offshore concentra- tions were not detected during 1978-82 aerial sur- veys (CeTAP 11 ) or during 1980-88 ship board sur- veys (Payne et al. 12 ). While juvenile whales can be expected to exhibit higher mortality than adults (Sumich and Harvey, 1986; Kraus, 1990a), the absence of adult animals from the stranding record may provide support for the suggestions of Swingle et al. (1993) that winter or migratory segregation, or both, is occurring. For- aging opportunities on the breeding grounds are rare (Dawbin, 1966; Baraff et al., 1991), and it may be adaptive for some juvenile animals to remain and feed in mid-latitude areas, rather than to migrate with adults. If occupying the breeding grounds is the preferred behavior, individuals remaining in higher latitude areas may be those that failed to obtain suf- ficient resources during the feeding season. Such nutritionally stressed animals may be more suscep- tible to all forms of mortality, natural or anthropo- genic. Nutritionally stressed juveniles and newly weaned calves in particular may be vulnerable to the effects of the parasitic nematode Crassicauda boopis (Lambertsen, 1992). 10 deGroot, G. 1992. A fluke of nature. The Annapolis Capital- Gazette. 10 March, p. 1. 11 CeTAP. 1982. A characterization of marine mammals and turtles in the mid- and North Atlantic areas of the U. S. outer continental shelf. Final Rep. to the Cetacean and Turtle As- sessment Program, Univ. Rhode Island, Bur. Land Manage., Contract AA551-CT8-48. U.S. Dep. Int., Wash., DC, 450 p. 12 Payne, P. M., W. Heinemann, and L. A. Selzer. 1992. A distri- butional assessment of cetaceans in shelf/shelf-edge and adja- cent slope waters of the northeastern United States based on aerial and shipboard surveys, 1978-1988. Natl. Mar. Fish. Serv., Northeast Fish. Sci. Cent,, Woods Hole, MA 02543. Unpubl. manuscr., 108 p. If winter foraging opportunities are sufficient, ju- veniles may delay their return to traditional feeding areas and may eventually occupy new habitat. This may be one mechanism by which a species establishes itself in new areas or reoccupies historic sites. This process may be reflected in the stranding record. There seems to be a progressive trend not only for an increased number of strandings but for strandings to take place in a greater variety of months. A high percentage of animals exhibited signs that anthropogenic interactions could be implicated in their death. However, there are reasons to believe that mortality estimates based on available strand- ing data could under- or overestimate the impact of human interaction. For example, stranded animals on 16 and 22 April 1992 exhibited no external signs of trauma. However, necropsies indicated internal injuries consistent with a ship strike (McLellan 13 ; Thayer 14 ), suggesting that such injuries could have escaped notice during more cursory examinations. The lack of external body trauma on animals which thorough necropsy revealed to have been killed by a ship strike has also been noted for the northern right whale, Eubalaena glacialis (Kraus 15 ). Alternatively, references to rope or net marks did not always specify whether such marks were of re- cent origin or due to past entanglement from which the animal escaped. Baleen whale entanglement does not always lead to immediate mortality (Kraus, 1990a); however, the effect of escaped entanglement on long-term survivorship or reproductive success, or both, is unknown. If rope or net marks noted in the stranding reports were of past origin, they may have been independent of the animal's death or the animal may have succumbed to the long-term effects of past entanglement. Reduced foraging efficiency during the entanglement period may be a factor in- fluencing animals to engage in winter feeding behav- ior, such as that observed in the study area by Swingle et al. (1993). The apparent high rate of interaction with com- mercial fishing and shipping, may be due, in part, to the age class inhabiting the area. Juvenile animals, and newly independent calves in particular, may be more susceptible to ship strikes or fishing gear en- tanglements, or both, owing to a lack of experience with either factor (Lien, in press). Commercial ship- ping and military traffic to and from the Chesapeake Bay passes by much of the area where strandings 13 McLellan, W. James Madison Univ., Harrisonburg, VA 22807. Personal commun., March 1993. 14 Thayer, V. Natl. Mar. Fish. Serv., Beaufort, NC 28516. Per- sonal commun., March 1993. 15 Kraus, S. New England Aquarium, Boston, MA 02110. Per- sonal commun., March 1993. 204 Fishery Bulletin 93(1), 1995 occur most frequently (Virginia and North Carolina), often in water depths of less than 20 m. In Florida, the concentration of strandings occurs in the vicinity of active commercial and military shipping and where ship strikes have been reported to represent a hazard to northern right whales (Kraus and Kenney, 1991). Entanglement in commercial fishing gear has been the most frequently identified anthropogenic cause of injury and death in humpback whales; gillnet-type gear most often was implicated (O'Hara et al., 1986). Coastal gillnet fisheries exist in the study area on a year-round basis, but effort may peak in late winter/ spring (NMFS, 1992; Swingle et al., 1993; Brooks 16 ). Over 2,200 gillnet licenses have been issued for the mid-Atlantic coastal region. However, fishermen may hold more than one permit and some coastal fisher- ies do not require permits (NMFS, 1992). In the study area, coastal gill nets and whales concurrently oc- cupy waters of less than 15 m in depth (observed by RAA and DPG), and whales have been observed trail- ing such gear (Swingle 17 ). The association of young, inexperienced whales with gill nets in shallow waters may increase the potential for entanglement incidents. Since entanglement mortality is inversely related to body size (Lien et al., 1989; Kraus 1990b), juvenile humpbacks may be more susceptible to fatalities. Data contained in this paper suggest that mid-At- lantic and southeast coastal areas of the United States are becoming increasingly important habitat for juvenile humpback whales and that anthropo- genic factors may negatively impact these animals. However, there are a number of factors that suggest caution should be used in interpretation of these data. The site of stranding is not necessarily the site of death, as the body of a large whale can be carried considerable distances by wind and currents before beaching occurs. Cause of death in the stranded ani- mals was rarely determined with certainty and in most cases was inferred from observations of the presence or absence of surface body trauma, not from thorough necropsy by experienced individuals. A greater emphasis should be placed on complete necropsies of stranded animals to determine not only the immediate cause of death but also whether there is an underlying factor in the fatality. This would allow a more reliable investigation into mortality and provide greater ability to evaluate and alleviate the impact of anthropogenic interactions. This is particu- larly important for an endangered species, such as the humpback whale. 16 Brooks, W. Florida Department of Environmental Protection, Jacksonville, FL 32216. Personal commun., September 1993. 17 Swingle, W. Virginia Marine Science Museum, Virginia Beach, VA 23451. Personal commun., March 1992. Acknowledgments The authors thank James G. Mead of the Smith- sonian Institution for access to data contained in the Marine Mammal Events Program. We also thank the many individuals who comprise the Northeast and Southeast Regional Stranding Networks. Phil Clapham, Colleen Coogan, Sharon Young, and two anonymous reviewers provided comments which greatly improved the manuscript. Literature cited Anonymous. 1991. Statistical abstract of the United States 1991. The national data book. U.S. Dep. Commer. 111:636-637. Balcomb, K., and G. Nichols. 1982. Humpback whale censuses in the West Indies. Rep. Int. Whaling Comm. 32:401-406. Baraff, L. S., P. J. Clapham, D. K. Mattila, and R. S. Bowman. 1991. Feeding behavior of a humpback whale in low lati- tude waters. Mar. Mamm. Sci. 7(2):197-202. Dawbin, W. H. 1966. Seasonal migratory cycle of humpback whales. In K. S. Norris (ed.l, Whales, dolphins and porpoises, p. 145- 170. Univ. Calif. Press, Berkeley. Hain, J. H. W., G. R. Carter, S. D. Kraus, C. A. Mayo, and H. E. Winn. 1982. Feeding behavior of the humpback whale, Megaptera novaeangliae, in the western North Atlantic. Fish. Bull. 80:259-268. Katona, S. K., and J. A. Beard. 1990. Population size, migrations and substock structure of the humpback whale [Megaptera novaeangliae) in the western North Atlantic Ocean. Rep. Int. Whaling Comm., Spec. Iss. 12:295-305. Katona, S. K.. V. Rough, and D. T. Richardson. 1983. A field guide to the whales, porpoises and seals of the Gulf of Maine and eastern Canada, Cape Cod to New- foundland. Charles Scribner's Sons, New York, 255 p. Kraus, S. D. 1990a. Rates and potential causes of mortality in North Atlantic right whales (Eubalaena glacialis). Mar. Mamm. Sci. 6:(4):278-290. 1990b. Fishery entanglements of marine mammals in the Gulf of Maine, 1975-1990. In Proceedings of the Stell- wagen Bank Conference, Univ. Massachusetts, April 26- 27, 1990. Kraus S. I)., and B. D. Kenney. 1991. Information on right whales (Eubalaena glacialis) in three proposed critical habitats in U.S. waters of the west- ern North Atlantic Ocean, 65 p. [Available from NTIS, Springfield, VA.] Lambertsen, R. H. 1992. Crassicuadosis: a parasitic disease threatening the health and population recovery of large baleen whales. Rev. Sci. Tech. Off. Int. Epiz. 11(4):1131-1141. Lien, J. In press. Entrapment of large cetaceans in passive inshore fishing gear in Newfoundland and Labrador (1979- 1990). In W. Perrin and G. Donavan (eds.), International NOTE Wiley et al.: Stranding and mortality of Megaptera novaeangiiae 205 Whaling Commission special issue on mortality of ceta- ceans in passive fishing nets and traps. Lien, J., G. B. Stenson, and I. Ni. 1989. A review of incidental entrapment of seabirds, seals and whales in inshore fishing gear in Newwfoundland and Labrador: a problem for fishermen and fishing gear designers. In J. Huntington (ed.), Proceedings of the world symposium on fishing gear and fishing vessel design, p. 67-71. Marine Institute, St. Johns, Newfoundland. Martin, A. R., S. K. Katona, D. Mattila, D. Hembree, and T. D. Waters. 1984. Migration of humpback whales between the Carib- bean and Iceland. J. Mammal. 65:330-333. Mattila, D. K., and P. J. Clapham. 1989. Humpback whales (Megaptera novaeangiiae) and other cetaceans on Virgin Bank and in the northern Leeward Is- lands, 1985 and 1986. Can. J. Zool. 67(9):2201-2211. Mattila, D. K., P. J. Clapham, S. K. Katona, and G. S. Stone. 1989. Humpback whales on Silver Bank, 1984: population composition and habitat use. Can. J. Zool. 67:281-285. Nishiwaki, M. 1959. Humpback whales in Ryukyuan waters. Sci. Rep. Whales Res. Inst. Tokyo 14:49-86. NMFS (National Marine Fisheries Service). 1992. Taking of marine mammals incidental to commer- cial fishing operations; interim exemption for commercial fisheries. NMFS Fed. Reg. Notice 57( 11 ). O'Hara, K., N. Atkins, and S. Iudicello. 1986. Marine wildlife entanglement in North Amer- ica. Center for Marine Conservation, Washington, D.C., 219 p. Payne, P. M., J. R. Nichols, L. O'Brien, and K. D. Powers. 1986. The distribution of the humpback whale, Megaptera novaeangiiae, on Georges Bank and in the Gulf of Maine in relation to densities of the sand eel, Ammodytes americanus. Fish. Bull. 84:271-277. Payne, P. M., D. N. Wiley, S. B. Young, S. Pittman, P. J. Clapham and J. W. Jossi. 1990. Recent fluctuations in the abundance of baleen whales in the southern Gulf of Maine in relation to changes in selected prey. Fish.Bull. 88:687-696. Perkins, J. S., K. C. Balcomb, G. Nichols Jr., and M. Dea villa. 1984. Abundance and distribution of humpback whales (Megaptera novaeangiiae) in west Greenland waters. Can. J. Fish. Aquat. Sci. 41:533-536. Piatt, J. F., D. A. Methven, A. E. Burger, R. L. Mclagan, V. Mercer, and E. Creelman. 1989. Baleen whales and their prey in a coastal environ- ment. Can. J. Zool. 67:1523-1530. Read, A. J. In press. Interactions between cetaceans and gill net and trap fisheries In the Northwest Atlantic. In W. Perrin and G. Donavan (eds.), International Whaling Commission, special issue on mortality of cetaceans in passive fishing nets and traps. Rice, D. W. 1963. Progress report on biological studies of the larger cetaceans in the waters off California. Norsk Hvalfangst- Tid. 52:181-187. Ringold, P. L., and J. Clark. 1980. The coastal almanac for 1980-the year of the coast. W.H. Freeman and Company, San Francisco, 172 p. Sigurjonsson, J., and T. Gunnlaugsson. 1990. Recent trends in the abundance of blue (Balaenoptera musculus) and humpback whales (Megaptera novaeangiiae) off west and southwest Iceland based on systematic sightings records with a note on the occurence of other ce- tacean species. Rep. Int. Whaling Comm. 40:537-51. Sokal, R. R, and F. J. Rohlf. 1981. Biometry, 2nd ed. W. H. Freeman and Co., San Fran- cisco, 859 p. Sumich, J. L., and J. T. Harvey. 1986. Juvenile mortality in gray whales (Eschrichtius robustus). J. Mammal. 67:179-182. Swingle, W. M., S. G. Barco, T. D. Pitchford, W. A. McLellan, and D. A. Pabst. 1993. Appearance of juvenile humback whales feeding in the nearshore waters of Virginia. Mar. Mamm. Sci. 9 (3):309-315. Woodhouse, C. D. 1991. Marine mammal beachings as indicators of popula- tion events. In J. E. Reynolds and D. K. Odell (eds.), Marine mammal strandings in the United States: proceed- ings of the second marine mammal stranding workshop; 3-5 Dec. 1987, Miami, FL, p. 111-116. U.S. Dep. Commer., NOAA Technical Report NMFS 98. Publication Awards, 1 993 National Marine Fisheries Service, NOAA The Publications Advisory Committee of the National Marine Fisheries Service is pleased to announce the awards for best publications authored by NMFS sci- entists and published in the Fishery Bulletin for Volume 9 1 and in the Marine Fisheries Review for Volume 54. Eligible papers are nominated by the Fisheries Science Centers and Regional Offices and are judged by the NMFS Editorial Board. Only articles that significantly contribute to the understanding and knowl- edge of NMFS-related studies are eligible. We offer congratulations to the fol- lowing authors for their outstanding efforts. Fishery Bulletin, Volume 91 Outstanding Publication Ambrose Jearld Jr., Sherry L. Sass, and Melinda F. Davis Early growth, behavior, and otolith development of the winter flounder Pleuronectes americanus. Fish. Bull. 91:65-75. Ambrose Jearld is with Northeast Fisheries Science Center, Woods Hole, Massachusetts. Sherry Sass is with the Division of Marine Fish- eries, Sandwich, Massachusetts. Melinda Davis is with Fort Valley State College, Fort Valley, Georgia. Marine Fisheries Review, Volume 54 Outstanding Publication Thomas K. Wilderbuer, Gary E. Walters, and Richard G. Bakkala Yellowfin sole, Pleuronectes asper, of the east- ern Bering Sea: biological characteristics, history of exploitation, and management. Mar. Fish. Rev. 54(4): 1-18. Thomas Wilderbuer and Gary Walters are with the Alaska Fisheries Science Center, Seattle, Washington. Richard Bakkala is a retired fishery biologist who was formerly with the Alaska Fish- eries Science Center, Seattle, Washington. Honorable Mention Michael H. Prager and Alec D. MacCall Detection of contaminant and climate effects on spawning success of three pelagic fish stocks off southern California: Northern anchovy Engraulis mordax, Pacific sardine Sardinops sagax, and chub mackerel Scomber japonicus. Fish. Bull. 91:310-327. Michael Prager is with the Southeast Fish- eries Science Center, Miami, Florida. Alec MacCall is with the Southwest Fisheries Sci- ence Center, Tiburon, California. Honorable Mention Carl. J. Sindermann Disease risks associated with importation of nonindigenous marine animals. Mar. Fish. Rev. 54(3): 1-10. Carl Sindermann is with the Northeast Fish- eries Science Center, Oxford, Maryland. 207 Superintendent of Documents Subscriptions Order Form Order Processing Code: *5178 Charge your order. It's Easy! □ YES, enter my subscription as follows: To fax yQm orders (202) 512 _ 22 33 subscriptions to FISHERY BULLETIN (FB) for $27.00 per year ($33.75 foreign). The total cost of my order is $ . Price includes regular domestic postage and handling and is subject to change. Please Choose Method of Payment: I I Check Payable to the Superintendent of Documents ~^\ GPO Deposit Account H - E (Company or Personal Name) (Please type or print) (Additional address/attention line) (Street address) (City, State, ZIP Code) (Daytime phone including area code) VISA or MasterCard Account I I I I I I Thank you Jor (Credit card expiration date) , , your order! (Purchase Order No.) May we make your name/address available to other mailers? |~ (Authorizing Signature) 11 Mail To: New Orders, Superintendent of Documents P.O. Box 371954, Pittsburgh, PA 15250-7954 U.S. Department of Commerce Seattle, Washington Volume 93 Number 2 April 1995 Fishery Bulletin Contents Marina Biological Laboratory/ Wood* Hot* Oceanographic Institution Library 209 APR 6 1995 Woods Hole, MA 02543 The National Marine Fisheries Service (NMFS) does not approve, recommend, or endorse any proprietary product or proprietary material mentioned in this publication. No reference shall be made to NMFS, or to this publication furnished by NMFS, in any advertising or sales promotion which would indicate or imply that NMFS approves, recommends, or endorses any proprietary product or proprietary material mentioned herein, or which has as its purpose an intent to cause directly or indirectly the adver- tised product to be used or purchased because of this NMFS publication. 217 231 254 262 274 290 299 Articles Ahrenholz, Dean W, Gary R. Fitzhugh, James A. Rice, Stephen W. Nixon, and Wilson C. Pritchard Confidence of otolith ageing through the juvenile stage for Atlantic menhaden, Brevoortia tyrannus Bisbal, Gustavo A., and David A. Bengtson Description of the starving condition in summer flounder, Paralichthys dentatus, early life history stages Doyle, Miriam J., William C. Rugen, and Richard D. Brodeur Neustonic ichthyoplankton in the western Gulf of Alaska during spring Epperly, Sheryan P., Joanne Braun, and Alexander J. Chester Aerial surveys for sea turtles in North Carolina inshore waters Felley, James D., and Michael Vecchione Assessing habitat use by nekton on the continental slope using archived videotapes from submersibles Fisher, Joseph P., and William G. Pearcy Distribution, migration, and growth of juvenile Chinook salmon, Oncorhynchus tshawytscha, off Oregon and Washington Helser, Thomas E., and Daniel B. Hayes Providing quantitative management advice from stock abundance indices based on research surveys Norton, Elizabeth C, and R. Bruce MacFarlane Nutritional dynamics of reproduction in viviparous yellowtail rockfish, Sebastes flavidus Fishery Bulletin 93(2), 1994 308 Restrepo, Victor R., and Christopher M. Legault Approximations for solving the catch equation when it involves a "plus group" 315 Rutherford, Edward S., and Edward D. Houde The influence of temperature on cohort-specific growth, survival, and recruitment of striped bass, Morone saxatilis. larvae in Chesapeake Bay 333 Theilacker, Gail H., and Steven M. Porter Condition of larval walleye pollock, Theragra chalcogramma, in the western Gulf of Alaska assessed with histological and shrinkage indices 345 Wade, Paul R. Revised estimates of incidental kill of dolphins (Delphinidae) by the purse-seine tuna fishery in the eastern tropical Pacific, 1959-1972 355 Yano, Kazunari, and Marilyn E. Dahlheim Killer whale, Orcinus orca, depredation on longline catches of bottomfish in the southeastern Bering Sea and adjacent waters 373 Zeldis, John R., Paul J. Grimes, and Jonathan K. V Ingerson Ascent rates, vertical distribution, and a thermal history model of development of orange roughy, Hoplostethus atlanticus, eggs in the water column Notes 386 Carlson, H. Richard Consistent yearly appearance of age-0 walleye pollock, Theragra chalcogramma, at a coastal site in southeastern Alaska, 1 973-1 994 391 Fenton, Gwen E., and Stephen A. Short Radiometric analysis of blue grenadier, Macruronus novaezelandiae, otolith cores 397 Garduho-Argueta, Hector, and Jose A. Calderon-Perez Seasonal depth distribution of the crystal shrimp, Penaeus brevirostris (Crustacea: Decapoda, Penaeidae), and its possible relation to temperature and oxygen concentration off southern Sinaloa, Mexico 403 Hernandez-Garcia, Vincente The diet of the swordfish Xiphias gladius Linnaeus, 1 758, in the central east Atlantic, with emphasis on the role of cephalopods 412 Kohler, Nancy E., John G. Casey, and Patricia A. Turner Length-weight relationships for 1 3 species of sharks from the western North Atlantic 419 Pepin, Pierre An analysis of the length-weight relationship of larval fish: limitations of the general allometric model Abstract. — The periodicity of increment formation and our abil- ity to enumerate increments in sag- ittal otoliths of Atlantic menhaden are evaluated from hatching through a nine-month period. We studied otoliths from one group of field-col- lected larvae that was marked by immersion in oxytetracycline (OTC ) and from a second group that was marked by immersion in alizarin complexone (ALC). Additionally, otoliths from known-age juveniles resulting from an Atlantic menha- den laboratory spawning and rear- ing experiment were examined. We determined that, on the average, larval and juvenile Atlantic men- haden form one growth increment per day. We were able to age juve- nile menhaden reliably up to 200 days old within a confidence inter- val (CI) of about 7 days and up to 250 days old within a CI of about 16 days. We hypothesized that growth rates may have impacted the periodicity of increment formation, as well as our ability to count them accurately. The statistically stron- gest results were obtained from the ALC-marked fish, which were reared outdoors and displayed growth rates (0.67 to 0.95 mm-day- 1 ) similar to higher rates observed for juveniles captured from estuarine nursery areas. The periodicity of increment counts for the ALC-marked fish was less than one per day when growth rates were observed to be less than 0.3 mm-day -1 . Increments in otoliths from the known-age and OTC-marked fish, which were reared indoors, had lower contrast than their outdoor-reared counter- parts. Otoliths were sectioned for enumeration on both a transverse and oblique-transverse plane. With minor exception, no differences in age estimation could be attributed to the orientation of the sections. Confidence of otolith ageing through the juvenile stage for Atlantic menhaden, Brevoortia tyrannus Dean W. Ahrenholz Beaufort Laboratory, Southeast Fisheries Science Center National Marine Fisheries Service. NOAA 101 Pivers Island Road, Beaufort, NC 28516-9722 Gary R. Fitzhugh James A. Rice Stephen W. Nixon Department of Zoology, North Carolina State University RO. Box 7617, Raleigh, NC 27695-7617 Wilson C. Pritchard Beaufort Laboratory, Southeast Fisheries Science Center National Marine Fisheries Service, NOAA 101 Pivers Island Road, Beaufort, NC 28516-9722 Manuscript accepted 21 September 1994. Fishery Bulletin 93:209-216 ( 1995). The daily age information obtained from larval and juvenile fish oto- liths is a valuable tool for studies of early life history and factors affect- ing recruitment (Jones, 1992). Daily age information is necessary for backcalculating cohort-specific spawning dates and is the best ap- proach for estimating mortality and growth rates in young fish (Essig and Cole, 1986; Pepin, 1989; Jones, 1992). A prerequisite, however, is the validation of the temporal peri- odicity of otolith increment forma- tion (Geffen, 1992). While the otolith approach to determination of vital rates has successfully been applied to larval fish, use of otoliths for the juvenile stage has been more controversial, often because of ad- ditional requirements of otolith preparation, including sectioning and polishing of otoliths, and be- cause of increased uncertainty in age estimations and back-calcula- tions of size at age (cf. Rice, 1987; Mosegaard, 1990; Jones, 1992). Many validation studies have de- termined that increments are, on average, daily in periodicity (cf. Jones, 1986), but conditions affect- ing a low growth rate, for example, can result in increment periodicity other than a daily one (Geffen, 1992) or can result in difficulty in the detection of daily increments (Campana, 1992). Therefore ageing error commonly increases with age and otolith size as increment widths decrease with decreasing growth rates, resulting in greater uncer- tainty of ages, growth rates, and birthdates (Rice et al., 1985; Rice, 1987; Campana and Jones, 1992). We examined conditions where con- fidence about the assumption of daily ring deposition may be low and what the consequence would be of increased ageing error on age es- timation for Atlantic menhaden, Brevoortia tyrannus. Larger, older otoliths are more difficult to prepare and read. To address this issue, we also exam- 209 210 Fishery Bulletin 93(2). 1995 ined the efficacy of sectioning and polishing juvenile menhaden otoliths on two orientations of transverse planes. Greater attention to otolith preparation can significantly improve ageing accuracy (Campana and Moksness, 1991), and section orientation can affect the ability to read otoliths (Secor et al., 1992). Previous menhaden validation studies have used only a minor amount of otolith processing, and the material has been examined on the sagittal plane. Maillet and Checkley ( 1990 ) and Warlen ( 1992 ) used known-age, lab-spawned and reared larvae, whereas Simoneaux and Warlen (1987) examined the outer- most growth increments of juvenile Atlantic menha- den injected with oxytetracycline (OTC). Maillet and Checkley ( 1990) examined growth/increment forma- tion from hatching through 36 days of age, Warlen (1992) through 41 days of age, and Simoneaux and Warlen (1987) used juveniles (63-98 mm in fork length) with an experimental duration of 7-14 days after marking with OTC. With the exception of one test group (Maillet and Checkley, 1990), results of all studies indicated that, on average, one growth increment was formed daily. However, these approaches have not resulted in a method that will permit precise and accurate ageing of older juvenile Atlantic menhaden otoliths. While Simoneaux and Warlen ( 1987) were able to validate the daily periodicity of increment formation for a short period of time, their otolith processing method could not be used to determine the actual age of the juveniles examined. The periodicity of increment for- mation in otoliths should be validated over the ranges in age and size that can potentially be encountered with unknown-age, field-collected material. We use two of the preferred validation methods, known-age and otolith-marking, to bridge the gap in age and size among the studies of Maillet and Checkley ( 1990), Warlen ( 1992), and Simoneaux and Warlen (1987) and to provide an estimate of the un- certainty in deriving age from older juveniles. Our known-age study provides a continuous validation from first feeding through metamorphosis, to juve- niles up to 9 months old. 52 to 136 days after hatching, then preserved in 70% ethyl alcohol. Oxytetracycline (OTC) marked fish In 1988, larval Atlantic menhaden collected at Pivers Island, Beaufort, North Carolina, were acclimated to 100-L indoor laboratory tanks and immersed on 7 April in OTC by a procedure modified from Hettler ( 1984). Salinity was slowly reduced to 0%c by adding tap (well) water over several hours. A premixed, buff- ered (sodium bicarbonate) stock solution of OTC was added to the tank. The resulting treatment condi- tions were 300 mg-L" 1 OTC at pH 6.3. After four hours of immersion, ambient seawater flow was restored; the test solution was thus diluted within an hour and salinity slowly increased. The fish remained in this tank for the duration of the study. Samples of postlarvae and juveniles were taken periodically, 13 to 147 days following treatment, and preserved in 95% ethyl alcohol. Alizarin complexone (ALC) marked fish In 1992 we conducted validation trials with marked fish under high and low feeding rations to examine further the effect of growth rate on increment depo- sition. Larval menhaden were captured with a neus- ton net at Pivers Island, NC, on 1 April 1992 and held at ambient temperatures and salinities until 21 April, then immersed for 14 hours in 100 mg-L -1 ALC buffered with sodium bicarbonate to pH 6.5. After immersion, 1,026 larval menhaden were divided be- tween two 2, 100-L outdoor holding tanks and sampled monthly, May through December. The lar- vae were fed cultured, live Artemia franciscana and increasing additions of dry food until 29 May, when only dry food (Ziegler salmon starter) was added in a ratio of 3 (high food tank) to 1 (low food tank). The amount of dry food initially added for the low food treatment was 25 mLday -1 in April; this amount was increased to approximately 90 mLday -1 by July and held constant after this period. Materials and methods Known-age fish Atlantic menhaden brood stock were held in the labo- ratory and induced to spawn in February 1987 by Hettler 's (1981) methods. Eggs were hatched and larvae were reared under laboratory conditions as described by Warlen (1992). Samples of postlarvae and later juveniles were sampled periodically from Otolith preparation and increment counting Some otoliths from late larvae were mounted whole in a mounting medium (Flo-tex) on glass microscope slides. After increments were counted on the sagit- tal plane, many were removed from the mounting medium and sectioned on one of two planes as de- scribed below. We generally followed the sectioning techniques described in Epperly et al. (1991) and Secor et al. (1992). Our processing techniques for the ALC- Ahrenholz et al.: Otolith ageing of Brevoortia tyrannus 21 marked group were altered: otoliths were dissected from each fish without bleaching (i.e. without a 59c sodium hypochlorite solution to remove tissue) and serial sectioning was used for the transverse sections rather than single cuts with dual blades. Two sec- tioning orientations were used: a transverse section, taken with the primordium (and focus) as the centerline, on a proximal-distal plane 90° to the an- terior-posterior axis, and an oblique-transverse sec- tion on a proximal-distal plane from a posterior and dorsal position through the focus to the anterior ventral(most) portion (Fig. 1). (Some otoliths were also examined on an unsectioned, sagittal plane.) Transverse sections were taken on the right sagitta and oblique sections were taken on the left, with the exception of the 1992 ALC-marked material for which selection of the right or left sagitta was randomized. Resulting sections were then ground and polished according to the methods of Epperly et al. (1991) and Secor et al. (1992). For otolith terminology and in- crement interpretation we followed Pannella ( 1980) and Campana ( 1992). Oxytetracycline and alizarin complexone marks were located with blue light epifluoresence on pre- pared otolith sections and viewed directly on a com- pound microscope or on a video image analysis sys- tem. The OTC-marked increment(s) fluoresced yel- low-green when illuminated with blue light (Fig. 2) and the ALC-marked zone fluoresced orange. The position of each fluorescing mark was fixed with the aid of an ocular micrometer (scope viewing) or with a pointer on the viewing screen; increment counts were made with white or polarized light. Otolith sec- tions viewed on a video monitor were magnified to l,500x. Since only a fraction of a section would fill the screen at this magnification, increment count- ing was done stepwise between distinguishable fea- tures or "landmarks," and counts were summed when interpretation was complete. An additional series of increment counts was performed with the microscope at l,000x and by tallying counts blindly on a hand- held counter. Agreement between the two methods on enumeration generally was better than 95%. Fi- nal counts were means from the two enumeration Figure 1 A whole sagittal otolith from a 39.0-mm (0.481-g) juvenile Atlantic menhaden, Brevoortia tyrannus, is shown to demonstrate the orientation of sectioning for this study. Transverse (dotted lines) and oblique-transverse (dashed lines) sections are displayed. The otolith is oriented with the dorsal edge up and the anterior to the right. 212 Fishery Bulletin 93(2). 1995 methods. Mean counts from the known-age fish were increased by five to estimate time from spawning rather than from first feeding (Warlen, 1992). ALC- marked material was viewed under a microscope at 400-lOOOx, counted with a hand-held counter, and the median of five serial counts was taken. Statistical analysis Regression and analysis of covariance (ANCOVA) computations were conducted with SAS statistical programs (SAS Institute, Inc., 1985). Analysis of co- variance was used to test for common regression B Figure 2 Photomicrographs of juvenile Atlantic menhaden, Brevoortia tyrannus, sagittal otolith sections showing fluo- rescent marks (arrows). (A) Transverse section of otolith from a post-larval fish 12 days after immersion in alizarin complexone solution (ALC). The maximum dimension of this section (dorsal/ventral) is 462 urn. (B) Oblique-trans- verse section of otolith from a juvenile 42 days after im- mersion in oxytetracycline solution (OTC). The maximum dimension of this section ( posterior-dorsal/anterior- ventral ) is 938 urn. parameters (ring count versus known days) for the low and high food treatments and between transverse and oblique-transverse sectioned material for each marking-validation method (Ott, 1977). Mean growth rates were estimated as the slopes of simple linear regressions of length on age. We tested the null hypothesis that growth incre- ments in otoliths of larval and juvenile Atlantic men- haden are formed daily The null hypothesis is ac- cepted if the regression of estimated increment count on known age in days since marking is significant, the slope is not significantly different from one, and the intercept is not significantly different from zero. We also calculated the appropriate statistical power to detect a relatively small difference from a slope of one (Rice, 1987). Student's-^ test was used to test for significance of the slope and intercept. Statistical power to determine a deviation of 0.1 (a=0.05) from a slope of one was estimated for each linear regres- sion (Rice, 1987; Neter et al., 1989). Results Otolith preparations were generally readable for the ranges in sizes and ages for the elapsed times. Known-age fish were sampled at ages 52, 66, 81, 122, 131, 132, and 136 days; they ranged from 10 to 64 mm in fork length. Mean growth for the known age group was 0.55 mm-d -1 , with a standard error (SE) of 0.048 over the interval from March to June. OTC- treated fish were sampled 13, 18, 42, 110, and 147 days after treatment; they ranged from 27 to 98 mm in fork length and ranged in estimated age from 62 to 130 days with a mean age of 103 days at marking, resulting in mean growth of 0.49 mm-d -1 (SE=0.011) for the interval April to August. ALC-marked fish were sampled 12, 42, 71, 100, 131, 161, 190, 205, and 237 days after treatment; they ranged from 26 to 175 mm FL and were approximately 70 days old at mark- ing. Mean growth rates of the ALC-marked fish were 0.67 and 0.95 mm-d- 1 (SE=0.020 and 0.015) through day 131 postmarking in low and high food tanks re- spectively Growth visibly declined for the interval from day 161 to day 237 postmark and was 0.29 mm-d -1 for both the low and high food treatments (SE=0.037 and 0.195). It was readily apparent from scatter plots that the ALC growth-increment count beyond day 131 (day 161 to day 237) postmark was less than one per day and the variance about an individual sampling date substantially greater. We pooled data up through day 131 postmark from the ALC high and low food treat- ments because tests for homogeneity of the result- ing slopes (P=0.667) and intercepts (P=0.831 ) for age- Ahrenholz et al.: Otolith ageing of Brevoortia tyrannus 213 increment count regressions (transverse sections) revealed that these parameters were not significantly different between treatments. We tested for the homogeneity of slopes for the in- crement count-age regressions between sectioning orientations separately for the known-age experi- ment and both of the marking experiments. None of the slopes were significantly different (P for known age=0.0583, for OTC=0.188, and for ALC=0.667). Tests for differences in intercepts for the same ex- perimental sets revealed none (P for known age=0.345, for OTC=0.082, and for ALO0.526). Therefore we pooled the increment count results within each experiment. We used regressions to compare the results for the known-age and chemically marked otoliths for about the same time duration (i.e. 136 days for known-age fish, 147 days for the OTC group, and 131 days for the ALC group; Table 1, Fig. 3). The intercepts of the three increment-count regressions were not signifi- cantly different from zero, and none of the three slope estimates were significantly different from 1.0 (Table 1). The results for the ALC and the OTC groups had sufficient power (>0. 80) to detect a difference in slope of 0.1 from a value of 1.0. The standard error of the slope was relatively greater for the known-age group, and thus the power estimate was less than that for the ALC and OTC groups (Table 1). We examined the results from day 161 to 237 for the ALC experiment in parallel fashion. A test for homogeneity of slopes for increment count on days postmark revealed a (marginally) significant differ- ence between the sectioning orientations (P=0.044). Estimates of the slopes from separate regressions for the oblique-transverse and transverse sections were significantly different from 1 (P=0.016 andP<0.001). While these observations begin to define limits for applying daily ageing techniques to juvenile Atlan- tic menhaden, they do not reduce the usefulness of the technique over a relatively broad time period. With the minor exception of the period when incre- ment counts were less than daily in the ALC trial, the results for the ALC-marked and OTC-marked test groups were equivalent for either section orientation with slopes near one and with good statistical power to detect a small deviation from one (Fig. 3, Table 1 ). Discussion Atlantic menhaden, on the average, form one growth increment per day through at least an estimable age of 200 days (131 days postmark + approximately 70 days in age at marking) and a size of nearly 150 mm fork length. We could reliably age menhaden up to 200 days old to within about 7 days when juvenile growth rates were high (e.g. above 0.6 mm-d -1 over summer months). At moderate juvenile growth rates (approximately 0.5 mm-d -1 ), we still detected incre- ments at approximately one per day through a 250 day time period for the OTC fish ( 147 days postmark + an average of 103 days of age at marking), but the variability of an individual age estimate increased in comparison with fish with higher growth rates. For the OTC and known-age test groups respectively, 95% confidence intervals increased to approximately ±16 and 21 d for similar-aged menhaden with slower growth rates (Table 1, Fig. 3). As growth rates de- clined further (below 0.3 mm-d -1 ), our increment counts declined to less than one per day, and vari- ability in estimated age increased; this may be due to decreases in increment width or to reduced peri- odicity as has been found for starved larval Atlantic menhaden (Maillet and Checkley, 1990). After day 131 postmark (ALC), declining growth rates and an increment periodicity of less than one per day (Fig. Table 1 Least squares linear regression analysis for increment counts from known-age, oxytetracycline (OTC) marked and alizarine (ALC) marked Atlantic menhaden, Brevoortia tyrannus. otolith sections. The null hypotheses tested are that the intercept=0 and the slope=l. (SE=standard error.) Test group n r 2 Intercept SE P Slope SE P %Power' 95%CI 2 Known-age 37 0.92 -5.853 5.149 0.263 1.036 0.053 0.501 45.1 21 Tetracycline-marked 34 0.97 1.796 2.139 0.407 0.949 0.027 0.068 94.9 16 Alizarine-marked 3 84 0.99 0.634 0.701 0.368 0.990 0.008 0.215 >99.9 7 ' Estimate of percent statistical power to detect a deviation of 0.1 from a slope of one at the P = 0.05 level. 2 95% confidence interval (±days) for an age estimate based on individual ring counts. The 95% confidence intervals for indi- vidual age estimates were constant over the range of values used to generate the regression. 3 Through day 131 postmark. 214 Fishery Bulletin 93(2). 1995 3, bottom graph) corresponded with declining tank temperatures (beginning in September; Fig. 4). How- ever, age could still be estimated within about 3 weeks up to 300 days after hatching (230 days post- mark plus about 70 days in age at marking; Fig. 3). If this relationship were consistently repeatable, it would still be a useful tool for estimating ages of older juveniles, even though the age-ring count relation- ship was well below 1:1. However, we suspect that this change was not so much a function of age as it 140 Known -age o o^ 120 '"5 • 100 O sS' 80 • %^ 60 : o 2 40 • 20 160 140 120 100 1 00 1 50 Days postmark Figure 3 Estimated number of otolith growth increments against elapsed time in days (known age) or days postmark (oxytetracycline [OTC] or alizarin complexone [ALC]) of juvenile Atlantic menhaden, Brevoortia tyrannus. Results from oblique-transverse sections (open circles) and trans- verse sections (closed circles) are pooled for the regression lines shown. The regression coefficients are given in Table 1. (Results for the alizarin-complexone trial for days 161- 237, where increment formation rates were less than daily, are shown on the upper right of the bottom graph. Regres- sion parameters for the oblique-transverse (dashed line) and the transverse (solid line) data sets respectively, are r 2 =0.81 and 0.79, intercept=39.62 and 62.76, and slope=0.73 and 0.52.) was a result of reduced growth rate, possibly in con- junction with declining temperature, which affected our ability to accurately estimate ages. Savoy and Crecco ( 1987 ) also showed that reduced rearing tem- peratures can reduce growth rate and subsequently result in a count-age slope below 1.0 for larval Ameri- can shad, Alosa sapidissima. The growth rates offish treated with ALC (through day 131 post-ALC-mark) are comparable with obser- vations for upper growth rates of juveniles in tidal creeks, spring through fall (0.7 to 0.83 mmd" 1 ; Kroger et al., 1974). The laboratory-reared fish had lower growth rates, but their rates were still greater than those for the ALC fish following postmarking day 131. Therefore it appears that reduced growth rate was a contributing factor for the higher vari- ance of our estimates of the slope of counts versus days for our known-age and OTC test groups. Simi- larly, the variances for the ALC group were highest during the period when increments displayed a less than daily periodicity (Fig. 3). 25 i 50 75 100 Day; i 125 150 postmark i 175 i 200 i 225 i 250 i May July Sep. Npv. Dec. Figure 4 (A) Mean fork length of juvenile Atlantic menhaden, Brevoortia tyrannus (error bars represent ±1 standard deviation ),and (B) tank water temperatures for the alizarin complexone rearing trial (see bottom graph on Fig. 3). Ahrenholz et al. : Otolith ageing of Brevoortia tyrannus 215 The otolith sections of the laboratory-reared ma- terial, which includes the OTC fish following mark- ing, generally had less contrast between alternating bands than did field material. Warlen (1988) noted similar results for gulf menhaden. This was not the case for the ALC fish, where contrast more closely resembled field material. OTC and known-age speci- mens were raised indoors in relatively small ( 100 L) containers, as compared with the larger (2,100 L) outdoor containers used for the ALC fish. (All groups were reared in ambient sea water.) Problems in vali- dating otoliths with laboratory-reared fish have been noted for other species (Campana and Moksness, 1991; Toole et al., 1993). Pannella ( 1980) notes that the transition between increments are unclear with respect to chemical or structural changes in some laboratory-reared material. It may be that otoliths from laboratory-reared specimens are less typical because of confounding effects from container size, growth rates, and other aspects of the rearing condi- tions. The poorer contrast may result in lower accu- racy and precision in increment counting, and the slower growth may result in more variable increment counts for a given time period. We obtained detectable OTC and ALC marks in viewing otoliths with the dosages used for immers- ing larvae. Because of the color contrast of the or- ange-against-blue background, ALC was visibly easier to detect under blue light fluoresence than was OTC. ALC has been used for marking eggs and hard parts in fish; it leaves a brilliant mark, does not ad- versely affect growth at low dosages, and does not require dilution procedures as does OTC (Tsukamoto, 1988; Kishiro and Nakazono, 1991). Although we obtained similar results using either oblique-transverse or transverse sections for those periods when increment formation is on the average one per day, one orientation or the other may be pre- ferred for various reasons. The oblique-transverse method of sectioning may be easier to complete in polishing because the primordium and focus can be detected from a greater distance (thickness) when the material is viewed. This reduces processing time and minimizes the number of overground, unusable preparations. On transverse sections of larger or older individuals, or both, the focus is located more by the outline shape than by early optical discovery. However, some investigators using increment measurements for size back calculation or discriminant analysis may pre- fer the transverse section for ease in keeping the same plane of measurement from otolith to otolith. The two section orientations were useful for cross comparisons and interpretation of certain growth zones. Therefore choice of orientation should depend upon the material being examined and the questions being addressed. Acknowledgments The oxytetracycline experiment was conducted by Robert M. Lewis and James F. Guthrie. The known- age fish, obtained from a spawning conducted by William F. Hettler, were kindly provided by Stanley M. Warlen, and were cared for by Sheryan P. Epperly and Ronald M. Clayton. Valerie Comparetta cared for the menhaden from the alizarin complexone rear- ing trial. Many of the marked otoliths were sectioned and polished by Theresa V. Henley and Robin T. Cheshire. Douglas S. Vaughan assisted us with the statistical power computations. This study was par- tially supported by Grant NA16RG0492 from the Coastal Ocean Program, South Atlantic Bight Recruit- ment Experiment (SABRE), of the National Oceanic and Atmospheric Administration to the North Caro- lina Sea Grant College program. Literature cited Campana, S. E. 1992. Measurement and interpretation of the microstruc- ture of fish otoliths. Can. Spec. Publ. Fish. Aquat. Sci. 117:59-71. Campana, S. I'.., and E. Moksness. 1991. Accuracy and precision of age and hatch date esti- mates from otolith microstructure examination. ICES J. Mar. Sci. 48:303-316. Campana, S. E., and C. M. Jones. 1992. Analysis of otolith microstructure data. Can. Spec. Publ. Fish. Aquat. Sci. 117:73-100. Epperly, S. P., D. W. Ahrenholz, and P. A. Tester. 1991. A universal method for preparing, sectioning and polishing fish otoliths for daily ageing. Dep. Commer., NOAATech. Memo. NMFS-SEFC-283, 15 p. Essig, R. J., and C. F. Cole. 1986. Methods of estimating larval fish mortality from daily increments in otoliths. Trans. Am. Fish Soc. 115:34-40. Geffen, A. J. 1992. Validation of otolith increment deposition rate. Can. Spec. Publ. Fish. Aquat. Sci. 117:101-113. Hettler, W. F. 1981. Spawning and rearing Atlantic menhaden. Prog. Fish-Cult. 43:80-84. 1984. Marking otoliths by immersion of marine fish larvae in tetracycline. Trans. Am. Fish. Soc. 113:370-373. Kishiro, T., and A. Nakazono. 1991. Seasonal patterns of larval settlement and daily otolith increments in the temperate wrasse Halichoeres tenuispinis. Nippon Suisan Gakkaishi 56:409-415. Kroger, R. L., J. F. Guthrie, and M. H. Judy. 1974. Growth and first annulus formation of tagged and untagged Atlantic menhaden. Trans. Am. Fish. Soc. 103:292-296. Jones, C. 1986. Determining age of larval fish with the otolith incre- ment technique. Fish. Bull. 84:91-103. 1992. Development and application of the otolith increment technique. Can. Spec. Publ. Fish. Aquat. Sci. 117:1-11. 216 Fishery Bulletin 93(2), 1995 introduction to statistical methods and data Wadsworth Publ. Co., Belmont, CA, 730 p. Maillet, G. L., and D. M. Checkley Jr. 1990. Effects of starvation on the frequency of formation and width of growth increments in sagittae of laboratory- reared Atlantic menhaden Brevoortia tyrannus larvae. Fish. Bull. 88:155-165. Mosegaard, H. 1990. What is reflected by otolith size at emergence? — A reevaluation of the results in West and Larkin ( 1987). Can. J. Fish. Aquat. Sci. 47:225-228. Neter, J., W. Wasserman, and M. H. Kutner. 1989. Applied linear models, 2nd ed. Irwin, Homewood, IL, 667 p. Ott, L. 1977. An analysis. Pannella, G. 1980. Growth patterns in fish sagittae. In D. C. Rhoads and R. A. Lutz (eds.), Skeletal growth of aquatic organ- isms, p. 519-556. Plenum Press, New York. Pepin, P. 1989. Using growth histories to estimate larval fish mor- tality rates. Rapp. P.-V. Reun. Cons. Int. Explor. Mer 191:324-329. Rice, J. A. 1987. Reliability of age and growth rate estimates from otolith analysis. In R. C. Summerfelt and G. E. Hall (eds.), Age and growth of fish, p. 167-176. Iowa State Univ. Press, Ames, IA. Rice, J. A., L. B. Crowder, and F. P. Binkowski. 1985. Evaluating otolith analysis for bloater Coregonus hoyi: do otoliths ring true? Trans. Am. Fish. Soc. 114:532-539. SAS Institute, Inc. 1985. SAS/STAT Guide for personal computers, version 6 ed. SAS Inst., Inc., Cary, NC, 378 p. Savoy, T. F., and V. A. Crecco. 1987. Daily increments on the otoliths of larval American shad and their potential use in population dynamics studies. In R. C. Summerfelt and G. E. Hall (eds.), Age and growth of fish, p. 167-176. Iowa State Univ. Press, Ames, IA. Secor, D. II., J. M. Dean, and E. H. Laban. 1992. Otolith removal and preparation for microstructural examination. Can. Spec. Publ. Fish. Aquat. Sci. 117:19-57. Simoneaux, L. F., and S. M. Warlen. 1987. Occurrence of daily growth increments in otoliths of juvenile Atlantic menhaden. In R. C. Summerfelt and G. E. Hall (eds.), Age and growth offish, p. 443-451. Iowa State Univ. Press, Ames, IA. Toole, C. L., D. F. Markle, and P. M. Harris. 1993. Relationships between otolith microstructure, microchemistry, and early life history events in Dover sole, Microstomias pacifieus. Fish. Bull. 91:732-753. Tsukamoto, K. 1988. Otolith tagging of ayu embryo with fluorescent substances. Nippon Suisan Gakkaishi 54:1289-1295. Warlen, S. M. 1988. Age and growth of larval gulf menhaden, Brevoortia patronus, in the northern Gulf of Mexico. Fish. Bull. 86:77-90. 1992. Age, growth, and size distribution of larval Atlantic menhaden off North Carolina. Trans. Am. Fish. Soc. 121:588-598. Abstract. — The nutritional sta- tus of laboratory-reared summer flounder, Paralichthys dentatus, larvae and early juveniles was as- sessed by morphometric, biochemi- cal, and histological criteria. Con- ditions of food deprivation were imposed on 6-, 16-, and 33-day-old larvae as well as on 60-day-old ju- veniles. Samples of ad-libitum-fed or starved individuals were ana- lyzed with regard to standard length, dry weight, eye diameter to head height ratio, pectoral angle, RNA:DNA ratio, total protein con- tent, histological appearance of se- lected organs, and cell height of the anterior and posterior intestinal mucosae. In general, tolerance to starvation increased with age: 60 h in 6-day-old-larvae, 72 h in 16- day-old larvae, 8 d in 33-day-old- larvae, and 10 d in 60-day-old-ju- veniles. The results of this study demonstrate that morphological criteria are either not good indica- tors of nutritional status (eye:head ratio), good only for larvae (pecto- ral angle), or require extensive cali- bration (standard length and dry weight). They also show that bio- chemical criteria are either not good indicators ( protein content ) or are sensitive to starvation only in juveniles (RNAtDNAratio). Among the histological criteria, thickness of the posterior intestinal mucosa was the most sensitive and consis- tent indicator of starvation in sum- mer flounder larvae and early ju- veniles. The most salient attributes of this histological analysis were sensitivity, objectivity, ease of in- terpretation, and exemption from shrinkage calibration. These re- sults suggest the use of the histo- logical approach in the face of un- certainties associated with the other methods examined. On the other hand, application of either morphological or histological crite- ria is appropriate for an aquacul- ture setting in which age of larvae is known. Description of the starving condition in summer flounder, Paralichthys dentatus, early life history stages Gustavo A. Bisbal Graduate School of Oceanography, University of Rhode Island Narragansett. Rl 02882 Present address. Northwest Power Planning Council 85! S.W Sixth Avenue. Suite 1 100. Portland. OR 97204-1348 David A. Bengtson Department of Zoology, University of Rhode Island Kingston, Rl 02881 Manuscript accepted 1 December 1994. Fishery Bulletin 93:217-230 (1995). It is currently accepted that star- vation and predation are the main agents of marine fish larval mortal- ity (Hunter, 1976; Bailey and Houde, 1989). However, the relative mag- nitudes of the processes controlling prerecruit mortality are, for the most part, either unknown or con- troversial (Pepin, 1988/1989; Miller et al., 1991). Furthermore, these forces may at times operate concur- rently, adding an additional level of complexity. For instance, although intense food limitation of fish lar- vae can be lethal per se, it could also be regarded as a sublethal agent that exposes weakened individuals to selective predation by reducing their growth rates (Laurence, 1985; Houde, 1987; Fogarty et al., 1991), reaction capabilities (Hunter, 1972, 1981), or ability to maintain a pre- ferred depth in the water column (Blaxter and Ehrlich, 1974). Nutritional condition of teleost larvae has been measured and de- scribed in a number of ways. The physical deterioration of larvae re- sulting from experimental condi- tions of food deprivation has been interpreted by means of morpho- metric and gravimetric (e.g. Hempel and Blaxter, 1963; Ishibashi, 1974; Ehrlich et al., 1976), biochemical (e.g. Ehrlich, 1974, a and b; Buckley, 1980, 1982, 1984; Fraser et al., 1987; Clemmesen, 1987; Richard et al., 1991), and histological (e.g. Ehrlich et al., 1976; O'Connell, 1976, 1980; Theilacker, 1978; Mar- tin and Malloy, 1980; Watanabe, 1985; Theilacker and Watanabe, 1989) criteria. In some cases, sev- eral of these techniques were tested concurrently to determine their relative utility as indicators of star- vation (Martin and Wright, 1987; Setzler-Hamilton et al., 1987). Mar- tin and Wright (1987) proposed the combined application of two or three techniques to any given study be- cause of differences in response time of the measure to actual nu- tritional status. The summer flounder, Para- lichthys dentatus, is a temperate paralichthyid flatfish occurring in Atlantic estuaries and continental shelf waters from Nova Scotia to Florida (Rogers and Van Den Avyle, 1983; Able et al., 1990). During 1983-91, the average landings from the commercial and recreational fishery were 11,400 metric tons. Recent surveys revealed that the stock biomass is currently at the lowest average level since the early 1970s which, combined with calcu- 217 218 Fishery Bulletin 93(2). 1995 lated present fishing mortality rates, indicates that summer flounder stocks are overexploited (NMFS, 1993). The decline in the natural fishery, together with recent success in culturing other flatfish spe- cies, such as the Japanese flounder, Paralichthys olivaceus (Sproul and Tominaga, 1992), and the Eu- ropean turbot, Scophthalmus maximus (Person-Le Ruyet et al., 1991), stimulated interest in the develop- ment of technology for the culture of summer flounder. Basic information on the ability to distinguish starving from feeding P. dentatus larvae and juve- niles will be useful for studies of both natural and cultured populations. Studies on the occurrence or frequency of starvation in either field populations or aquaculture operations must be preceded by an ex- perimental study in which specific starvation indi- cators are validated for fish of known nutritional his- tory. Therefore, the aim of our research was to evalu- ate and compare alternative criteria for assessing starvation effects at several stages during the early life history of P. dentatus. We characterize P. dentatus larvae and recently metamorphosed juveniles subjected to conditions of starvation or ad libitum feeding, using biochemical, morphometric, and histological criteria. Materials and methods Adult broodstock P. dentatus were collected from Narragansett Bay, Rhode Island, and Long Island Sound, Connecticut, and were held in laboratory fa- cilities. They were spawned after artificial induction with repeated carp pituitary injections (2.5 mg/kg) during 8 to 12 consecutive days (Smigielski, 1975). The fertilized eggs were distributed in 38-L glass aquaria covered with opaque black plastic. Each tank was filled with UV-treated filtered (1 |im) Nar- ragansett Bay seawater (adjusted to 34 ±\%c salin- ity by brine addition). Antibiotic (200 mg erythro- mycin activity dissolved in 23 liters of water) was added at one time in each tank, and water changes were performed every 2-3 days to maintain water quality. During the first week, the alga, Tetraselmis suecica, was added to the water. No artificial sub- strate was added to the aquaria. Water temperature was maintained at 19 ±1°C throughout the experi- ment. Overhead illumination adjusted to a natural photoperiod and aeration were provided. Hatching began 55 hours after fertilization. Dur- ing the next 4 days the larval digestive system be- came morphologically ready to process external food at the time of mouth opening (Bisbal and Bengtson, in press). Since yolk resorption and mouth opening are almost simultaneous, flounder larvae were fed daily on rotifers, Brachionus plicatilis, cultured on T. suecica (Lubzens, 1987) after day 4. Newly hatched Reference Artemia III nauplii (Collins et al., 1991) were offered for the first time 18 days later, and the rotifer supply was progressively reduced. Settlement to the bottom began on day 45 after hatching. Available literature on the early life stages offish and previous direct observations on flounder cultures directed our interest toward four developmental stages (Al-Maghazachi and Gibson, 1984; Blaxter, 1988; Youson, 1988). The effects of starvation were evaluated at day 6 (early food ingestion, yolk com- pletely resorbed), day 16 (these larvae have positively ingested and processed food at least once or else they would have died within 10 days after hatching), day 33 (at the beginning of metamorphic eye migration), and day 60 (bottom-dwelling juveniles have meta- morphosed) after hatching. At these times, sub- samples of the larvae pool were randomly placed in one of two 5-L tanks (25 larvae/L): one (control group) receiving food ad libitum (i.e. Brachionus or Artemia ); the other (starved group) devoid of food. Although the presence of food in the gut was not systemati- cally recorded, the performance of feeding motions and active swimming were visually confirmed on an individual basis. An extra subsample was processed as described below in order to establish the basal levels of the several parameters measured prior to the initiation of the imposed starvation (time 0). Based on previous observations on the progression of starvation at different age intervals and constant visual monitoring of behavioral changes, each group (control and starved) was sampled at least three times, from the beginning of the experimental expo- sure until the onset of mortality. A larva was consid- ered dead if it did not respond to gentle probing with a glass rod. If that was the case, the larva was cap- tured and placed under the dissecting microscope for a confirmation of its status. At each sampling time the same protocol was followed: 6 to 10 individuals from each group were sampled for histological analy- sis, 10 for morphometric and dry weight measure- ments, and 10 for biochemical analyses. Morphometric measurements consisted of stan- dard length, eye diameter, head height, and the pec- toral girdle angle as defined by Ehrlich et al. ( 1976). Measurements of live larvae were taken under a dis- secting microscope equipped with an ocular microme- ter accurate to 0.7 um. Pectoral angles were traced under a camera lucida and measured on a digitizing pad. Each fish was then rinsed in deionized water and placed in a 60°C oven until a constant dry weight was obtained. Weight was measured, on either a Met- tler AE 240 balance or a Cahn C-31 electrobalance. Samples for biochemical analysis were rinsed in deionized water and individually preserved in Eppen- Bisbal and Bengtson: Starvation in early life stages of Parahchthys dentatus 219 dorf vials in a — 80°C freezer for no more than 45 days until RNA, DNA, and protein determinations were performed. Owing to the extremely small size of the 6-day-old larvae, each determination was performed on samples consisting of two larvae pooled in the same vial. This was the only case where pooling was necessary. Determinations of RNA and DNA were performed according to the methodology described by Bentle et al. (1981) as modified for individual larvae of small size (Nacci et al., 1992). Total protein determination was assessed by a dye-binding assay ( Bradford, 1976) in which bovine serum albumin was the reference standard. Volumes were adjusted to 96-well micro- titration plates and, after completion of the colored reaction, absorbances were read at 600 nm in an EL 312 Bio-Tek automated microplate reader. The fraction of the sample destined for histologi- cal examination consisted of 6 to 10 specimens pre- served in Dietrich's fixative, embedded in paraffin blocks, and completely sectioned every 4—5 pm on a rotary microtome. Light microscopy analysis was per- formed after staining with Cason's trichromic (Cason, 1950). The qualitative histological examination concen- trated on the liver, pancreas, musculature, and in- testinal mucosae. For quantitative purposes, mea- surements of the cell height of the anterior and pos- terior intestinal mucosae were performed as de- scribed by Theilacker and Watanabe (1989). These measurements consisted of the distance from the basal membrane to the tip of the brush border and were obtained under a microscope equipped with an ocular micrometer eyepiece accurate to 0.02 urn. In the anterior intestine, the site for this measurement was the ventral row of cells located just cranial of the intestinal valve complex (see Fig. 6, A and B). A similar measurement on the posterior intestine mu- cosa was performed caudal of the intestinal valve (see Fig. 6, A and B). Control and starved group parameters at each sam- pling time were compared by using Student's Mests. The overall level of significance (a) for each data set was fixed at a nominal value of 0.05. The critical t- value for k number of tests was adjusted through Bonferroni's correction as oik (Sacks, 1978). All values were plotted as arithmetic means and standard errors. Results Morphometry and biochemistry Sampling of 6-day-old larvae was conducted at 24, 48, and 60 hours after initiation of starvation (Fig. 1 ). Mortality in starved larvae began about 60 hours after food deprivation. The mean standard length of starved larvae was lower than their fed counterparts at all sampling times tt 18 =3.39, P=0.003, at 24 h, Fig. 1A). Mean dry weight (Fig. IB) and the mean eye to head ratio (Fig. 1C) did not differ significantly (dry weight, £ 18 =2.39, P=0.028, at 24 h; eye/head ratio, * 18 =1.31, P=0.208, at 60 h). The mean pectoral angle of starved larvae decreased relative to the fed larvae after 24 hours (f 18 =3.53, P=0.002; Fig. ID). Mean RNA:DNA ratios of starved larvae were lower than those of fed larvae « 18 =2.68, P=0.015, at 60 h; Fig. IE). After 60 hours, mean RNA:DNA ratios had de- creased from an initial value of 3.75 to 2.74 and 2.31 in fed and starved larvae, respectively. Levels of pro- tein remained fairly constant throughout the experi- mental period (Fig. IF). Sampling of 16-day-old larvae was conducted at 24, 48, and 72 hours after initiation of starvation (Fig. 2). Starved 16-day-old larvae began to die after 72 hours. Mean standard length of both groups was not statistically different at any time U 18 =2.25, P=0.037, at 72 h; Fig. 2A). However, differences in mean dry weight were significant at 72 hours U 18 =3.04, P=0.007; Fig. 2B). A comparison of the mean dry weight at the beginning of the experiment and that for each group after 72 hours indicates that fed lar- vae incorporated body mass at a daily specific rate of 7.9%/day, whereas starved larvae lost weight at a rate of 10.4%/day. Similarly, the ratio of eye diam- eter to head height became significantly different only after 72 hours of starvation (t 18 = 4.41, P<0.001; Fig. 2C). Little difference was observed in the mean pectoral angle between the groups until 48 h (f 18 =4.59, P<0.001 ) and 72 hours tf 18 =8.25, P<0.001; Fig. 2D). For three days, the mean RNA:DNA ratio of fed animals (2.97-2.99) remained near the mean value at time (2.81; Fig. 2E). During the same pe- riod, starved fish showed a steady decline in RNA:DNA ratio to a final value of 1.93, although dif- ferences were only significant at 72 hours (< 18 =3.47, P=0.003). Mean protein content initially decreased in both groups but became fairly constant and indis- tinguishable between groups thereafter (Fig. 2F). Sampling of 33-day-old larvae was conducted at 24, 72, 120, and 192 hours after initiation of the ex- periment (Fig. 3). Larvae began to die after approxi- mately 8 days of food deprivation. Starved larvae were significantly shorter than fed ones after 72 hours (* 18 =3.32, P=0.004; Fig. 3A). Daily specific growth in length of fed larvae progressed at a rate of 2.5%/day but remained almost constant in starved fish. Dry weight of fed larvae also increased signifi- cantly relative to starved larvae (Fig. 3B). At the end of the experimental period, the fed larvae had in- 220 Fishery Bulletin 93(2). 1995 12 24 36 48 60 Time (h) Figure 1 Summer flounder, Paralichthys dentatus, 6-day-old larvae. Morphometric, gravi- metric, and biochemical changes during ad libitum feeding ( ) or starvation (• ). (A) standard length; (B) dry weight; (C) eye diameter/head height ratio; (D) pec- toral angle; (E) RNA:DNA ratio; (F) total proteins. Symbols represent the arith- metic mean of samples of 9-10 animals ±Standard Error. Asterisks indicate a statistically significant difference between fed and starved groups at a particu- lar sampling time. creased their dry weight by more than 206% of the initial value, whereas the starved group remained unchanged. This weight difference was significant at 72 hours (* 18 =4.46, P<0.001), 120 hours « 18 =5.54, P<0.001), and 192 hours (* 18 =4.06, P<0.001). The eye:head ratio of both groups differed at 192 hours (* 18 =4.28, P<0.001; Fig. 3C). At 72 hours (* 18 =5.38, P<0.001), 120 hours (* 18 =7.89, P<0.001), and 192 hours U 18 =6.85, P<0.001) the starved group had a lower mean pectoral angle than did the fed group (Fig. 3D). The RNA:DNA ratio showed an initial rise from 2.88 to 3.41 and to 3.26 in fed and starved larvae, respectively (Fig. 3E). After 24 hours, both groups showed a decline, but starved larvae declined to a much greater extent, resulting in significant differences be- tween the two groups at 120 hours (< 18 =4.85, P<0.001 ) and 192 hours « 18 =5.18, P<0.001). By day 8, starved larvae had ratios 62.4% lower than those of fed larvae. Mean total protein of starving larvae was also signifi- cantly lower than that in fed fish, a difference detect- able after 192 hours tt 18 =4.19,P<0.001; Fig. 3F). Samples of 60-day-old metamorphosed juveniles were taken at 72, 144, and 216 hours (Fig. 4). Mor- tality in the starved group began after 10 days. While the mean standard length of both groups was differ- ent at 216 hours (* 18 =4.01, P<0.001; Fig. 4A), mean dry weights of the starved and fed groups were sig- nificantly different from each other at each sampling time (* 18 =2.95, P=0.009, at 72 h; Fig. 4B). In 9 days, fed juveniles grew in length at a daily specific rate of 3.1%/day, whereas starved larvae grew at 0.7%/day. During the same time, fed fish gained weight at a rate of 10.1%/day, whereas starved fish lost 1.9% of their body mass every day. The eye diameter to head height ratio in both groups varied in a similar man- ner (Fig. 4C). A significant difference in the shape of the pectoral angle was only detected at 216 hours U 18 =3.15, P=0.006; Fig. 4D). Mean RNA:DNA ratios Bisbal and Bengtson. Starvation in early life stages of Paralichthys dentatus 221 E £ 5 0) 5.0 ■o CD ? 4.5 ra 55 160 o> 140 a. - 120 O) ■ 80 o 60 36 48 72 48 60 130 n> 110 >° DO 2.5 5 D > 30 | 25 "5 o 20 | Time (h) Figure 2 Summer flounder, Paralichthys dentatus, 16-day-old larvae. Morphometries, gravi- metric, and biochemical changes during ad libitum feeding ( ) or starvation ( • ). (A) standard length; (B) dry weight; (C) eye diameter/head height ratio; (D) pec- toral angle; (E) RNA:DNA ratio; (F) total proteins. Symbols represent the arith- metic mean of samples of 9-10 animals iStandard Error. Asterisks indicate a statistically significant difference between fed and starved groups at a particu- lar sampling time. of starved juveniles remained consistently lower than those of fed juveniles at all times (^=3.05, P=0.007, at 72 h; Fig. 4E). During the experimental period, fed fish maintained a mean ratio between 8 and 9. In contrast, the ratio in starved fish dropped from an initial value of 8.49 to a final value of 4.86, a 68% difference from the fed group. Differences in mean total proteins were significant at 72 hours U 17 =3.46, P=0.003) and 216 hours (i 18 =2.71, P=0.014; Fig. 4F). Histology The trunk musculature in fed larvae was striated, closely packed, and composed of parallel myofibrils over the lateral surfaces of the notochord (Fig. 5A). However, under starving conditions, the fibrils were not distinguishable and their parallel orientation was disrupted. Further, muscle fibers were widely sepa- rated because of shrinkage of the cells (Fig. 5B). In 6 and 16-day-old larvae, degradation of skeletal muscle was evident after 24 hours of starvation. In 33-day- old larvae and 60-day-old juveniles, this effect was de- tected after 72 and 144 hours of starvation, respectively. Hepatic tissue of fed larvae appeared continuous and compact, composed of hepatic cells organized in typical liver cords (Fig. 5C). The hepatocytes had a bulky cytoplasm with low staining affinity, several vacuolar inclusions, and round nuclei in their cen- ters. Conversely, liver tissue of starving larvae was fractionated and exhibited loss of the cellular cord arrangement and contained wide intercellular spaces (Fig. 5D). The cytoplasm was severely collapsed and deeply stained (there were no vacuolar spaces) and contained heavily pigmented eccentric nuclei of ir- regular shape. Liver deterioration was detected af- ter 24, 48, 120, and 144 hours of food deprivation in 6, 16, 33-day-old larvae, and 60-day-old juveniles, respectively. 222 Fishery Bulletin 93(2), 1995 Q> 8 „ 2500 3 2000 .!? 1500 d> J 1000 0) >, HI 38 36 B 140 <9. 130 a. 120 3 3.5 > 2.5 5 > 400 300 200 100 72 72 120 Time (h) Figure 3 Summer flounder, Parahehthys dentatus, 33-day-old larvae. Morphometric, gravi- metric, and biochemical changes during ad libitum feeding ( ) or starvation ( • ). (A) standard length; (B) dry weight; (C) eye diameter/head height ratio; (D) pec- toral angle; (E) RNA:DNA ratio; (F) total proteins. Symbols represent the arith- metic mean of samples of 9-10 animals ±Standard Error. Asterisks indicate a statistically significant difference between fed and starved groups at a particu- lar sampling time. The acinar arrangement of pancreatic cells was sensitive to starvation. In fed larvae, the typical aci- nar structure was well defined and symmetrical; cells were arranged around central intercellular lumina (Fig. 5E). Under food deprivation, the acinar struc- ture became increasingly disorganized (Fig. 5F). In 6, 16, and 33-day-old larvae, symptoms of pancre- atic degeneration were discernible as early as 24 hours after food deprivation. In 60-day-old juveniles, this ef- fect was detectable after 144 hours of starvation. The intestinal mucosa of fed larvae was continu- ous and uninterrupted. A distinct brush border com- posed of microvilli was evident. The intestinal lu- men was wide and the columnar enterocytes were systematically arranged and deeply folded. Cytoplas- mic vesicles and vacuoles, suggestive of pinocytosis and intracellular protein digestion, were present in varying numbers and sizes (Fig. 6C). In the starved group, the intestinal mucosa was discontinuous, less compact, and had irregular cells and intercellular spacing. The brush border was not smooth and signs of cell sloughing were evident from the necrotic de- bris in the lumen. The enterocytes were shrunken and collapsed resulting in a severe reduction of the entire mucosal thickness. The intestinal lumen was comparatively occluded. Cytoplasmic vesicles were not present (Fig. 6D). The mean cell height of the anterior intestinal mucosa was significantly different between starved and fed groups of all ages. In all cases, these differ- ences were detectable from the first sampling time (* 18 =2.99, P=0.008, at 24 h in 6-day-old larvae; £ 18 =8.20, P<0.001, at 24 h in 16-day-old larvae; * 18 =6.06, P<0.001, at 24 h in 33-day-old larvae; and 1 10 =H.O, P<0.001, at 72 h in 60-day-old juveniles; Fig. 7, A, C, E, and G, respectively). Differences in the cell height of the posterior in- testinal mucosa of starved and fed groups were also Bisbal and Bengtson Starvation in early life stages of Paralichthys dentatus 223 Time (h) Figure 4 Summer flounder, Paralichthys dentatus, 60-day-old juveniles. Morphometric, gravimetric, and biochemical changes during ad libitum feeding ( ) or starva- tion (•). (A) standard length; (B) dry weight; (C) eye diameter/head height ratio; (D) pectoral angle; (E) RNA:DNA ratio; (F) total proteins. Symbols represent the arithmetic mean of samples of 9-10 animals iStandard Error. Asterisks in- dicate a statistically significant difference between fed and starved groups at a particular sampling time. significant from the first sampling time in 16-day- old larvae (f 18 =6.86, P<0.001, at 24 h), 33-day-old larvae (f 18 =2.87, P=0.010, at 24 h), and in 60-day-old juveniles U 10 =3.05, P=0.012, at 72 h; Fig. 7, D, F, and H, respectively). In the case of 6-day-old larvae, these differences were significant after 48 hours U 18 =10.49, P<0.001; Fig. 7B). Discussion In summer flounder, the onset of mortality due to starvation occurred later in older ontogenetic stages, similar to observations made by Ivlev (1961) and Wyatt ( 1972). Response to starvation may depend not only on energy reserves stored in the liver, muscles, and other body tissues but also on more efficient cata- bolic capabilities attained during ontogenesis (Ehrlich, 1974b). Yin and Blaxter ( 1987 ) argued that the relative tolerance to lack of food is the result of reduced energy costs for metamorphosing flounder that increasingly spend more time lying on the bottom. Morphometric, biochemical, and histological mea- surements all showed significant differences between starved and fed summer flounder at some point dur- ing development. The question then becomes the fol- lowing: Which individual measurement or combina- tion is the most useful indicator of nutritional sta- tus as development proceeds? We define usefulness both in terms of ease and practicality of application. Because of the relatively low resistance to starva- tion in younger larvae, it is imperative to select an indicator with the sensitivity to respond quickly to changes in nutritional status. While mean length and dry weight of fed summer flounder showed a steady increase, starving fish shrank or did not grow. Only in 6-day-old larvae did standard length decrease, presumably representing 224 Fishery Bulletin 93(2). 1995 ***» W* Figure 5 Histological comparisons of ad-libitum-fed and starved summer flounder, Paralichthys dentatus, larvae. (A) 16 days after hatch- ing ( DAH ), skeletal musculature, ad-libitum-fed control ( bar=20 um ). ( B ) 19 DAH, skeletal musculature, after 72 hours of starva- tion (bar=35 um). (C) 18 DAH, hepatic tissue, ad-libitum-fed control (bar=25 um). (D) 19 DAH, hepatic tissue, after 72 hours of starvation (bar=20 um). (E) 19 DAH, pancreatic tissue, well-fed control (bar=55 urn). (F) 19 DAH, pancreatic tissue, after 72 hours of starvation (bar=30 um). Bisbal and Bengtson: Starvation in early life stages of Paralichthys dentatus 225 A pi LU LU W X Jf S *■ , ' ».%*.••• Figure 6 Histological comparisons of well-fed and starved summer flounder, Paralichthys dentatus. larvae. (A) 19 days after hatching (DAH), intestinal mucosae at the intestinal valve, ad-libitum-fed control (bar=50 urn). (B) 19 DAH, intestinal mucosae at the intestinal valve, after 72 hours of starvation (bar=60 |im). The arrows indicate the mucosal height in each intestinal segment. (C) 16 DAH, detail of enterocytes showing absorptive inclusions, ad-libitum-fed control (bar=35 urn). (D) 19 DAH, detail of enterocytes showing cellular sloughing into the lumen, after 72 hours of starvation (bar=20 pm). Abbreviations: AI=anterior intestine, IV=intestinal valve, LU=lumen, PI=posterior intestine. The arrows indicate the mucosal height in each intestinal segment. shrinkage of the larvae after yolk absorption. Shrink- age of starved early stage larvae has been reported in herring (Ehrlich et al., 1976) and striped bass (Eldridge et al., 1981). Additionally, large variation in the extent of shrinkage has been reported in pre- served larvae as a consequence of capture and fixa- tion (Theilacker, 1980; Hay, 1981). The time of sam- pling must also be considered to account for changes in dry weight associated with the diurnal rhythms of visual feeders (Arthur, 1976 ). The dry weight of a larva with a full digestive tract will obviously be greater than that of the same larva with an empty digestive tract. Because extensive calibration between laboratory and field experiments is necessary to compare small larvae at the same developmental stage, length and dry weights are not useful indicators of nutritional status. The pectoral angle accurately identified the nutri- tional condition of earlier larval stages. The variabil- ity within each group was low and significant differ- ences were established early in the sampling proto- col. However, these attributes progressively vanished at later stages. The eye length to head diameter ra- tio was not a good indicator of the feeding condition at any stage because of large variability within each group. Ehrlich et al. (1976) found the pectoral angle to be a good indicator of starvation in both herring, Clupea harengus, and plaice, Pleuronectes platessa , but the eye:head ratio was a good indicator in her- ring only. Morphological characteristics are relatively simple to measure, inexpensive, and require little time, but the validity of laboratory-derived criteria is uncer- 226 Fishery Bulletin 93(2). 1995 c w » "? C 3 s £ E .c •E 13 - 0) O Q. in — •- ° ■£. 0) S E ""(UP § E £ o 21 lc 19 A^ 17 - \ 15 \ 13 11 9 #*--_ . *• *. 15 13 11 D **\ 9 7 * T ^ ** Time (h) Figure 7 Anterior and posterior intestinal mucosal cell height in summer flounder, Paralichthys dentatus, during ad libitum feeding ( ) or starvation ( • ). (A-B) 6-day- old larvae; (C-D) 16-day-old larvae; (E-F) 33-day-old larvae; (G-H) 60-day-old ju- veniles. Symbols represent the arithmetic mean of samples of 9-10 animals ±Stan- dard Error. Asterisks indicate a statistically significant difference between fed and starved fish groups at a particular sampling time. tain for populations in nature (O'Connell, 1976; Theilacker, 1986; Fraser et al., 1987; Setzler- Hamilton et al., 1987). Confinement in experimen- tal tanks influences growth rates and morphometries of laboratory-reared larvae (Blaxter, 1975; Arthur, 1976). At present, the applicability of morphometric indices seems more reliable and feasible for reared larvae, where age and historic information are known and feeding can be controlled. Given the inherent problems of laboratory-to-field calibration and the dynamic changes in body propor- tions due to allometric growth and progressive ossi- fication of developing larvae, Theilacker (1978) con- cluded that no single morphological feature can be singled out as a consistent indicator of larval condi- tion. Because some of the variability associated with field-collected larvae is accounted for by differences in age of larvae, interpretation of the data requires the ability to determine age. Ageing of summer floun- der from daily growth ring deposition is difficult on field-collected larvae of mixed age (Dery, 1988, Szedlmayer and Able, 1992). Therefore, the use of Bisbal and Bengtson: Starvation in early life stages of Paralichthys dentatus 221 length as an estimate of age is a coarse alternative when age data are not available. If this is the case, then the analysis should be restricted to a limited size range (Martin and Wright, 1987). Among the biochemical criteria, protein data had the largest associated variability. Similar variation in the protein content of winter flounder, Pleuronectes americanus, larvae has been obtained by Cetta and Capuzzo ( 1982 ). Other studies have shown that pro- tein breakdown is the major source of energy during starvation of herring (Ehrlich, 1974a I and plaice (Ehrlich, 1974b), at least during early larval stages, when lipid reserves are negligible or nonexistent. The RNA:DNA ratio showed less individual vari- ability and provided a more sensitive index to feed- ing condition than did protein. The ratio of total RNA to DNA in tissues has been extensively used as an indicator of recent growth rate and changes in feed- ing levels of various larval fish ( Buckley, 1984; Bulow, 1987). In recent years, the relative ease and sensi- tivity of this analysis have stimulated the develop- ment of several procedural variations of the tech- nique. Thus, discretion should be exercised in directly comparing RNA:DNA values obtained with different methods and standards (Caldarone and Buckley, 1991). In addition, it has been demonstrated that temperature can affect the RNA:DNA ratio in fish larvae (Buckley, 1982, 1984; Buckley and Lough, 1987). In the 6-day-old larvae used in our study, the RNA:DNA ratio declined by about 30% over the 60- hour experiment, even in fed larvae. After that de- cline, which was similar in magnitude to that ob- served in fed winter flounder larvae 4 days after yolk absorption (Buckley, 1980), the mean RNA:DNA ra- tio of fed larvae remained within a narrow range (2.7 to 3.1) for the remainder of the larval period. There- fore, it appears that a mean RNA:DNA ratio of less than 2.7 strongly suggests food limitation in floun- der. The equilibrium RNA:DNA ratio for P. dentatus larvae reared at 14, 16, or 18°C has been reported to be 2.4, 3.1, and 2.6, respectively (Buckley, 1984). Win- ter flounder and striped bass, Morone saxatilis, lar- vae also appear to establish narrow RNA:DNA equi- librium ranges (Buckley, 1980; Wright and Martin, 1985). After metamorphosis, the RNA:DNA ratio of summer flounder increased to between 8.2 and 8.9, whereas that of starved fish was never above 6. A similar increase in RNA:DNA ratio after metamor- phosis has been observed in fed winter flounder (Buckley, 1980). Although RNArDNA ratio and pectoral angle were both able to discriminate fed from starved summer flounder, pectoral angle was more sensitive to star- vation than was the RNA:DNA ratio in larvae, whereas the opposite was true for juveniles. The quick response of RNA:DNA ratio to food depriva- tion noted by Buckley (1980), Wright and Martin (1985), and Martin and Wright (1987) was not ap- parent in summer flounder. An advantage of bio- chemical methods for field use is that larvae dam- aged by sampling gear can still be analyzed (Fraser et al., 1987) and distortions due to chemical fixatives are avoided. We conclude, therefore, that RNA:DNA ratios may be useful as indicators of nutritional limi- tation in summer flounder larvae and juveniles. Histological analyses indicated that food depriva- tion of summer flounder larvae and early juveniles had a marked effect on several internal structures. Starvation was readily manifest in the intestine, fol- lowed in time by changes in the pancreas, liver, and skeletal musculature, as previously seen in other teleost larvae (Umeda and Ochiai, 1975; Ehrlich et al., 1976; O'Connell, 1976, 1980; Theilacker, 1978, 1986; Cousin et al., 1986; Margulies, 1993). The nu- trient shortages that result from food deprivation have an almost immediate manifestation in the in- testinal epithelium. In starved summer flounder, lipid and protein inclusions progressively disap- peared from the intestinal epithelial cells until they were no longer visible, similar to the previous obser- vations of Ehrlich (1974a), Ciullo (1975), Watanabe ( 1985), and Govoni et al. ( 1986). By contrast, Kjorsvik et al. (1991) reported that pinocytic inclusions were visible at all stages of starvation in cod larvae. Mucosal cell height in summer flounder was ex- tremely sensitive to starvation when applied to the posterior intestine, whereas the height of the ante- rior intestinal mucosa varied with increasing size or age, or both. The mean height of the posterior intes- tinal mucosa showed a stable boundary for discrimi- nation of fed and starved individuals (above 10 (im for fed larvae, below for starved) regardless of indi- vidual size or age. This criterion therefore provides the best tool to assess starvation in summer floun- der during the first 60 days of life. Previous investi- gators have noted the utility of histological exami- nation of intestinal mucosa, especially cell height, for determination of starvation (Ehrlich et al., 1976; Theilacker, 1978, 1980; Watanabe, 1985; Umeda et al., 1986; Theilacker and Watanabe, 1989; Kj0rsvik et al., 1991). The discriminating power of the mu- cosal cell height criterion incorporates the well known advantages of other traditional histological evalua- tion procedures. As with the biochemical criteria, specific equipment and some technical proficiency are required to process the samples. One advantage to this criterion is that samples can be preserved on a ship and no subsequent calibration is necessary for shrinkage due to capture or fixation, or for individual size or age. 228 Fishery Bulletin 93(2), 1995 To summarize, this study has demonstrated that 1) morphological criteria were either not good indi- cators of nutritional condition (eye:head ratio), good only for larvae (pectoral angle), or require extensive calibration (standard and dry weight); 2) biochemi- cal criteria are either not good indicators (protein content) or are sensitive only in juveniles (RNA:DNA ratio); and 3) the histological criterion of posterior intestinal mucosa cell height is the most sensitive and consistent indicator of starvation in young sum- mer flounder over the stages examined. Although the current study needs to be applied to field-collected larvae, the laboratory data indicate that the addi- tional time and expense of histological sample prepa- ration and analysis is justified in the face of uncer- tainties associated with the other methods examined. On the other hand, application of either morphologi- cal or histological criteria is appropriate for an aquac- ulture setting in which age of the larvae is known. Acknowledgments This research was supported by the United States Department of Commerce, National Oceanic and Atmospheric Administration, National Marine Fish- eries Service, Saltonstall-Kennedy grant number NA-90-AA-H-SK033. The authors thank Doranne Borsay, Sue Cheer, Ken Thomas, and Paul Yevich for their assistance in this study. Robert Bullock and Austin Williams kindly granted access to their fa- cilities and equipment. Larry Buckley, Ted Durbin, Grace Klein-MacPhee, and Perry Jeffries provided helpful comments and advice during the experimen- tal phase and preparation of this manuscript. Literature cited Able, K. W., R. E. Matheson, W. W. Morse, M. P. Fahay, and G. Shepherd. 1990. Patterns of summer flounder Paralichthys dentatus early life history in the Mid-Atlantic bight and New Jer- sey estuaries. Fish. Bull. 88:1-12. Al-Maghazachi, S. J., and R. Gibson. 1984. The developmental stages of larval turbot, Scoph- thalmus maximus (L.). J. Exp. Mar. Biol. Ecol. 82:35-51. Arthur, D. K. 1976. Food and feeding of larvae of three fishes occurring in the California current, Sardinops sagax, Engraulis mordax, and Trachurus symmetricus. Fish. Bull. 74:517-530. Bailey, K. M., and E. D. Houde. 1989. Predation on eggs and larvae of marine fishes and the recruitment problem. Adv. Mar. Biol. 25:1-83. Bentle, L. A., S. Dutta, and J. Metcoff. 1981. The sequential enzymatic determination of DNA and RNA. Anal. Biochem. 116:5-16. Bisbal, G. A., and D. A. Bengtson. In press. Development of the digestive tract in larval sum- mer flounder, Paralichthys dentatus L. J. Fish Biol. Blaxter, J. H. S. 1975. Reared and wild fish-how do they compare? Tenth European symposium on marine biology, Ostend, Belgium, 17-23 Sept., 1975, Vol. 1:11-26. 1988. Pattern and variety in development. In W. S. Hoar and D. J. Randall (eds.). Fish physiology, Vol. XIA, p. 1-58. Acad. Press, New York. Blaxter, J. H. S., and K. F. Ehrlich. 1974. Changes in behaviour during starvation of herring and plaice larvae. In J. H. S. Blaxter (ed.), The early life history offish, p. 575-588. Springer- Verlag, NY. Bradford, M. 1976. A rapid and sensitive method for quantification of microgram quantities of protein utilizing the principle of protein dye binding. Anal. Biochem. 72:248-254. Buckley, L. J. 1980. Changes in ribonucleic acid, deoxyribonucleic acid, and protein content during ontogenesis in winter floun- der, Pseudopleuroneetes americanus, and effect of starvation. Fish. Bull. 77:703-708. 1982. Effects of temperature on growth and biochemical composition of larval winter flounder Pseudopleuroneetes americanus. Mar. Ecol. Prog. Ser. 8:181-186. 1984. RNA-DNA ratio: an index of larval fish growth in the sea. Mar. Biol. 80:291-298. Buckley, L. J., and R. G. Lough. 1987. Recent growth, biochemical composition, and prey field of larval haddock iMelanogrammus aegleftnus) and Atlantic cod (Gadus morhua) on Georges Bank. Can. J. Fish. Aquat. Sci. 44:14-25. Bulow, F. J. 1987. RNA-DNA ratios as indicators of growth in fish: A review. In R. C. Summerfelt and G. E. Hall (eds.), The age and growth of fish, p. 45-64. The Iowa State Univ. Press, Ames, Iowa. Caldarone, E. M., and L. J. Buckley. 1991. Quantitation of DNA and RNA in crude tissue extracts by flow injection analysis. Anal. Biochem. 199:137-141. Cason, J. E. 1950. A rapid one-step Mallory-Heidenhain stain for con- nective tissue. Stain Technology 25:225-226. Cetta, C. M., and J. M. Capuzzo. 1982. Physiological and biochemical aspects of embryonic and larval development of the winter flounder Pseudo- pleuroneetes americanus. Mar. Biol. 71:327-337. Ciullo, R. H. 1975. Intestinal histology of Fundulus heteroclitus with observations on the effects of starvation. In W. E. Ribelim and G. Migaki (eds.), The pathology of fishes, Chapter 30, p. 733-767. The Univ. Wisconsin Press, Madison. Clemmesen, C. M. 1987. Laboratory studies on RNA/DNA ratios of starved and fed herring (Clupea harengus) and turbot (Scophthalmus maximus) larvae. J. Cons. Int. Explor. Mer 43:122-128. Collins, G. B., D. A. Bengtson, and J. C. Moore. 1991. Characterization of Reference Artemia III for marine toxicological studies. In M. A. Mayes and M.G. Barron (eds.), Aquatic toxicology and risk assessment: 14 th Sym- posium, p. 315-323. American Society for Testing and Materials, Special Tech. Publ. 1124, Philadelphia. Cousin, J. C. B., G. Balouet, and F. Baudin-Laurencin. 1986. Alterations histologiques observees chez des larves Bisbal and Bengtson: Starvation in early life stages of Paralichthys dentatus 229 de turbot {Scophthalmus maximus L.) en elevage intensif. Aquaculture 52:173-189. Dery, L. M. 1988. Summer flounder Paralichthys dentatus. In J. Penttila and L. M. Dery leds.lAge determination methods for Northwest Atlantic species, p. 97-102. U.S. Dep. Commer., NOAATech. Report NMFS 72. Ehrlich, K. F. 1974a. Chemical changes during growth and starvation of herring larvae. In J. H. S. Blaxter (ed.l. The early life history offish, p. 301-323. Springer- Verlag, New York. 1974b. Chemical changes during growth and starvation of larval Pleuronectes platessa. Mar. Biol. 24:39-48. Ehrlich, K. F., J. H. S. Blaxter, and R. Pemberton. 1976. Morphological and histological changes during the growth and starvation of herring and plaice larvae. Mar. Biol. 35:105-118. Eldridge, M. B., J. A. Whipple, D. Eng, M. J. Bowers, and B. M. Jarvis. 1981. Effects of food and feeding factors on laboratory- reared striped bass larvae. Trans. Am. Fish. Soc. 110:111— 120. Fogarty, M. J., M. P. Sissenwine, and E. B. Cohen. 1991. Recruitment variability and the dynamics of exploited marine populations. Trends Ecol. Evol. 6:241-246. Fraser, A. J., J. R. Sargent, J. C. Gamble, and P. MacLahlan. 1987. Lipid class and fatty acid composition as indicators of the nutritional condition of larval Atlantic herring. Am. Fish. Soc. Symposium 2:129-143. Govoni, J. J., G. W. Boehlert, and Y. Watanabe. 1986. The physiology of digestion in fish larvae. Envir. Biol. Fishes 16:59-77. Hay, D. E. 1981. Effects of capture and fixation on gut contents and body size of Pacific herring larvae. Rapp. P.-V. Reun. Cons. Int. Explor. Mer 178:395-400. Hempel, G., and J. H. S. Blaxter. 1963. On the condition of herring larvae. Rapp. P.-V. Reun. Cons. Int. Explor. Mer 154:35^40. Houde, E. D. 1987. Fish early life dynamics and recruitment varia- bility. Am. Fish. Soc. Symposium 2:17-29. Hunter, J. R. 1972. Swimming and feeding behavior of larval anchovy Engraulis mordax. Fish. Bull. 70:821-838. 1976. Culture and growth of northern anchovy, Engraulis mordax, larvae. Fish. Bull. 74:81-88. 1981. Feeding ecology and predation of marine fish larvae. In R. Lasker (ed.), Marine fish larvae: morphology, ecology and relation to fisheries, p. 33-77. Univ. Washington Press, Seattle. Ishibashi, N. 1974. Feeding, starvation and weight changes of early fish larvae. In J. H. S. Blaxter (ed.), The early life history of fish, p. 339-344. Springer- Verlag, New York. Ivlev, V. S. 1961. Experimental ecology of the feeding of fishes. Yale Univ. Press, New Haven, 302 p. Kjorsvik, E., T. van der Meeren, H. Kryvi, J. Arnfinnson, and P. G. Kvenseth. 1991. Early development of the digestive tract of cod lar- vae, Gadus morhua L., during start-feeding and star- vation. J. Fish Biol. 38:1-15. Laurence, G. C. 1985. Nutrition and trophodynamics of larval fish — Review, concepts, strategic recommendations and options. In G. C. Laurence and R. G. Lough (eds.), Growth and survival of larval fishes in relation to the trophodynamics of Georges Bank Cod and Haddock, p. 1-42. U.S. Dep. Commer., NOAA Tech. Memo. NMFS-F/NEC-36. Lubzens, E. 1987. Raising rotifers for use in aquaculture. Hydro- biologia 147:245-255. Margulies, D. 1993. Assessment of the nutritional condition of larval and early juvenile tuna and Spanish mackerel (Pisces: Scombridae) in the Panama Bight. Mar. Biol. 115:317- 330. Martin, F. D., and R. Malloy. 1980. Histologic and morphometric criteria for assessing nutritional state in larval striped bass Morone saxatilis. U.S. Fish Wildl. Serv. Biol. Serv. Prog. FWS/OBS-80/ 43:157-166. Martin, F. D., and D. A. Wright. 1987. Nutritional state analysis and its use in predicting striped bass recruitment: Laboratory calibration. Am. Fish. Soc. Symposium 2:109-114. Miller, J. M., J. S. Burke, and G. R. Fitzhugh. 1991. Early life history patterns of Atlantic North Ameri- can flatfish: likely (and unlikely) factors controlling recruitment. Neth. J. Sea Res. 27:261-275. Nacci, D., S. Cheer, and E. Jackim. 1992. ERL-N standard operating procedure conducting fluo- rescent multiwell method to estimate RNADNA ratios. U.S. EPA Environ. Res. Laboratory, Narragansett, RI. Standard Operating Procedure publ., May 1992, 6 p. NMFS (National Marine Fisheries Service). 1993. Status of fishery resources off the Northeastern United States for 1993. U.S. Dep. Commer., NOAATech. Memo. NMFS-F/NEC-101, 140 p. O'Connell, C. P. 1976. Histological criteria for diagnosing the starving con- dition in early post yolk-sac larvae of the northern anchovy, Engraulis mordax Girard. J. Exp. Mar. Biol. Ecol. 25: 285-312. 1980. Percentage of starving northern anchovy, Engraulis mordax, larvae in the sea as estimated by histological methods. Fish. Bull. 78:475-489. Pepin, P. 1988/1989. Predation and starvation of larval fish: A nu- merical experiment of size- and growth-dependent survival. Biol. Oceanogr. 6:23-44. Person-Le Ruyet, J., F. Baudin-Laurencin, N. Devauchelle, R. Metailler, J.-L. Nicolas, J. Robin, and J. Guillaume. 1991. Culture of turbot (Scophthalmus maximus). In 3. P. McVey (ed.), Handbook of mariculture, Vol. II: Finfish aquaculture, p. 21-41. CRC Press, Boca Raton, FL. Richard, P., J. P. Bergeron, M. Bouhic, R. Galois, and J. Person-Le Ruyet. 1991. Effect of starvation on RNA, DNA and protein con- tent of laboratory-reared larvae and juveniles of Solea solea. Mar. Ecol. Prog. Ser. 72:69-77. Rogers, S. G., and M. J. Van Den Avyle. 1983. Species profiles: life histories and environmental re- quirements of coastal fishes and invertebrates (South At- lantic ). Summer flounder. U.S. Fish Wildl. Serv. FWS/OBS- 82/11.15. U.S. Army Corps of Engineers, TR EL-82-4, 14 p. Sacks, L. 1978. Applied statistics: a handbook of techniques. Springer- Verlag, New York, 706 p. 230 Fishery Bulletin 93(2), 1995 Setzler-Hamilton, E. M., D. A. Wright, F. D. Martin, C. V. Millsaps, and S. I. Whitlow. 1987. Analysis of nutritional condition and its use in pre- dicting striped bass recruitment: Field studies. Am. Fish. Soc. Symposium 2:115-128. Smigielski, A. S. 1975. Hormone-induced spawnings of the summer floun- der and rearing of the larvae in the laboratory. Prog. Fish- Cult. 37:3-8. Sproul, J. T., and O. Tominaga. 1992. An economic review of the Japanese flounder stock enhancement project in Ishikari Bay, Hokkaido. Bull. Mar. Sci. 50:75-88. Szedlmayer, S. T., and K. W. Able. 1992. Validation studies of daily increment formation for larval and juvenile summer flounder, Paralichthys dentatus. Can. J. Fish. Aquat. Sci. 49:1856-1862. Theilacker, G. H. 1978. Effects of starvation on the histological and morpho- logical characteristics of jack mackerel, Trachurus symmetricus, larvae. Fish. Bull. 76:403-414. 1980. Changes in body measurements of larval northern anchovy, Engraulis mordax. and other fishes due to han- dling and preservation. Fish. Bull. 78:685-692. 1986. Starvation-induced mortality of young sea-caught jack mackerel, Trachurus symmetricus, determined with his- tological and morphological methods. Fish. Bull. 84:1-17. Theilacker, G. H., and Y. Watanabe. 1989. Midgut cell height defines nutritional status of labo- ratory raised larval northern anchovy, Engraulis mordax. Fish. Bull. 87:457^169. Umeda, S., and A. Ochiai. 1975. On the histological structure and function of diges- tive organs of the fed and starved larvae of the yellowtail, Seriola quinqueradiata. Jpn. J. Ichthyol. 21: 213-219. Umeda, S., H. Ochi, and A. Ochiai. 1986. The influences of delayed initial feeding on survival, growth and digestive organs in early postlarvae of the jack mackerel, Trachurus japonicus. Report USA Marine Bi- ology Inst., Kochi Univ. 8:45-53. Watanabe, Y. 1985. Histological changes in the liver and intestine of freshwater goby larvae during short-term starvation. Bull. Jpn. Soc. Sci. Fish. 51:707-709. Wright, D. A., and F. D. Martin. 1985. The effect of starvation on RNA:DNA ratios and growth of larval striped bass, Morone saxatilis. J. Fish Biol. 27:479^185. Wyatt, T. 1972. Some effects of food density on the growth and behaviour of plaice larvae. Mar. Biol. 14:210-216. Yin, M. C, and J. H. S. Blaxter. 1987. Feeding ability and survival during starvation of marine fish larvae reared in the laboratory. J. Exp. Mar. Biol. Ecol. 105:73-83. Youson, J. H. 1988. First metamorphosis. In W. S. Hoar and D. J. Randall (eds.), Fish physiology, Vol. XIB, p. 135-196. Aca- demic Press, New York. Abstract. — Species diversity and abundance offish eggs in shelf waters of the western Gulf of Alaska were similar in both surface neuston net tows and subsurface bongo net tows, but a unique group of fish larvae appear to be associ- ated with the neuston in this re- gion. The dominance of larvae of an osmerid, several hexagrammids, cottids, bathymasterids, Anoplo- poma fimbria, Cryptacanthodes aleutensis, and Ammodytes hexap- terus in this group resembles the neustonic assemblage offish larvae found in the California Current region along the U.S. west coast and most of these taxa are consid- ered obligate members of the neus- ton. Several taxa, however, appear to be abundant in the neuston only at night suggesting a facultative association with the neuston through a diel pattern of vertical migration. The facultative association of cer- tain species of larvae with the neus- ton varies with larval size. The distribution patterns ob- served for most taxa of fish larvae in the neuston during this study suggest that during spring, spawn- ing and emergence of larvae into the plankton and subsequently into the neuston take place mainly around Kodiak Island (except along the seaward side) and along the Alaska Peninsula to the southwest. Analysis of multispecies spatial patterns using recurrent group analysis and numerical classifica- tion did not reveal the existence of more than one neustonic assem- blage of fish larvae in the study area. Apart from perhaps Pleuro- grammus monopterygius larvae, which are known to occur through- out the Gulf of Alaska, and to a lesser extent A. fimbria and Hemi- lepidotus hemilepidotus, members of this neustonic assemblage of lar- vae are not commonly found in the oceanic zone. The ecological significance of a neustonic existence for larvae of fish that are primarily demersal spawners in the Gulf of Alaska is considered to be trophic in nature. Neustonic fish larvae seem to be able to exploit to their advantage the unique feeding conditions which exist at the sea surface. Manuscript accepted 25 September 1994. Fishery Bulletin 93:231-253 ( 1995). Neustonic ichthyoplankton in the western Gulf of Alaska during spring Miriam J. Doyle William C. Rugen Richard D. Brodeur Alaska Fisheries Science Center National Marine Fisheries Service. NOAA 7600 Sand Point Way NE. Seattle. WA 981 I 5-0070 The Fisheries Oceanography Coor- dinated Investigations (FOCI) is a long-term cooperative research pro- gram conducted by National Oce- anic and Atmospheric Administra- tion (NOAA) biological and physi- cal scientists to describe processes leading to recruitment variability of commercially important fish and shellfish stocks of the Gulf of Alaska and Bering Sea (Schumacher and Kendall, 1991). To date, most effort has concentrated on walleye pol- lock, Theragra chalcogramma, in the western Gulf of Alaska, specifically in Shelikof Strait and along the Alaska Peninsula. Understanding the dynamics of the spring spawning of this species in Shelikof Strait and the subsequent hatching, drift, growth, and survival of the larvae, in interaction with the physical and bio- logical oceanographic environment, have been the primary goals of FOCI. Ancillary to the information col- lected on the early life history stages of walleye pollock, are data on the distribution and abundance patterns of eggs and larvae of other fishes that spawn in the coastal waters and adjacent deeper waters of the western Gulf of Alaska. These observations can contribute to our understanding of the biology and ecology of fish populations in this region and the relationships be- tween their life history strategies and the environment. Prior to the onset of FOCI inves- tigations in the early 1980's, plank- ton collections in the vicinity of Kodiak Island were generally lim- ited in scope but still yielded infor- mation on species composition and spatio-temporal patterns in abun- dance offish eggs and larvae ( Rogers et al., 1979; Kendall and Dunn, 1985; Kendall et al. 1 ). Based on early FOCI plankton collections, large-scale patterns in the ichthy- oplankton have been documented for a more extensive portion of the continental shelf along the Alaska Peninsula (Rugen and Matarese 2 ; Rugen 3 ). There remains, however, considerable data from the more recent FOCI spring cruises, the analysis of which may improve our understanding of the ecological re- lationships among the fish popula- tions inhabiting this region. * This paper is contribution FOCI-0 187 from the Fisheries Oceanography Coordinated Investigations program of the National Oceanic and Atmospheric Administration. 1 Kendall, A. W., Jr., J. R. Dunn, R. J. Wolotira Jr., J. H. Bowerman Jr., D. B. Dey, A. C. Matarese, and J. E. Munk. 1980. Zooplankton, including ichthyoplankton and decapod larvae, of the Kodiak Shelf. U. S. Dep. Commer., NOAA, Natl. Mar. Fish. Serv., Alaska Fish. Sci. Cent., 7600 Sand Point Way NE, Seattle, WA 98115. Proc. Rep. 80-8, 393 p. 2 Rugen, W. C, and A. C. Matarese. 1988. Spatial and temporal distribution and rela- tive abundance of Pacific cod (Gadus macrocephalus ) larvae in the western Gulf of Alaska. U.S. Dep. Commer., NOAA, Natl. Mar. Fish. Serv., Alaska Fish. Sci. Cent., 7600 Sand Point Way NE, Seattle, WA, 98115. Proc. Rep. 88-18, 53 p. 3 Rugen, W. C. 1990. Spatial and temporal distribution of larval fish in the western Gulf of Alaska, with emphasis on the pe- riod of peak abundance of walleye pollock. U.S. Dep. Commer., NOAA, Natl. Mar. Fish. Serv., Alaska Fish. Sci. Cent., 7600 Sand Point Way NE, Seattle, WA, 98115. Proc. Rep. 90-01, 162 p. 231 232 Fishery Bulletin 93(2). 1995 During the 1970's and 1980's, several investiga- tions of ichthyoplankton in the neuston were con- ducted in the northeast Pacific Ocean, primarily off the coasts of Washington and Oregon but also ex- tending to southern California waters ( Ahlstrom and Stevens, 1976; Shenker, 1988; Brodeur, 1989; Doyle 1992). These studies established that larvae of many fish are abundant at the surface as well as deeper in the water column and that an additional group of species is almost exclusively neustonic. Doyle (1992) identified obligate and facultative members of the neuston among the larvae and juveniles of fish col- lected off Washington, Oregon, and northern Cali- fornia and attributed their association with the neus- ton primarily to the unique trophic conditions that prevail in this environment. Clearly, the neustonic realm is important in the early life history of many fish species (Zaitsev, 1970; Hempel and Weikert, 1972; Moser, 1981; Tully and O'Ceidigh, 1989; Doyle 1992). The level of importance, however, varies with geographical area and local conditions. Rogers et al. (1979), Kendall and Dunn (1985), Kendall et al. 1 , and Rugen 3 identified a unique sur- face component in the ichthyoplankton of the west- ern Gulf of Alaska and concluded that the larvae of several species, mainly hexagrammids and cottids, are primarily neustonic. This finding merits further investigation concerning the ecological significance of a neustonic existence, particularly in this shelf area where there is a dynamic surface zone with a vigor- ous flow field (Reed et al., 1988; Reed and Schu- macher, 1989). The present paper focuses on the neustonic ichthyoplankton in the western Gulf of Alaska. During seven of the spring cruises (1981- 86), neuston as well as subsurface bongo net sam- pling was carried out. Data from these collections were used 1 ) to examine species composition and rela- tive abundance of ichthyoplankton taxa in the neus- ton and to compare these with subsurface ichthyoplankton col- lected concurrently; 2) to iden- tify obligate and facultative members of the neustonic ich- thyoplankton; 3) to investigate diel variation in catches of lar- vae in the neuston; 4) to com- pare size distributions among the neustonic and subsurface larvae; and 5) to describe hori- zontal distribution patterns of the dominant neustonic ich- thyoplankton species and to re- late these to the oceanography of the western Gulf of Alaska. Methods In 1981, the National Marine Fisheries Service (NMFS) initiated studies on the early life history of walleye pollock in the northwestern Gulf of Alaska. These studies included cooperative cruises with the Soviet Pacific Research Institute (TINRO, Vladi- vostok). Although the primary purpose of these cruises was to assess the spatial distribution and abundance of walleye pollock and to understand the dynamics of their planktonic stages, all taxa collected were identified and measured. For the present study, we used data from seven cruises during which both neuston net and bongo net samples were collected at each station. These cruises were conducted during spring months of the years 1981 to 1986 (Table 1). The survey area extended from the Kenai Peninsula ( 145°W), southwest along the Alaska Peninsula and Kodiak Island to Unimak Pass (165°W). The topog- raphy of the study area in the western Gulf of Alaska is characterized by numerous troughs and shallow banks (Fig. 1). The shelf area, as defined by the 200- m isobath, is generally wide (65-175 km) and drops abruptly to depths of 5,000-6,000 m in the Aleutian Trench, which parallels the shelf break (Fig. 1). A detailed description of the physical oceanography of the region is provided by Reed and Schumacher (1986). The neuston was sampled at a total of 898 stations (Table 1). Station locations varied for each cruise because of specific objectives and are given in Dunn and Rugen. 4 Neuston net samples were collected with a Sameoto sampler ( Sameoto and Jaroszynski, 1969 ) Dunn, J. R., and W. C. Rugen. 1989. A catalog of Northwest and Alaska Fisheries Center ichthyoplankton cruises, 1965-1988. U.S. Dep. Commer., NOAA, Natl. Mar. Fish. Serv., Alaska Fish. Sci. Cent, 7600 Sand Point Way NE, Seattle, WA, 98115. Proc. Rep. 89-04, 197 p. Table 1 Summary of neuston collections by cruise in the western Gulf of Alaska. conducted during spring of 1981 to 1986 Cruise Inclusive dates Number of collections Longitudinal range (°W) 1SH81 5-18 March 1981 130 148-164 2SH81 16-24 April 1981 60 151-159 1CH83 16-31 May 1983 62 154-159 1SH84 17 April-9 May 1984 157 145-159 1P085 29 March-21 April 1985 151 150-158 2P085 16 May-8 June 1985 189 148-168 1GI86 30 March-20 April 1986 149 138-166 Doyle et al.: Neustonic ichthyoplankton in the western Gulf of Alaska 233 Gulf of Alaska 169° W 167° 165° 163° 161° 159° 157° 155° 153° 151° 149° 147° 53° 145° Figure 1 Near surface currents and some geographic and bathygraphic features of the western Gulf of Alaska. Currents based on Reed and Schumacher (1986). with a mouth opening of 0.3 m x 0.5 m and with a 0.505-mm mesh net. Ship speed was 2 knots. Stan- dard MARMAP (Marine Resources Monitoring As- sessment and Prediction) oblique tows (Smith and Richardson, 1977) were conducted to sample subsur- face ichthyoplankton with 60-cm bongo samplers fit- ted with 0.505-mm mesh nets. In shelf waters, tows were made to a depth close to the bottom, usually around 5 m above, and in deep water to a maximum depth of approximately 200 m. Calibrated flowmeters in the mouths of the samplers were used to deter- mine the volume of water filtered by each net. Counts offish eggs and larvae were converted to den- sities per 1,000 m 3 for neuston collections, as follows: (n)( 1,000 )/[(h)(w )(/)], where n = number of organisms in sample; h = effective fishing height of net opening (0.15 m); w = width of net opening (0.5 m); / = length of tow in meters (calculated from flowmeter). In order to determine the importance of the neustonic layer relative to that of the entire water column, we compared the paired catches of neuston and bongo tows from the same stations following the approach derived by Hobbs and Botsford ( 1992). This approach accounts for the differences in surface area sampled between the neuston tows and the bongo tows. The method solves for the density of larvae per unit area in the ith sample (A.) and the portion of total water column larvae in the neuston ( 9) simul- taneously in an iterative fashion. We first calculated the surface area (in m 2 ) sampled by the neuston (A m ) and bongo (A..) net as: Kt = hxwxl 234 Fishery Bulletin 93(2), 1995 and Ah - r xkxI where r - radius of net opening (0.3 m for bongo net); d = depth of water column sampled. The maximum likelihood estimates of A and 6 for k sample pairs are derived as follows: S„,+S h x=- and ■'ni °fei k 6 = min IX (=1 X A "'^' V i=l where S = number of larvae in the ith neuston sample; S bj = number of larvae in the j'th bongo sample. This method assumes that the sample pairs are drawn from a population that is distributed randomly in the horizontal plane but stratified vertically (Hobbs and Botsford, 1992). Plankton samples were preserved in the field with a 5% formalin-seawater solution buffered with so- dium tetraborate. Ichthyoplankton were sorted at the Polish Plankton Sorting Center in Szczecin, Poland. All fish eggs and larvae were removed and identi- fied to the lowest possible taxa. Identifications were later verified at the NMFS laboratory in Seattle. Up to 50 larvae per taxon per station were measured to the nearest 0.1 mm standard length (SL). Since sampling patterns and positions were dif- ferent for each cruise, the study area was subse- quently divided into 298 sectors of approximately 215 mi 2 (347 km 2 ). Data from stations within each sector were pooled so that average distribution patterns could be determined for the dominant neustonic taxa. The number of tows in each sector over all seven cruises are illustrated by various levels of stippling (Fig. 2). The mean densities of individual taxa were calculated for each sector by dividing the summed i i i i i i i i i i i i i i i i i i i i i i i i , 11 i i i hP^FQ 57 "00 59°00N 55°00 1 I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I " 53 "00 165°00W 163°00 161°00 159°00 157°00 155°00 153°00 151°00 149°00 147°00 145°00 Figure 2 Neuston sampling coverage and intensity per sector for all seven cruises combined (1981-86). Doyle et al.: Neustonic ichthyoplankton in the western Gulf of Alaska 235 abundance in each sector by the total number of sta- tions sampled within that sector. Cooccurrences of larval fish taxa in the neuston net samples were determined by using recurrent group analysis (Fager, 1957). This analysis identi- fies groups of taxa that occur together relatively fre- quently and considers only joint occurrences and not abundance. The procedure involves two steps: the calculation of indices of affinity for each pair of taxa and the formation of groups of taxa based on a cho- sen minimum index value. The equation for the af- finity index is N, l where/ = the affinity index (range 0-1); Nj = the number of joint occurrences; N a = the number of occurrences of taxon a, the less common taxon; Nb = the number of occurrences of taxon b, the more common taxon. species. The "flexible sorting" strategy was used and a recommended value of -0.25 was chosen as the clus- tering intensity coefficient (Lance and Williams, 1967). To aid in identification of groups from the dendro- grams, the original data sets (species abundance x stations) were rearranged into two-way tables accord- ing to the order that species and stations appeared in the dendrograms. In this manner, it was possible to see how a group of stations was characterized by the occurrence or definitive range of abundance of a particular species or group of species. After the final species and station groups were chosen, the two-way tables were reduced by calculating the mean abun- dance of each species, within the different species groups, for each station group. The station groups were then plotted on maps of the sampling area to aid in the identification of geographically distinct groups of fish larvae. Results For this study, minimum index values for the for- mation of recurrent groups were set at 0.3 and 0.4, respectively, for two separate runs of the analysis. One or both of these values have been chosen previ- ously by other workers who applied this method to ichthyoplankton data (Kendall and Dunn, 1985; Moseretal., 1987). Numerical classification was used to investigate multispecies spatial patterns among the fish larvae in the neuston. It involves grouping similar entities based on numerical data such as, in this instance, species abundance at a range of stations (Clifford and Stephenson, 1975). An agglomerative, hierarchical technique was chosen. Normal and inverse classifi- cations were carried out on the data sets (i.e. both the species and stations were classified into groups). Only the dominant larval fish taxa occurring in >4% of the samples were included in this analysis, as scarce taxa did not contribute significantly to spa- tial patterns overall. The numerical classification was performed on each individual data set from the seven neuston cruises, as well as on data combined for all the cruises (i.e. mean abundance of larval fish spe- cies in each of the previously chosen geographical sectors). The data were log-transformed prior to analysis. The first step in the classification procedure com- prised the calculation of correlation coefficients for each pair of species or stations in a data set. The Bray-Curtis dissimilarity measure was used. An agglomerative, hierarchical sorting strategy pro- duced dendrograms depicting clusters of stations and Taxonomic composition and density A total of 24,327 fish eggs were collected in the neus- ton samples. Eggs of 12 species representing five families were identified from the samples (Table 2). The numerically dominant taxa included the gadid Theragra chalcogramma and several pleuronectids, mainly Errex zachirus, Hippoglossoides elassodon, Microstomas pacificus, and other unidentified Pleuronectidae. Theragra chalcogramma was the only taxon whose eggs occurred in greater than 10% of all the samples. Although the density of Clupea pallasi eggs was relatively high, this taxon occurred in less than 1% of the samples. It is likely that the presence of these demersal eggs in the neuston was due to clumps of eggs breaking off the substrate and floating to the surface. The low diversity and gener- ally low density offish eggs in the neuston (relative to the diversity and density of fish larvae) was in- dicative of the scarcity of species that spawn pelagic eggs in this region. In total, 41,157 specimens of larvae or early juve- niles were caught in the neuston. The taxonomic di- versity and overall density were higher than for the eggs (Table 3). Thirty-five species were identified representing a total of 18 families. Apart from T. chalcogramma and Anoplopoma fimbria, which spawn pelagic eggs close to the bottom, the numeri- cally dominant taxa among the larvae were demer- sal spawners. Among the dominant larvae, the families Hexa- grammidae and Cottidae were best represented. The 236 Fishery Bulletin 93(2). 1995 Table 2 Summary of all fish eggs collected in neuston gear during spring cruises from 1981 to 1986 in the western Gulf of Alaska. Percent Mean occurrence abundance Scientific name Common name (n=895) (no./lOOOm 3 ) Clupea pallasi Pacific herring 0.37 22.83 Theragra chalcogramma walleye pollock 28.12 205.59 Sebastalobus spp. unidentified thornyhead 1.39 1.04 Chirolophis nugator mosshead warbonnet 0.09 0.03 Trachipterus altivelis king-of-the-salmon 0.74 0.16 Eopsetta exilis slender sole 0.09 0.01 Errex zachirus rex sole 6.38 5.50 Hippoglossoides elassodon flathead sole 7.12 10.69 Microstomas pacificus Dover sole 5.46 33.50 Platichthys stellatus starry flounder 1.57 1.22 Pleuronectes asper yellowfin sole 0.09 0.03 Pleuronectes isolepis butter sole 0.37 0.20 Pleuronectes quadrituberculatus Alaska plaice 5.83 12.67 Pleuronectes vetulus English sole 0.46 0.49 Pleuronectidae unidentified flounder 5.83 12.67 Teleost Type A unidentified teleost 4.07 2.07 Teleost Type H unidentified teleost 0.09 0.01 most abundant species by far was the hexagrammid Hexagrammos decagrammus , which was present in 71% of all the samples collected and had a mean den- sity of 234 larvae/1,000 m 3 (Table 3). Less abundant were the hexagrammids H. stelleri and Pleurogram- mus monopterygius. The category Hexagrammos spp. was also numerically important. Many of these lar- vae were most likely H. decagrammus, but the con- dition of the specimens made specific identification impossible. The most important taxa among the cottids were Hemilepidotus hemilepidotus, H. jordani, H. spinosus, Hemilepidotus spp., and Myoxocephalus spp. Hemilepidotus hemilepidotus was the third most abundant species overall, present in 20% of the samples with a mean density of 60 lar- vae/1,000 m 3 . Ammodytes hexapterus was the sec- ond most abundant taxon with a mean density of 148 larvae/1,000 m 3 and was present in 14% of the samples. With a mean density of 43 larvae/1,000 m 3 , Cryptacanthodes aleutensis was ranked as the fourth most abundant larval taxon and it was present in 21% of the samples collected. The remaining larval taxa each were found in less than 10%- of the samples and had a mean density of less than 20 larvae/1,000 m 3 . Most important among these were Mallotus villosus, Theragra chalcogramma, the hexagrammids and cottids mentioned above, Bathy master spp., and the family Stichaeidae. The rest were scarce, mostly with a mean density of less than 1 larva/1,000 m 3 and a percent occurrence of less than 2%. A comparison of the occurrence of dominant taxa of ichthyoplankton in the neuston samples with their occurrence in bongo samples, and estimates of the fraction of each taxon in the neuston, indicate that most of the dominant larval taxa in the neuston were scarce or absent in the subsurface zone (Table 4). In contrast, the dominant taxa of eggs were the same for both neuston and subsurface samples. Theragra chalcogramma eggs were by far the most abundant and accounted for 69%- of all eggs caught in the neus- ton and 95% in the bongo samples. Eggs of pleuro- nectids, mainly of Microstomus pacificus, Hippo- glossoides elassodon, and Errex zachirus, were the only other eggs to be significantly abundant in ei- ther gear, again indicating the paucity of pelagic spawners in this region. The estimated fractions ( 6) of these eggs occurring in the neuston were moder- ately high (9-26%) merely showing that positively buoyant eggs tend to accumulate in the surface layer. The only taxa of larvae well represented in both neuston and bongo samples were T chalcogramma, A. hexapterus, and Bathy master spp. (Table 4). All three occurred in much fewer of the neuston net than the bongo net samples, however. In addition, the frac- tions of these taxa occurring in the neuston were low (<13%) suggesting that they were only occasionally abundant in the neuston. Among the less abundant taxa in the neuston, Mallotus villosus, Stichaeidae, Zaprora silenus, and Myoxocephalus spp. were only slightly better represented in neuston net than in Doyle et al.: Neustonic ichthyoplankton in the western Gulf of Alaska 237 Table 3 Summary of all fish larvae collected in the neuston during spring cruises from 1981 to 1986 in the western Gulf of Alaska. Percent Mean occurrence abundance Scientific name Common name (n=895) (no./1000m 3 i Mallotus villosus capelin 5.83 8.90 Osmeridae unidentified smelt 0.09 0.03 Nansenia Candida bluethroat argentine 0.09 0.01 Oncorhynehus keta chum salmon 0.09 0.01 Bathylagidae unidentified deepsea smelt 0.09 0.01 Stenobrachius leucopsarus northern lampfish 0.09 0.01 Gadus maeroeephalus Pacific cod 0.65 0.15 Theragra chalcogramma walleye pollock 6.75 13.66 Gadidae unidentified gadid 0.56 0.24 Sebastes spp. unidentified rockfish 1.67 2.68 Hexagrammos decagrammus kelp greenling 59.11 194.84 Hexagrammos lagocephalus rock greenling 0.46 0.09 Hexagrammos octogrammus masked greenling 1.85 0.26 Hexagrammos stelleri whitespotted greenling 8.14 1.87 Ophiodon elongatus lingcod 1.76 0.53 Pleurogrammus monopterygius Atka mackerel 3.61 1.76 Hexagrammos spp. unidentified greenling 3.52 5.94 Hexagrammidae unidentified greenling 0.28 0.04 Anoplopoma fimbria sablefish 5.00 15.37 Blepsius bilobus crested sculpin 0.09 0.01 Enophrys bison buffalo sculpin 0.09 0.01 Hemilepidotus hemilepidotus red Irish lord 16.84 50.25 Hemilepidotus jordani yellow Irish lord 5.55 3.63 Hemilepidotus spinosus brown Irish lord 6.38 5.80 Hemilepidotus spp. unidentified Irish lord 3.70 5.47 Leptocottus armatus Pacific staghorn sculpin 0.09 0.01 Myoxoeephalus spp. unidentified sculpin 2.59 1.04 Radulinus boleoides darter sculpin 0.09 0.01 Cottidae unidentified sculpin 0.65 0.10 Agonidae unidentified poacher 0.28 0.04 Cyclopteridae unidentified snailfish 0.37 0.06 Bathymaster spp. unidentified ronquil 4.63 6.68 Chirolophis decoratus decorated warbonnet 0.19 0.05 Chirolophis spp. unidentified warbonnet 0.56 0.16 Lumpenella longirostris longsnout prickleback 0.09 0.02 Stichaeidae unidentified stichaeid 1.57 4.90 Cryptacanthodes aleutensis dwarf wrymouth 17.76 36.13 Cryptaeanthodes giganteus giant wrymouth 1.67 0.53 Zaprora silenus prowfish 2.78 1.09 Ammodytes hexapterus Pacific sand lance 11.75 123.75 Atheresthes stomias arrowtooth flounder 0.19 0.04 Errex zachirus rex sole 0.46 0.08 Hippoglossoides elassodon flathead sole 0.93 0.15 Hippoglossus stenolepis Pacific halibut 1.67 0.48 Mierostomus pacificus Dover sole 0.09 0.01 Platichthys stellatus starry flounder 0.19 0.05 Pleuronectes bilineatus rock sole 0.56 0.12 Pleuronectes vetulus English sole 0.09 0.01 Psettichthys spp. unidentified sole 0.19 0.02 Reinhardtius hippoglossoides Greenland turbot 1.48 0.55 238 Fishery Bulletin 93(2), 1995 Table 4 Comparison of percent occurence and percent of total abundance (based on no ./1000 m 3 ) of the dominant taxa in the neuston and bongo collections and fraction of each taxon occurring in the neustonic layer (6). Taxa ranked in order of percent occurrence in neuston. Neuston Bongo Fraction Percent Percent Percent Percent Taxa occurrence total abundance occurrence total abundance in neuston Eggs Theragra chalcogramma 33.85 69.40 46.90 95.10 0.013 Hippoglossoides elassodon 8.69 3.61 21.06 0.72 0.091 Errex zachirus 7.68 1.86 18.07 0.77 0.155 Pleuronectidae 7.02 4.28 8.54 2.10 0.261 Microstomias paciftcus 6.57 11.31 13.08 0.87 0.209 Larvae Hexagrammos decagrammus 71.16 40.15 4.99 0.22 0.930 Cryptacanthodes aleutensis 21.38 7.44 3.22 0.08 0.861 Hemilepidotus hemilepidotus 20.27 10.35 2.33 0.09 0.890 Ammodytes hexapterus 14.14 25.50 73.84 29.92 0.053 Hexagrammos stelleri 9.80 0.79 0.11 <0.01 0.989 Theragra chalcogramma 8.13 2.82 48.78 46.05 0.009 Hemilepidotus spinosus 7.68 1.19 0.55 0.01 0.932 Mallotus villosus 7.02 1.83 5.10 0.18 0.568 Hemilepidotus jordani 6.68 0.75 0.00 0.00 1.000 Anoplopoma fimbria 6.01 3.17 2.33 0.04 0.689 Stichaeidae 5.79 0.32 2.33 0.10 0.728 Bathymaster spp. 5.57 1.38 17.74 6.47 0.121 Hemilepidotus spp. 4.45 1.13 2.33 0.04 0.638 Pleurogrammus monopterygius 4.34 0.38 0.11 <0.01 0.974 Hexagrammos spp. 4.23 1.22 0.00 0.00 1.000 Zaprora silenus 3.34 0.22 2.55 0.05 0.541 Myoxocephalus spp. 3.12 0.22 1.88 0.08 0.596 bongo net samples perhaps also reflecting a faculta- tive association with the neuston (i.e. concentrated at the surface only during certain hours). However, the high (54-73%) fraction occurring in the neuston suggests a strong association by these species with the surface zone. The remaining dominant taxa of larvae in the neus- ton were absent or scarce in the bongo samples and all except Hemilepidotus spp. had a value of >85% (Table 4). It seems that their association with the neuston was obligative (i.e. permanent presence in the surface zone). These obligative taxa included the hexagrammids and cottids as well as Crypta- canthodes aleutensis and Anoplopoma fimbria. They formed a unique community of fish larvae in the neustonic realm. Most of the dominant taxa of fish larvae that in- habit the subsurface zone of the western Gulf of Alaska were absent or rare in the neuston, includ- ing Gadus macrocephalus and Sebastes spp., and species of Bathylagidae, Myctophidae, Cyclopteridae, Agonidae, and Pleuronectidae (Kendall and Dunn, 1985; Rugen 3 ). Diel variation in catches of larvae To examine diel variation in catches of larvae for both the neuston and bongo samplers, stations were grouped by hour of the day, and mean densities of larvae for each of the 24 hours were calculated. Be- cause of the substantial variability in day length over the 3-month sampling period, it was not possible to assign a specific sunrise and sunset time that could be used for all cruises. For the purposes of this analy- sis, we assumed that the daytime period lasted from 0700 to 1900 hr and the nighttime from 2200 to 0400 hr. The intervening periods of 0400 to 0700 h and 1900 to 2200 h were presumed to have been twilight, including dawn and dusk, respectively. For all neuston catches combined, both the total mean density and the number of hauls in which lar- vae were caught were higher at night than during Doyle et al.: Neustonic ichthyoplankton in the western Gulf of Alaska 239 the day (Fig. 3A). This pattern was not apparent for the bongo catches taken from the same stations (Fig. 3B). Some of the highest catches of larvae in the bongo samples were taken during daylight. The ra- tio of night:day catches for the neuston was 9.1:1, whereas it was 1.6:1 for the bongo tows. The high ratio of night:day catches in the neuston may be at- tributed to two factors: 1) vertical migration of lar- vae into the neuston at night and 2) enhanced avoid- ance of the neuston sampler during daylight. One or both of these factors may operate among the species of larvae in the neuston. Diel variation in catches among all the dominant taxa of neustonic larvae suggested a daytime de- crease in density in the neuston. All larvae, except Hexagrammos decagrammus and Theragra chalco- Total Fish Larvae m Neuston Samples B 3 5 7 9 11 13 15 17 19 21 23 Local Time (Hours) Total Fish Larvae in Bongo Samples ° 2000 llllllllllllllllllll 1 3 5 7 9 11 13 15 17 19 21 23 Local Time (Hours) Figure 3 Diel variation in density and occurrence of total fish larvae in (A) neuston samples and (B) bongo samples for all cruises combined (1981-86). Bars represent mean density offish larvae; dashed line represents total number of collections; solid line represents the number of hauls that collected fish gramma, had lowest occurrences in neuston samples during the day (Fig. 4). Sampler avoidance by the larvae during daylight probably contributed signifi- cantly to this pattern. The taxa Hemilepidotus jordani, H. spinosus, Myoxocephalus spp., Bathy- master spp., and Zaprora silenus were absent from neuston samples during most daylight hours but were relatively abundant in twilight or nighttime samples. Because the latter three of these taxa were relatively common in bongo samples (Table 4), indi- cating a facultative association with the neuston, their scarcity in the neuston during the day may have been at least in part due to a diel pattern of vertical migration with larvae moving toward the surface zone at night. This may have also been true for T. chalcogramma and Ammodytes hexapterus whose larvae were extremely abundant in the bongo net samples (Table 4) but abundant in the neuston samples only at night (Fig. 4). Mallotus villosus lar- vae were also relatively common in bongo samples (Table 4), although they were most abundant in the neuston at night (Fig. 4). As expected, catches of T. chalcogramma eggs showed no discernable diel variation in either den- sity or frequency of positive hauls. The large mean densities during two periods of the day are most likely due to spatial variation of egg densities rather than to any biological factor. Length distributions of dominant neustonic taxa Standardized length distributions were plotted for the dominant neustonic taxa (Fig. 5). Comparisons were made with the corresponding length distribu- tions of larvae in the subsurface zone for six of these taxa that were sufficiently represented in the bongo samples. For all these six taxa, greater median lengths were documented for larvae in the neuston than in the bongo hauls, especially in the case of Mallotus villosus and Ammodytes hexapterus. Mallotus villosus seemed unusual in that all larvae caught in both neuston and bongo net samples were >25 mm SL indicating a predominance of postflexion larvae. This is most likely due to species identifica- tion capabilities, as it is not possible to identify small osmerids to species until the pectoral fin rays are completely developed. With the exception of Bathymaster spp., the larvae caught in the neuston were also significantly larger than those caught in the bongo collections (Kolmogorov-Smirnov (K-S) 2- sample tests; allP<0.01). For A. hexapterus, it seemed that only the large postflexion larvae and early ju- veniles (mostly >20 mm SL) migrated into the neus- ton, mainly at night; most A. hexapterus larvae 240 Fishery Bulletin 93(2), 1995 Theragra chalcogramma 7 9 11 13 15 17 19 21 23 Local Time (Houis) Theragra chalcogramma Local Time (Hours) Hexagrammos decagrammus 3 11 13 15 17 IS 21 23 Local Time (Hours) Pleurogrammus monopterygius 9 11 13 15 17 19 21 23 Local Time (Hours) Mallolus villosus 9 11 13 15 17 19 21 23 Local Time (Hours) Ammodytes hexapterus ^3000- / 000 / IS. ^ / / \ ° 2000- \ r / Mean Density v 4 i . i III tIIttT i > cJm 9 11 13 15 17 19 21 23 Local Time (Hours) Hexagrammos stelleri 9 11 13 15 17 19 21 Local Time (Hours) Anoptopoma fimbria S-700 E I 8 --500 -8 > o O -6 °- ^400 c J™ 7 19 21 23 Local Time (Hours) Figure 4 Diel variation in density and occurrence of walleye pollock, Theragra chalcogramma, eggs and individual dominant taxa offish larvae in neuston samples, for all cruises combined (1981-86). Bars represent mean density; solid line represents the percent of hauls that caught larvae. Doyle et at.: Neustonic ichthyoplankton in the western Gulf of Alaska 241 Hemilepidotus hemilepidotus 5 7 9 11 13 15 17 10 21 23 Local Time (Hours) Hemilepidotus spinosus 9 11 13 IS 17 19 21 23 Local Time (Hours) Myoxocephalus spp 3 15 17 IB 21 23 Local Time (Hours) Cryptacanthodes aleutensis 9 11 13 15 17 19 21 23 Local Time (Hours) Hemilepidotus jordani 9 11 13 15 17 19 21 23 Local Time (Hours) Hemilepidotus spp 11 13 15 17 19 21 23 Local Time (Hours) Bathymaster spp Local Time (Hours) Zaprora silenus 9 11 13 15 17 19 21 23 Local Time (Hours) Figure 4 (continued) 242 Fishery Bulletin 93(2). 1995 Uallotus villosus n-685 v 9 ^ 45 36 25 15 5 5 15 25 35 45 2025303640465056606670 Cryptacanthodes alautensis 5-3142 35 , , , , o J. 10 o Q. 10 15 20 25 30 35 40 45 SO v J HLu. 5 10 15 20 25 30 35 40 45 SO Hemilepidotus jordani n-276 10 15 20253035404550 Hemilepidotus spp. 20j n " 38S 15- V Theragra chalcogramma 45 35 25 15 Hexagrammos stelleri 25 15- 10 25 35-, 30- 25- 20- 15- 10- 5- 10 15 20 25 30 36 40 45 50 45 36 25 15- 5 5 15- 25 36 46 5 10 15 20 25 30 35 40 45 60 Ba thymaster spp. n-629 Myoxocephalus spp. 2S-, 20 15- 10 5 5 10 15 20 25 10 15 20253035404550 Pleurogrammus monopterygius S 10 15 20 26 30 36 40 45 SO Hemilepidotus hemilepidotus 10 15 20253036404550 5 10 15 20253035404550 Standard length (mm) Hexagrammos decagrammus -ft- i 1 1 1 1 1 1 1 1 r 5 10 15 20253036404660 A/nmodytes hexapterus 1*11771 I T n-12607 5 10 15 20 25 X 35 40 45 60 25 Anoplopoma limbria 20-| n - 1500 15 5 10 15 20253035404550 50-, _ Hemilepidotus spinosus n-501 30- 5 10 15 20253035404550 40-, Zaprora silenus n-93 30 5 10 15 2025X35404550 Figure 5 Length-frequency distributions for the dominant taxa of fish larvae in neuston samples and, where comparable, in bongo samples (open histograms), for all cruises combined (1981-86). caught in the bongo samples were <15 mm SL. In con- trast, larvae of Bathymaster spp. that were common in the neuston at night did not differ significantly in size from those occurring in the bongo samples; all were small, mostly <10 mm SL. Theragra chalcogramma larvae were also relatively small (all < 15 mm but mostly <10 mm SL) both in bongo and neuston catches. Among the remaining neustonic taxa, most larvae caught were >10 mm SL, and length distributions generally displayed one dominant mode within a rela- tively short length interval. The predominant length range for the taxa Hexagrammos decagrammus, Cryptacanthodes aleutensis, Anoplopoma fimbria, Hemilepidotus hemilepidotus, Myoxocephalus spp., Doyle et al.: Neustonic ichthyoplankton in the western Gulf of Alaska 243 and Zaprora silenus was 10-20 mm. Hexagrammos stelleri, Pleurogrammus monopterygius, and Hemil- epidotus jordani larvae were larger with predomi- nant length ranges of 15-40 mm, 15-25 mm, and 15-30 mm, respectively. In contrast, larval sizes for the cottids, Hemilepidotus spinosus and Hemil- epidotus spp., were relatively small with a predomi- nant length range of 5-15 mm. Daytime catches of larvae in the neuston were suf- ficient to make diel comparisons in length distribu- tions for only three of the dominant taxa. There was no significant day-night difference in the length dis- tribution of Hexagrammos decagrammus larvae (K- S test; Z=0.07, P>0.05). Theragra chalcogramma lar- vae caught at night (median length=6 mm) were slightly, but significantly, larger (K-S test; Z=1.52, P=0.02) than those caught during the day (median length=5 mm). Day-night differences were much greater for Ammodytes hexapterus larvae for which the median length caught at night was 24 mm and the median day length was 13 mm (K-S test; Z=4.99, P<0.001). Migration of the larger larvae and juve- niles to the surface at night may have been the cause of this difference, but it is also likely that enhanced sampler avoidance during daylight by large larvae and juveniles reduced the daytime median larval length significantly. Horizontal patterns of distribution Patterns of distribution illustrated here for total and individual dominant taxa of neustonic larvae were based on data combined for all cruises. The distribu- tion maps therefore represent general patterns of horizontal distribution for these species during spring in this region and did not take into account day-night, monthly, or interannual differences in catches. The pattern for total fish larvae in the neuston indicated that highest concentrations generally oc- curred to the southwest of Kodiak Island, in Shelikof Strait, and off the northern tip of Kodiak Island (Fig. 6A). Southwest of the Shumagin Islands and north- east of Kodiak Island, high densities of larvae were more scattered. Despite the high intensity of sam- pling seaward of Kodiak Island (Fig. 2), mean larval concentrations tended to be low in this region. Based on data which incorporated sampling during all sea- sons, Kendall and Dunn (1985) and Rugen 3 fre- quently recorded high concentrations of various spe- cies of larvae in the neuston seaward of Kodiak Is- land. The apparent scarcity of larvae here may there- fore be characteristic of spring in the sampling area. Larvae of the osmerid Mallotus villosus were taken primarily southwest of Kodiak Island along the Alaska Peninsula as far southwest as the Shumagin Islands (Fig. 6b). They were scarce southwest of the Shumagin Islands and seaward of Kodiak Island and absent in the northeastern part of the sampling area. This pattern is similar to that described by Rugen 3 except that the latter study plus Kendall and Dunn's (1985) observations indicated a greater presence of larvae seaward of Kodiak Island. These studies also showed that M. villotus larvae were relatively scarce both in bongo and neuston samples during spring; the main spawning season seems to be late summer through fall (Kendall and Dunn, 1985). Theragra chalcogramma larvae were usually most abundant in the upper 50 m of the water column in the southern Shelikof Strait area and along the Alaska Peninsula during spring (Schumacher and Kendall, 1991). Spawning takes place primarily in the sea valley in Shelikof Strait during late March and early April. Rugen 3 has also documented the occurrence of pollock larvae on occasions in large concentrations to the northeast of Kodiak Island. These patterns were reflected in the distribution of pollock larvae in the neuston documented during the present study (Fig. 6C ). The scarcity of larvae within Shelikof Strait may have been due to the low num- ber of samples from that region. Pollock larvae were absent or scarce along the outer shelf and slope indi- cating that most of the larvae in the surface zone were retained on the shelf. Neustonic larvae of Anoplopoma fimbria were most abundant during late spring and summer in the west- ern Gulf of Alaska where they were associated with the shelf edge (Kendall and Dunn, 1985; Rugen 3 ). The general distribution pattern documented here for the spring months showed them to be most abun- dant close to the shelf edge southwest and northeast of Kodiak Island, as well as around the northern and northwestern perimeter of Kodiak Island (Fig. 6D). As with pollock, this species is a pelagic spawner in deep water, and the distribution pattern of larvae suggested that spawning occurred mainly in outer shelf and slope waters, a pattern which is consistent with what is known about the early life history of this species (Kendall and Matarese, 1987; Doyle, 1992). The dominant hexagrammid species whose larvae were abundant in the neuston of the sampling area all spawn in coastal waters (Matarese et al., 1989). In the Gulf of Alaska region, spawning of these spe- cies seems to occur from fall through spring ( Kendall and Dunn, 1985; Rugen 3 ). Larvae of the most abun- dant species, Hexagrammos decagrammus, were found to be dominant in the neuston during most of the year; during the summer months there was a large decrease in density. They were distributed widely throughout the sampling area, but greater concentrations were found in the southwestern re- 244 Fishery Bulletin 93(2), 1995 l 'V ,'.^^J Mallotus villosus '*®p r *K Anoplopoma fimbria Figure 6 Distribution maps for total and individual dominant taxa offish larvae in the neuston for all cruises (1981-86). Mean density of a particular taxa is superimposed on each sector in the form of a dot the area of which is proportional to the mean number of larvae/1,000 m 3 . gion than northeast of Kodiak Island (Rugen 3 ). The same pattern was apparent from the spring data presented here (Fig. 6E). Larvae were most abun- dant to the north of Kodiak Island and to the south- west beyond the Shumagin Islands, whereas densi- ties were lowest to the northeast and offshore of Kodiak Island. Kendall and Dunn ( 1985) documented widespread distribution around Kodiak Island but mainly at nearshore and midshelf stations early in the spawning season during fall. Advection of larvae in the neuston is probably extensive throughout win- ter and spring months in this region. Patterns in seasonal occurrence and spatial distribution of H. stelleri larvae were similar to those for H. deca- grammus (Fig. 6F), and as found in previous studies (Kendall and Dunn, 1985; Rugen 3 ), densities were much lower than those for H. decagrammus. The third dominant hexagrammid species, Pleuro- grammus monopterygius, was also considerably less abundant in the neuston than was H. decagrammus. Although the spawning season appears to extend from fall through spring, maximum densities of these larvae have been recorded during late October in the Kodiak Island region (Kendall and Dunn, 1985). The distribution of P. monopterygius larvae during the spring months of the present study extended from the Kodiak Island region southwest to the Shumagin Island area; most records were in the vicinity of the shelf edge from Kodiak Island to the Shumagin Is- lands (Fig. 6G). Kendall and Dunn ( 1985) and Rugen 3 also recorded highest densities of these larvae over the outer shelf and slope in the Kodiak Island re- gion. The former authors also documented fingers of occurrence of these larvae extending shoreward as- sociated with the troughs seaward of Kodiak Island. Although the larvae of this species usually display an offshore and oceanic distribution, spawning is known to take place in shallow water where currents Doyle et al.: Neustonic ichthyoplankton in the western Gulf of Alaska 245 TP 5 ^ Hexagrammos stelleh Pleurogrammus monopterygius ~W*\ H Hemilepidotus hemilepidotus Figure 6 (continued) are strong, primarily at 10-30 m depth, following an onshore migration by the mature adult fish during summer (Gorbunova, 1962; Macy et al. 5 ). Gorbunova (1962) describes the oceanic occurrence of P. monopterygius larvae in the Pacific Ocean and Bering Sea and suggests that they migrate out to sea after hatching in shallow water, thus explaining the pri- marily offshore distribution pattern observed for these larvae. The predominant cottid species in the sampling area were members of the genus Hemilepidotus. As with the hexagrammids, these species are inshore coastal dwellers that spawn demersal eggs and have neustonic larvae (Matarese et al., 1989). In the study area, spawning seems to occur from fall through Macy, P. T., J. M. Wall, N. D. Lampsakis, and J. E. Mason. 1978. Resources of the non-salmonid pelagic fishes of the Gulf of Alaska and eastern Bering Sea. Part 1: Introduction, general fish resources and fisheries, and review of literature on non- salmonic pelagic fish resources. Part of Final Report for Con- tracts R7120811 and R7120812, Task A-7, Research Unit 64/ 354, Outer Continental Shelf Environment Assessment Pro- gram, U.S. Dep. Interior, Bureau of Land Management, 355 p. spring; peak densities of larvae occur in the neuston during fall (Kendall and Dunn, 1985). The most abun- dant cottid recorded during the present study was H. hemilepidotus . Highest densities of this species occurred to the southwest of Kodiak Island, extended beyond the Shumagin Islands, and had a tendency to be associated with the mid- to outer-shelf region (Fig. 6H). Larvae were scarce northeast of Kodiak Island. The same pattern of distribution was ob- served for this species by Rugen 3 from samples taken during all seasons. The less abundant H.jordani dis- played a similar distribution pattern (Fig. 61) as did Hemilepidotus spp. (Fig. 6K). Hemilepidotus spinosus, however, had a more northerly distribu- tion. Most larvae were caught northeast of Kodiak Island (Fig. 6J), suggesting that this is the main spawning area for this species. Kendall and Dunn ( 1985) found larvae of the cottid Myoxocephalus spp. to be most abundant during sum- mer to the south of Kodiak Island. The samples from the present study yielded low numbers of these larvae; when present they were found in the mid-shelf region 246 Fishery Bulletin 93(2). 1995 F"*3 Hemilepidotus jordani W >so ° xr^n Hemilepidotus spinosus ^P^ K Hemilepidotus spp. ^.^"^AJ Myoxocephalus spp. Figure 6 (continued) between Kodiak Island and the Shumagin Islands (Fig. 6L). Spawning may be centered in this region. Three species of bathymasterids belonging to the genus Bathymaster are known to occur in the sam- pling area: B. caeruleofasciatus , B. leurolepis, and B. signatus (Rogers et al., 1979; Rugen 3 ). They are coastal demersal spawners. At the larval stage, it is not possible to identify these to species and they are included here in the taxon Bathymaster spp. The dis- tribution of these larvae during spring was centered southwest of Kodiak Island (Fig. 6M) suggesting that this may be a primary spawning area. Occurrences were scarce northeast of Kodiak Island and south- west of the Shumagin Islands. It seems, however, that spring is a period when Bathymaster larvae are relatively scarce in the neuston. Previous studies have found these larvae to be most abundant in sub- surface samples from May to October with a peak in summer (Kendall and Dunn, 1985; Rugen 3 ). In the neuston, however, larvae did not become abundant until late June. Although Rugen 3 found Bathymaster larvae to be most abundant from Kodiak Island to the Shumagin Islands, he also found them to be abun- dant seaward of Kodiak Island, particularly during the summer, as did Kendall and Dunn ( 1985). There may be a northeasterly progression in spawning ac- tivity in the sampling area from spring to summer. The wrymouth Cryptaeanthodes aleutensis is epi- and meso-benthic in shelf and slope waters and spawns demersal eggs during spring and summer (Matarese et al., 1989). Larvae are associated mainly with the neuston (Kendall and Dunn, 1985; Doyle, 1992; Rugen 3 ). The distribution of C. aleutensis lar- vae during the spring months of the present study was associated primarily with Kodiak Island and southwest to the Shumagin Islands (Fig. 6N), simi- lar to that documented by Rugen. 3 Densities were higher in the inner- and mid-shelf region than along the shelf edge and slope. The Pacific sand lance, Ammodytes hexapterus, is a pelagic, schooling species common to coastal and shelf waters and it spawns demersal eggs. Its larvae have been found to be facultative members of the neuston along the U.S. west coast where the well- Doyle et al.: Neustonic ichthyoplankton in the western Gulf of Alaska 247 *^*1 Cryptacanthodes aleutensis O Ammodytes hexapterus Figure 6 (continued) developed larvae are abundant in the neuston mainly at night ( Doyle, 1992 ). They are common in the neus- ton and subsurface zone in the western Gulf of Alaska from winter to summer (Kendall and Dunn, 1985; Rugen 3 ). Mean larval lengths tended to be greater in the neuston, however, and densities were highest in the neuston during late spring and summer. As with many of the other species, A. hexapterus larvae were most abundant during spring in the mid-shelf area from southern Kodiak Island to the Shumagin Islands (Fig. 60). They were scarce to the northeast and seaward of Kodiak Island and southwest of the Shumagin Islands. Kendall and Dunn (1985) and Rugen 3 found them to be more widely distributed in subsurface samples, including high numbers north- east and seaward of Kodiak Island, implying that spawning is widespread throughout the sampling area. Multispecies spatial patterns Three recurrent groups of larval fish taxa were iden- tified by using Recurrent Group Analysis on data from all cruises (Fig. 7). Constituent members of these groups displayed affinity levels of >0.4 with each other. Individual species from these groups were also associated with individual species from other groups, or from outside the groups, at affinity levels of>0.3or>0.4. The largest group contained four taxa, Crypta- canthodes aleutensis , Hemilepidotus hemilepidotus, Mallotus villotus, and Stichaeidae, which frequently occurred together in the same samples. A second group comprising Ammodytes hexapterus and Hexagrammos decagrammus, the two most abundant larval species in the neuston, was connected to Group 1 via individual linkages among all taxa except Stichaeidae. The result, two groups and their asso- ciated weak linkages, suggested the existence of a loosely affiliated assemblage of larval species in the neuston for this region. Pleurogrammus monopterygius and Hemilepidotus spp. belonged to a third recurrent group which did not display any linkages with other species or groups of species. This may reflect the unusual association 248 Fishery Bulletin 93(2), 1995 H. jordani - H. splnosus - Bathymaster spp. A. fimbria — C. aleutensls H. hemilepidotus Mallotus villosus Stlchaeidae Affinity Level 0.40 0.30 Myoxocephalus spp. A. hexapterus H. decagrammus H. stelleri P. monopteryglus Hemilepidotus spp. Figure 7 Results of recurrent group analysis on neuston data (larvae) for all cruises ( 1981-86). Boxes enclose members of recurrent groups that have affinity levels of 0.4 or higher with each other. Lines connect taxa with affinities outside their groups. i l l i ' ' ''..'' i i i i i of P. monopterygius larvae with the outer shelf and slope particularly off Kodiak. Hemilepidotus spp. had a similar pattern of distribution. Two species which were in- cluded in the analysis, but did not display significant affinities with any of the other taxa, were Theragra chalcogramma and Zaprora silenus. It seemed that at least in the neuston, T. chalcogramma, which is the dominant larval taxon in this region, had a unique pattern of occurrence, largely dissimilar to the other neustonic larvae. The lack of affinity of Z. silenus with other species was probably due to its infrequent occurrence in these samples. Kendall and Dunn ( 1985 ) and Rugen 3 found a variety of recur- rent groups and inter-species linkages among the neustonic fish larvae in the western Gulf of Alaska over four seasons. The species groups and affinities changed seasonally and were inconsistent among two-week random (Fig. 8) but di trends which reflected sampling periods. Similar to the results presented here, T. chalcogramma did not occur among the recurrent groups or associated linkages of spe- cies identified in these studies. Five species groups and eight sector groups (sectors= sampling sectors in Fig. 2) were identified from the agglomerative hierarchical classification of data com- bined for all the cruises (Table 5). The Bray-Curtis dissimilarity coefficient val- ues at which these groups were formed were high ( mini- mum value of 0.63), particu- larly among the sector groups. These indicated that the groupings were weak and that species were only loosely affiliated with each other in terms of density and distri- bution patterns. The distribution of the eight sector groups seemed splayed certain geographical a variety of distribution pat- i i i iii .i. i I I ,'.U' ' A+AJ i T tV*R 4 2 5 8 3 1 192274722 I 7 2 2 8 12 I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I Figure 8 Distribution of sector groups resulting from numerical classification of density data for the dominant taxa offish larvae in the neuston, based on all cruises ( 1981-86). A plus sign ( + ) indicates that no fish larvae were caught in that sector. Doyle et al.: Neustonic ichthyoplankton in the western Gulf of Alaska 249 terns among the larval species. Groups 1 and 2 to- gether were characterized by highest densities of most species (Table 5); these sectors were located primarily around Kodiak Island and particularly in the region between Kodiak Island and the Shumagin Islands to the southwest. Total larval abundance was very low in Group-3 sectors (Table 5 1 which were concentrated mainly to the northeast of Kodiak Is- land and to a lesser extent around the Shumagin Islands. Group-4 sectors displayed an offshore dis- tributional trend, mainly seaward of Kodiak Island. Larval abundance was moderately high for this group, enhanced by highest mean density of Hemilepidotus spp. and Pleurogrammus mono- pterygius (Table 5). Most of the sectors in Group 5 were distributed close to Kodiak Island, and the coastal half of the region immediately southwest of Kodiak, along the Alaska Peninsula. Mean larval density was also moderately high for this group; Theragra chalcogramma, Hexagrammos deca- grammus, and Ammodytes hexapterus were the pre- dominant species. Group 6 included only eight sec- tors, five of which occurred close to Kodiak Island and three in the northeastern extremity of the sam- pling area. Mean densities of T. chalcogramma and A. hexapterus were highest for this group (Table 5) owing to their occurrence in extremely high num- bers in one of the sectors (different one for each spe- cies) along the southern half of Kodiak Island (Fig. 5). Hexagrammos decagrammus was the only spe- cies to occur in sectors belonging to Groups 7 and 8 (Table 5) which were scattered randomly through- out the sampling area. This species was unusual in that its distribution was widespread in contrast with the other taxa that were confined primarily to two or three of the sector groups. Discussion Our results indicated that species diversity and den- sity of fish eggs in shelf waters in the western Gulf of Alaska were essentially the same in the surface and subsurface zone. Theragra chalcogramma eggs were exceptionally abundant and, along with eggs of several pleuronectid species, accounted for >90 c 7c of all eggs taken in both bongo and neuston samples. Except for T. chalcogramma, pelagic eggs tended to be scarce in the neuston where the predominant mode of spawning among fish species is demersal (Kendall Table 5 Two-way coincidence table showing mean density (no./lOOO m 3 ) of dominant larval species among sector groups. Numbers in parentheses are dissimilarity coefficient values at which the groups were formed Values are >1 in certain instances owing to use of the flexible sorting strategy in combining the entities into groups. Sector groups 1 2 3 4 5 6 7 8 Species groups (1.35) (1.05) (1.67) (1.40) (1.42) (1.29) (0.95) (0.79) 1 Hexagrammos stelleri 2.9 0.8 1.8 4.1 0.8 1.4 0.0 0.0 (0.63) Hemilepidotus jordani 3.7 14.6 0.8 1.9 0.0 0.0 0.0 0.0 Bathymaster spp. 65.4 0.1 0.0 0.6 0.0 1.4 0.0 0.0 Cryptaeanthodes aleutensis 171.2 18.6 1.7 0.3 2.0 45.6 0.0 0.0 2 Anoplopoma fimbira 85.4 1.3 3.6 0.1 0.0 0.0 0.0 0.0 (0.76) Hemilepidotus spp. 1.9 14.2 0.2 48.7 0.8 0.1 0.0 0.0 Hemilepidotus spinosus 2.2 7.6 6.7 0.3 0.0 0.0 0.0 0.0 3 Mallotus villosus 18.6 15.0 0.0 6.3 1.0 0.0 0.0 0.0 (0.79) Pleurogrammus monopterygius 1.3 2.5 0.0 13.6 0.1 0.0 0.0 0.0 Theragra chalcogramma 22.3 0.6 0.2 0.8 53.3 298.1 0.0 0.0 4 Hexagrammos spp. 2.9 0.7 4.1 0.2 0.3 0.0 0.0 0.0 (0.98) Hemilepidotus hemilepidotus 55.3 291.1 2.3 22.7 1.2 0.0 0.1 0.0 Sebastes spp. 7.0 1.0 0.0 0.0 0.0 2.1 0.0 0.0 5 Hexagrammos decagrammus 233.3 303.8 32.6 105.7 91.4 0.0 93.0 6.5 (0.90) Ammodytes hexapterus 411.5 3.2 0.5 0.2 19.8 441.1 0.0 0.0 Total (dominant taxa) 1084.9 675.1 54.5 206.5 170.7 789.8 93.1 6.5 250 Fishery Bulletin 93(2), 1995 and Dunn, 1985). In this region, fish eggs in the neus- ton could be considered strays because their accu- mulation at the surface may be attributed to their positive buoyancy rather than to the deposition of eggs in this zone. A similar conclusion has been made regarding the occurrence of fish eggs in the neuston of shelf and oceanic waters off Washington, Oregon, and northern California (Doyle, 1992). In contrast, a unique group of larval fish appeared to be associated with the neuston in the western Gulf of Alaska, and most of the dominant taxa were scarce or absent in the subsurface zone. The dominance of hexagrammids, cottids, an osmerid, Arcop/opoma/ira- bria, bathymasterids, Cryptacanthodes aleutensis, and Ammodytes hexapterus in this group has also been documented for the larval fish component of the neuston in the California Current region along the U.S. west coast (Brodeur et al., 1987; Shenker, 1988; Doyle, 1992). The occurrence of T. chalcogramma larvae in high numbers in the neuston of the west- ern Gulf of Alaska, however, is unique to this region and reflects the overall dominance of this species in the plankton of the study area (Kendall and Dunn, 1985; Schumacher and Kendall, 1991; Rugen 3 ). Among the dominant taxa of fish larvae in the neuston, most were obligate tenants of the surface, despite the predominance of demersal spawning among these taxa. The most important taxa in this group included the hexagrammids, cottids, Anoplopoma fimbria, and Cryptacanthodes aleutensis, and, accord- ing to the general classification scheme for neustonic organisms (Zaitsev, 1970; Hempel and Weikert, 1972; Peres, 1982), they may be considered obligate mem- bers of the neuston. The same taxa of larvae have been identified as obligate neustonic organisms in the plankton off the U.S. west coast (Doyle, 1992). Because of their scarcity in bongonet samples, the dramatic daytime reduction in density of these lar- vae in the neuston samples may have been attrib- uted primarily to light-aided avoidance of the sam- pling gear. The generally large sizes documented (pre- dominantly > 10 mm SL) for these neustonic larvae also contributed to their ability to avoid the neuston net. Theragra chalcogramma, Ammodytes hexapterus, and Bathymaster spp. larvae were unusual among the dominant neustonic taxa in that they were ex- tremely abundant in bongo net samples also; there- fore, their association with the neuston was consid- ered facultative. Their nighttime presence in the neuston suggested a pattern of diel vertical migra- tion with movement upward at dusk and a return to deeper layers during the day. This pattern has been observed for many species of fish larvae and zoo- plankton in many different regions (Zaitsev, 1970; Hempel and Weikert, 1972; Neilson and Perry, 1990). Mallotus villosus, Myoxocephalus spp., and Zaprora silenus larvae, which were well represented in bongo net samples, but abundant in the neuston at night, may also exhibit this pattern of vertical migration. However, with the limited data presented here, it was difficult to verify this migration pattern. Day- time sampler avoidance, particularly by the larger larvae and early juveniles, is likely to have had a confounding influence on the observation of such a pattern. In addition, it is necessary to consider in more detail the diel variation in the vertical distri- bution pattern of the larvae over the entire range of the water column in which they occurred. Kendall et al. (1987, 1994) observed that within the upper 50 m of the water column, T. chalcogramma larvae (size range approximately 7-10 mm SL) un- dergo limited vertical migration on a diel cycle. These larvae were found to be deepest during the day, shal- lowest in the evening, sink slightly at night, and sink more in the morning. Under controlled laboratory conditions, Olla and Davis ( 1990) also observed simi- lar diel periodicity in vertical distribution of T. chal- cogramma larvae; larvae moved downward with day- time light intensity, upward during evening twilight conditions, remained close to the surface at night, and moved downward again in the morning. The T. chalcogramma larvae caught in the neuston, mainly at night, during the present study were predomi- nantly 5-14 mm SL unlike their counterparts in the bongo net samples that were mostly <6 mm SL. This diel pattern of neustonic occurrence for the larger- sized larvae was likely due to the pattern of diel ver- tical migration observed by the above authors. Observations on the vertical distribution of Ammo- dytes hexapterus larvae have also been made in the western Gulf of Alaska (Rogers et al., 1979; Brodeur and Rugen, 1994). Unlike T. chalcogramma larvae, A. hexapterus larvae were found to be deepest in the water column at night and shallowest at dawn and during the day. This apparent migration pattern of nocturnal descent has also been observed for A. personatus larvae off Japan and has been interpreted as advantageous in terms of diurnal feeding and predator avoidance (Yamashita et al., 1985). If this is the normal diel pattern of vertical migration for Ammodytes larvae, the occurrence of high densities of A. hexapterus larvae in the neuston at night, docu- mented during the present study, seems unusual. On examination of length-frequency distributions for these larvae, however, it appears that the pattern of nocturnal descent was prevalent among larvae <20 mm SL (Yamashita et al., 1985; Brodeur and Rugen, 1994), whereas the nocturnal concentration of lar- vae at the surface was restricted to larger larvae and early juveniles (Doyle, 1992; this study). Perhaps Doyle et al Neustonic ichthyoplankton in the western Gulf of Alaska 251 these larger specimens undertake a nocturnal mi- gration into the neuston as has been indicated by data collected off the U.S. west coast (Doyle, 1992). The length-frequency distributions documented for A. hexapterus larvae here, however, suggest that during spring in the western Gulf of Alaska, the well- developed larvae and early juveniles (>20 mm SL) almost exclusively occupied the neuston. Such speci- mens were rare in the bongo net samples where the predominant larval size range was 5-15 mm SL. The scarcity of the large A. hexapterus larvae in the day- time neuston samples in this instance could be at- tributed to light-enhanced sampler avoidance. Brodeur and Rugen (1994) also found that Bathymaster spp. larvae (4-7 mm SL) were deepest in the water column at night in the western Gulf of Alaska and suggest a diel migration pattern of noc- turnal descent similar to A. hexapterus. A similar pattern of downward migration at night has been observed for Bathymaster spp. larvae in the Bering Sea ( Walline 6 ). Their absence from daytime neuston samples during the present study seemed to contra- dict such a pattern of vertical migration. Whereas most of the young larvae may follow the above pat- tern, our data also suggest a facultative association with the neuston by some of these larvae and a night- time occupation of the neuston as a result of migra- tion upward to the surface. This seems feasible as it is apparent from observations by Kendall and Dunn (1985) and Rugen 3 in the Gulf of Alaska that Bathymaster spp. larvae become more neustonic with development. Most Bathymaster spp. larvae taken here, both in neuston net and bongo net samples, were <10 mm SL and would not be able to avoid the sampler as did the A. hexapterus larvae found in the neuston during the present study. The facultative nocturnal association with the neuston proposed here for Mallotus villosus larvae does not contradict what is already known concerning vertical distribution patterns for osmerids in the Gulf of Alaska. Haldorson et al. ( 1993) recorded that osmerid larvae in Auke Bay apparently spend most of their time in the mixed layer, rising to the surface at night and returning to relatively shallow depths during the day. Recent investigations on the interaction between the early life history stages of T. chaleogramma and the oceanographic environment in the western Gulf of Alaska indicate that prevailing southwesterly cur- rents transport larvae from the Shelikof Strait re- gion to nursery grounds along the Alaska Peninsula (Kendall et al., 1987; Kim and Kendall, 1989; Hinckley et al., 1991; Schumacher and Kendall, 1991). Although the southwesterly flowing Alaska Coastal Current bifurcates southwest of Kodiak Is- land, most of this water remains on the shelf, thus potentially retaining the majority of fish larvae in the coastal region. Physical features such as plumes and eddies also serve to retain larvae on the conti- nental shelf and transport them southwestward along the Alaska Peninsula (Vastano et al., 1992). Given these current patterns, the distribution pat- terns observed for most taxa of fish larvae in the neuston during this study suggest that springtime spawning and emergence of larvae into the plank- ton (and subsequently the neuston) took place mainly around Kodiak Island (except along the seaward side) and along the Alaska Peninsula to the southwest. A high concentration of larvae over the shelf from Kodiak Island to the Shumagin Islands was the pre- dominant pattern for most species. Despite their oc- currence in the neuston, these larvae were likely re- tained over the shelf and in the coastal zone by the prevailing currents. In contrast, the more offshore distribution patterns observed for A. fimbria, P. monopterygius, and H. hemilepidotus indicate that a significant proportion of these larvae may have been entrained in the Alaskan Stream over the slope and in deep water. Analysis of multispecies spatial patterns using recurrent group analysis and numerical classifica- tion did not reveal the existence of more than one neustonic assemblage offish larvae in the study area. A unique and comparable assemblage of neustonic fish larvae has also been identified off the U.S. west coast and its geographical distribution is essentially confined to shelf and slope waters off Washington, Oregon, and northern California (Doyle, 1992; Doyle 7 ). Apart from perhaps P. monopterygius lar- vae, which are known to occur throughout the Gulf of Alaska (Gorbunova, 1962), and to a lesser extent A. fimbria and H. hemilepidotus, members of the neustonic assemblage offish larvae in the western Gulf of Alaska are likely to be scarce in the oceanic zone. It has been postulated that the primary advantage of a neustonic existence as an early life history strat- egy for certain species of marine fish is the enhanced trophic conditions that prevail in this biotope ( Moser, 1981; Tully and O'Ceidigh, 1989; Doyle, 1992). The suitability of the neuston as a feeding ground for lar- vae is, however, dependent on the ability of larvae to 6 Walline, P. D. 1981. Hatching dates of walleye pollock I Theragra chaleogramma) and vertical distribution of ichthyoplankton from the eastern Bering Sea, June-July 1979. U.S. Dep. Commer., NOAA, Natl. Mar. Fish. Serv., Alaska Fish. Sci. Cent., 7600 Sand Point Way NE, Seattle, WA 98115. Proc. Rep. 81-05, 22 p. Doyle, M. J. 1992. Patterns in distribution and abundance of ichthyoplankton off Washington, Oregon, and northern Cali- fornia (1980 to 1987). U.S. Dep. Commer., NOAA, Natl. Mar. Fish. Serv., Alaska Fish. Sci. Cent., 7600 Sand Point Way NE, Seattle, WA, 98115. Proc. Rep. 92-14, 344 p. 252 Fishery Bulletin 93(2), 1995 seek and capture prey. Although surface aggregations of zooplankton are common at frontal and conver- gence zones, the neuston may in general have a re- duced biota, at least during the daytime. The rela- tively large size and well-developed form that char- acterizes most fish larvae occurring in the neuston of the western Gulf of Alaska and elsewhere is possi- bly an adaptive advantage in terms of finding and consuming suitable quantities of food. The data of Kendall and Dunn (1985) and Rugen 3 indicate that hexagrammid and cottid larvae (obligate members of the neuston) are abundant in the study area dur- ing all seasons. Given that peak production of cope- pod nauplii, a dominant larval fish food, occurs dur- ing summer in this region (Cooney, 1986), the above larvae are likely to encounter a diminished biota in the neuston during fall and winter months in par- ticular. Because of their relatively large size, how- ever, a wide diversity of prey organisms are likely to be available to them in the neustonic layer and this diversity may compensate for the lower prey densi- ties of copepod nauplii. Acknowledgments This study would not have been possible without the foresight and assistance of Art Kendall of the Alaska Fisheries Science Center. We appreciate the efforts of the crew and scientists aboard the various research vessels that collected the samples and the expert assistance of the staff of the Polish Plankton Sorting Center in sorting and initial identifications of the samples. Susan Picquelle and Rod Hobbs assisted with the data analysis. We thank Art Kendall, Jeff Napp, Morgan Busby, Brenda Norcross, Bruce Wing, and an anonymous reviewer for valuable comments on an earlier version of this manuscript. Literature cited Ahlstrom, E. H ., and E. Stevens. 1976. Report of neuston (surface) collections made on ex- tended CalCOFI cruises during May 1972. Calif. Coop. Oceanic Fish. Invest. Rep. 18:167-180. Brodeur, R. D. 1989. Neustonic feeding by juvenile salmonids in coastal wa- ters of the northeast Pacific. Can. J. Zool. 67:1995-2007. Brodeur, R. D., and W. C. Rugen. 1994. Diel vertical distribution of ichthyoplankton in the northern Gulf of Alaska. Fish. Bull. 92:223-235. Brodeur, R. D., W. G. Pearcy, B. C. Mundy, and R. W. Wisseman. 1987. The neustonic fauna in coastal waters of the north- east Pacific: abundance, distribution and utilization by juvenile salmonids. Oregon Sea Grant publ. ORESU-T- 87-001, 61 p. Clifford, H. T., and W. Stephenson. 1975. An introduction to numerical classification. Aca- demic Press, New York, 229 p. Cooney, R. T. 1986. Zooplankton. In D. W. Hood and S. T. Zimmerman (eds. ), The Gulf of Alaska: a physical environment and bio- logical resources, p. 285-303. Mineral Manage. Serv. publ. Outer continental shelf study, MMS 86-0095. U.S. Gov. Print. Off., Washington, D.C. Doyle, M. J. 1992. Neustonic ichthyoplankton in the northern region of the California Current ecosystem. Calif. Coop. Oceanic Fish. Invest. Rep. 33:141-161. Fager, E. W. 1957. Determination and analysis of recurrent groups. Ecology 38:586-595. Gorbunova, N. N. 1962. Spawning and development of greenlings (family Hexagrammidae). Akad. Nauk. SSSR, TV. Inst. Okeanol. 59: 118-182. [In Russian.] [Translated by Israel Program Sci. Transl., 1970. In T S. Rass (ed.), Greenlings: tax- onomy, biology, interoceanic transplantation, p. 121-185; avail. Natl. Tech. Inf. Serv., Springfield, VA.] Haldorson, L., M. Prichett, A. J. Paul, and D. Ziemann. 1993. Vertical distribution and migration offish larvae in a northeast Pacific bay. Mar. Ecol. Prog. Ser. 101:67-80. Hempel, G., and H. Weikert. 1972. The neuston of the subtropical and boreal northeast- ern Atlantic Ocean: a review. Mar. Biol. 76:70-88. Hinckley, S., K. M. Bailey, S. J. Picquelle, J. D. Schumacher, and P. J. Stabeno. 1991. Transport, distribution, and abundance of larval and juvenile walleye pollock {Theragra chalcogramma) in the western Gulf of Alaska in 1987. Can. J. Fish. Aquat. Sci. 48:91-98. Hobbs, R. C, and L. W. Botsford. 1992. Diel vertical migration and timing of metamorpho- sis of larvae of the Dungeness crab Cancer magister. Mar. Biol. 112:417-428. Kendall, A. W., Jr., and J. R. Dunn. 1985. Ichthyoplankton of the continental shelf near Kodiak Island, Alaska. U.S. Dep. Commer., NOAA Tech. Rep. NMFS 20, 89 p. Kendall, A. W., Jr., and A. C. Matarese. 1987. Biology of eggs, larvae and epipelagic juveniles of sablefish, Anoplopoma fimbria, in relation to their poten- tial use in management. Mar. Fish. Rev. 49(1): 1-13. Kendall, A. W., Jr., M. E. Clarke, M. M. Yoklavich, and G. W. Boehlert. 1987. Distribution, feeding and growth of larval walleye pollock, Theragra chalcogramma, from Shelikof Strait, Gulf of Alaska. Fish. Bull. 85:499-521. Kendall, A. W., Jr., L. S. Incze, P. B. Ortner, S. R. dimming*, and P. K. Brown. 1994. The vertical distribution of eggs and larvae of wall- eye pollock, Theragra chalcogramma , in Shelikof Strait, Gulf of Alaska. Fish. Bull. 92:540-554. Kim, S., and A. W. Kendall Jr. 1989. Distribution and transport of larval walleye pollock (Theragra chalcogramma) in Shelikof Strait, Gulf of Alaska, in relation to water movement. Rapp. P.-V. Reun. Cons. Int. Explor. Mer 191:127-136. Lance, G. N., and W. T. Williams. 1967. A general theory of classificatory sorting strategies. I: Hierarchical systems. Computer Journal 9:373-380. Doyle et al.: Neustonic ichthyoplankton in the western Gulf of Alaska 253 Matarese, A. C, A. W. Kendall Jr., D. M. Blood, and B. M. Vinter. 1989. Laboratory guide to early life history stages of north- east Pacific fishes. U.S. Dep. Commer., NOAATech. Rep. NMFS 80, 625 p. Moser, H. G. 1981. Morphological and functional aspects of marine fish larvae. In R. Lasker (ed), Marine fish larvae: morphol- ogy, ecology and relation to fisheries, p. 90-131. Univ. Washington Press, Seattle. Moser, H. G., P. E. Smith, and L. E. Eber. 1987. Larval fish assemblages in the California Current region, 1954-1960, a period of dynamic environmental change. Calif. Coop. Oceanic Fish. Invest. Rep. 28:97-127. Neilson, J. D., and R. I. Perry. 1990. Diel vertical migrations of marine fishes: an obligate of facultative process? Adv. Mar. Biol. 26: 115-126. Olla, B. L., and M. W. Davis. 1990. Effects of physical factors on the vertical distribution of larval walleye pollock Theragra chalcogramma under con- trolled laboratory conditions. Mar. Ecol. Prog. Ser. 63: 105-112. Peres, J. M. 1982. Specific pelagic assemblages: 1. Assemblages at the air-ocean interface. In O. Kinneled.), Marine ecology, vol. 5, p. 313-372. Reed, R. K., and J. D. Schumacher. 1986. Physical oceanography. In D. W. Hood and S. T. Zimmerman (eds), The Gulf of Alaska: physical environ- ment and biological resources, p. 57-75. Mineral Man- age. Serv. publ. Outer continental shelf study, MMS 86- 0095. U.S. Gov. Print. Off., Washington, D.C. 1989. Transport and physical properties in central Shelikof Strait, Alaska. Cont. Shelf Res. 9:261-268. Reed, R. K., J. D. Schumacher, and A. W. Kendall Jr. 1988. NOAA's Fishery Oceanography Coordinated Investi- gations in the Western Gulf of Alaska. EOS, Transactions of the American Geophysical Union. 69:890-894. Rogers, D. E., D. J. Rabin, B. J. Rogers, K. J. Garrison, and M. E. Wangerin. 1979. Seasonal composition and food web relationships of marine organisms in the nearshore zone of Kodiak Island- including ichthyoplankton, meroplankton (shellfish), zoo- plankton, and fish. Univ. Washington Rep. FRI-UW-7925, 291 p. Sameoto, D. D., and L. O. Jaroszynski. 1969. Otter surface trawl: anew neuston net. J. Fish. Res. Board Can. 26:2240-2244. Schumacher, J. D., and A. W. Kendall Jr. 1991. Some interactions between young walleye pollock and their environment in the western Gulf of Alaska. Calif. Coop. Oceanic Fish. Invest. Rep. 32:22-40. Shenker, J. M. 1988. Oceanographic associations of neustonic larval and juvenile fishes and Dungeness crab megalopae off Oregon. Fish. Bull. 86:299-317. Smith, P. E., and S. L. Richardson. 1977. Standard techniques for pelagic fish egg and larval surveys. FAO Fish. Tech. Paper No. 175, 100 p. Tully, O., and P. O'Ceidigh. 1989. The ichthyoneuston of Galway Bay (west of Ireland). II: Food of post-larval and juvenile neustonic and pseudoneustonic fish. Mar. Ecol. Prog. Ser. 51:301-310. Vastano, A. C, L. S. Incze, and J. D. Schumacher. 1992. Observation and analysis of fishery processes: larval pollock at Shelikof Strait, Alaska. Fish. Ocean 1:20-31. Yamashita, Y., D. Kitagawa, and T. Aoyama. 1985. Diel vertical migration and feeding rhythm of the larvae of the Japanese sand-eel Ammodytes person- atus. Bull. Jpn. Soc. Sci. Fish. 51:1-5. Zaitsev, Y. P. 1970. Marine neustonology. Naukova Dumka, Kiev. [Translated from Russian by Israel Program for Scientific Translations, Jerusalem, 207 p. J Abstract. — Aerial surveys for sea turtles conducted in Core Sound and Pamlico Sound, North Carolina, 1989-91, indicated a spring immigration by the turtles into these sounds and a summer- time dispersal followed by emigra- tion in the late fall and early win- ter. Estimates of density in Core Sound were greater than estimates for Pamlico Sound. Core Sound density estimates were comparable to those reported for the lower Chesapeake Bay and those re- ported from offshore pelagic sur- veys in the region. The data were analysed by strip- and line-transect methods, and the choice of analy- sis did not influence the overall conclusions. The abundance of sea turtles in the inshore waters of the Atlantic Coast at densities at least as great as in the ocean indicates the importance of these estuarine habitats for the foraging and devel- opment of immature turtles. Aerial surveys for sea turtles in North Carolina inshore waters Sheryan R Epperly Joanne Braun Alexander J. Chester Beaufort Laboratory, Southeast Fisheries Science Center National Marine Fisheries Service. NOAA Beaufort. NC 285 1 6 Manuscript accepted 25 September 1994. Fishery Bulletin 93:254-261 (1995). Recent studies have demonstrated the importance of inshore waters as developmental and foraging habi- tats for threatened and endangered sea turtles along the Atlantic Coast of the United States (e.g. Medonca and Ehrhart, 1982; Ehrhart, 1983; Lutcavage and Musick, 1985; Kein- ath et al., 1987; Burke et al., 1992, 1993). A study of sea turtles in North Carolina waters used sight- ings reported by the public and documented the importance of Pamlico and Core Sounds for imma- ture loggerhead, Caretta caretta; green, Chelonia mydas; and Kemp's ridley, Lepidochelys kempii, sea turtles (Epperly et al., in press, a). As part of the same study, aerial surveys were employed over a 3-yr period to provide independent quan- titative verification of the impor- tance of Pamlico and Core Sounds as sea turtle habitats. We report the results of the aerial survey work in Pamlico and Core Sounds, part of the largest estua- rine system in the southeast United States. Once aerial survey method- ology was validated in inshore wa- ters, our goals were 1) to obtain in- dependent evidence for the season- ality and distribution patterns of turtles obtained from other sources, 2) to quantify the abundance of sea turtles in the sounds and compare those densities with other areas, and 3) to evaluate the consequences of the application of line vs. strip survey methodology to the data. Materials and methods Aerial surveys of Core and Pamlico Sounds Pamlico and Core Sounds were di- vided into three areas (Fig. 1): Core Sound (34°41'N to 35°00'N), south- ern Pamlico Sound (35°00'N to 35°20'N), and northern Pamlico Sound (35°20'N to 35°48'N). Areas of each were 248 km 2 , 2,501 km 2 , and 1,951 km 2 , respectively. The divisions were, in part, based on geography and on facilitating access to restricted airspace. In Core Sound, each flight surveyed ap- proximately 26% of the total surface area of the sound (32, rarely 33 transects); for both southern and northern Pamlico Sound, approxi- mately 6% of the total area was sur- veyed (8 transects in southern Pamlico Sound and 11 transects in northern Pamlico Sound). Surveys were taken from a Cessna 172 (from a side-viewing platform) at 128 km/ h and at an altitude of 152 m. This altitude was chosen as a compro- mise between areal coverage and the ability to sight smaller turtles on the surface of inshore waters. Surveys were scheduled so that lo- cal apparent noon occurred approxi- mately half-way through the survey. Surveys were undertaken only if winds were less than 28 km/h and seas were less than 0.6 m with no or few whitecaps (e.g. Beaufort Sea State <2). We attempted to perform 254 Epperly et al.: Aerial surveys for sea turtles 255 Cape Hatieras ATLANTIC OCEAN Cape Lookout Figure 1 Core Sound and subareas of Pamlico Sound flown in aerial surveys for sea turtles in North Carolina inshore waters, 1989-91. the surveys monthly beginning in spring 1989 and bimonthly May-November 1990 and 1991. Because it was difficult to obtain military airspace clearance over Pamlico Sound and because the results of the 1989-90 surveys indicated that our effort was best expended in Core Sound (greater sighting rates), the only area surveyed in 1991 was Core Sound. We employed a systematic sampling design. The underlying assumption was that the systematic sample could be treated as a random sample. There was no reason to assume that the number of turtles sighted per transect would be autocorrelated (i.e. we assumed no areal trend in density or correlations between neighboring transect values). As recom- mended by Cochran (1977) and Eberhardt et al. (1979) in order to avoid potential selection biases of systematic sampling, the starting transect for each survey was chosen at random from all possible transects in the survey. Transect lines ran east-west and were spaced equi-distant from the starting transect. On the basis of the maximum known swim- ming speed of a loggerhead turtle (6 km/h, Keinath, 1993), transects were spaced far enough apart so that a turtle could not be sighted twice during any one survey. LORAN was used to maintain position on the prescribed transects. Beginning and ending longitu- dinal coordinates and time were recorded for each transect flown. Two observers on opposite sides of the plane scanned the waters, recording the time (with synchronized watches) and perpendicular angle to each turtle sighted (with handheld clinometers). On the assumption that groundspeed within a transect was constant, turtle positions were calcu- lated by interpolating time and longitudinal coordi- nates and by converting sighting angle and survey altitude to perpendicular distance from the transect. We used both strip- and line-transect theory to analyze the data. First, a histogram of all perpen- dicular sighting distances was constructed, one for Core Sound and one for Pamlico Sound (Fig. 2). From these histograms we empirically determined the strip width over which the probability of sighting a turtle was not reduced by nearness to the plane ( acute view- ing angle; turtles diving to avoid the plane) or by distance from the plane (reduced detection) to be 0.15-0.30 km from the flight line. Observations 35 - 30 Core Sound 25 - 20 || 15 - 10 - tj 5 J B o> - O) a> B "5 1 35 E 3 if Hi.. 0.1 0.2 0.3 0.4 0.5 0.6 0.7 z 30 - 25 - Pamlico Sound 20 - 15 - 10 ■III.. . 0.7 0.1 0.2 0.3 0.4 0.5 0.6 Distance from transect (km) Figure 2 Histograms of distances at which turtles were sighted from the line of flight in Core and Pamlico Sound aerial sur- veys, 1989-91. 256 Fishery Bulletin 93(2), 1995 within this strip were then used to calculate ratio- to-size estimates of density ( D R ) for each survey by using a single-stage, sampling approach in which sampled transects were treated as clusters of unequal sizes (i.e. transect lengths varied; Cochran, 1977; Gates, 1979; Jolly and Watson, 1979): D - Y « ""M- the density of turtles on the surface of the sound; and r* = 5>i. i=l the total number of turtles sighted during a survey, where y t = the number of turtles in the i th transect; and n M R = 2_. m i> total area surveyed (km 2 ), 1=1 where m t - the area surveyed in the i th transect (km 2 ); and inverse of one-half the effective strip width (Burnham et al., 1980), mathematically equivalent to the value of the pdf exactly on the flight line (perpendicular distance=0). On the basis of the histograms of sight- ing distances, data were censored such that the prob- ability of sighting a turtle was not reduced by prox- imity to the airplane. Distance data were rescaled such that x=0 at the point data were censored (0.15 km from flight line). Simple, generalized, and non- parametric models were examined with the program TRANSECT (Laake et al., 1979) to derive density estimators from the sighting distance data. Because only small numbers of turtles were seen during most sampling occasions, we could not conduct individual analyses for each survey. Instead, sighting informa- tion was combined for all Core Sound surveys and for all Pamlico Sound surveys, and an overall flO)^ was specified for each of the two water bodies (s). Density for each survey ( D R ) then was estimated as D, fM s Y R 2L R where /10) is the overall /CO) for the water body, and is obtained from the TRANSECT program, and L R (km) is the total length of all transects (/.): n = the number of strip transects sampled. Variances of the density estimates, V( D R ), were calculated as follows: it i_A 5>?(A-A?) 2 V(D S ) = —Jt . i=l nM 2 n-1 where N = the total number of strip transects pos- sible; and y D ( = — - , the density of turtles in z'th transect; m i and M M — , the average area of a single transect " (km 2 ). For line-transect analyses we used methods de- scribed by Burnham et al. ( 1980). The essential prob- lem in line-transect analysis is to construct a prob- ability density function (pdf) from the set of perpen- dicular distance observations of sighted organisms to estimate fXO). The value of /10) is defined as the H ■'R ~ ^t The estimated variance of the density estimate for each survey was computed as V(D R ) = D R ( V(Y R ) | V(f(0) s ) ) Yr f(0f s The variance of the number of turtles sighted dur- ing a survey V(Y R ) is V(Y R ) = fci- **1Mt-$ n-l and the variance of/l0) s is obtained from the pdf so- lution (Burnham et al., 1980). Experiment to evaluate observer bias Four observers participated in the study. An experi- ment was conducted on 29 August 1991 to evaluate the accuracy and comparability of observer sightings Epperly et al.: Aerial surveys for sea turtles 257 and to validate methodology. Two planes, each car- rying two observers positioned on the same side, con- ducted 12 flights over an area where painted ply- wood "turtles" were deployed. Turtle models repre- senting loggerhead turtles of 30, 60, and 90 cm length, were attached to three anchored ground lines. Within an overflight pass, turtles of one size were grouped on a single line. All three lines could con- tain turtle models during any one pass. The number of turtle models of one size and the line on which they were placed during a single pass were chosen at random, but the experiment was constrained such that a total of six turtle models of each size were displayed within every three passes; the actual num- ber of a given size displayed during a pass ranged from to 4. The number, location, and size of the turtle models were unknown to the observers. Alti- tude and speed were identical to that used in the general survey ( 152 m and 128 km/h). The airplane flew on a line 0.10-0.30 km from the models. Analy- sis of variance techniques were used to examine the contribution of observers, turtle model size, and the interaction of observer and model size to the error in the counts. Results and discussion Under the ideal conditions under which the aerial survey experiment was performed, no significant dif- ferences were detected among observers (AN OVA, df=3, P=0.89). Within the range of sizes tested, turtle size was not a significant factor in the observers' ability to sight turtles ( ANOVA, df=2, P=0.24). On average, 97.2% of the actual number of "turtles" were sighted during a pass (range 50-100%). We concluded that interobserver variability was not a major factor and that turtles could be sighted accurately in relatively turbid waters. The experiment did not test for the effect of fatigue on an observer's ability to sight turtles. The inshore waters of temperate latitudes are sea- sonally repopulated with sea turtles. Nearly all sea turtles in Pamlico and Core Sounds, North Carolina, are immature individuals (Epperly et al., in press, a). Based on public reports, there is evidence that turtles immigrate into Core and Pamlico Sounds in the spring, disperse throughout the sounds in the summer, and emigrate from the sounds in the late fall and early winter (Epperly et al., in press, a). Results of the aerial surveys confirm this general Figure 3 Seasonal sea turtle sightings in aerial surveys of Core and Pamlico Sounds, 1989-91. There were no fall surveys of southern Pamlico Sound, and Core Sound was the only area flown during the winter. The Core Sound area is enlarged to the right of each figure. (A) March- May; (B) June-August; (C) September-November; (D) December-February. 258 Fishery Bulletin 93(2), 1995 Table 1 Strip- and line-transect estimates of density for sea turtles excluding leatherbacks, Dermochelys coriacea, on the surface of Core and Pamlico Sounds North Carolina, 1989-91. Strip-transect Line-transect estimates of density estimates of density Total Number of distance Turtles Turtles turtles sighted surveyed per SE per SE Survey within sound' (km) 100 km 2 of mean 100 km 2 of mean Core Sound 1989 22 May 30 197 30.48 7.62 37.19 11.63 12 Jul 22 203 22.95 5.75 36.00 9.67 16 Aug 10 227 7.35 2.96 12.55 4.85 12 Sep 15 224 19.34 3.69 25.41 7.09 13 Oct 6 217 1.54 1.20 3.75 2.41 6 Nov 5 231 5.78 2.07 7.05 2.91 14 Dec 5 219 6.08 2.85 9.28 4.49 1990 4 Jan 216 — — 15 Mar 219 — — 24 Apr 3 212 3.15 1.69 5.76 3.16 3 May 2 204 3.27 1.81 3.99 2.70 6 Jun 2 228 2.93 1.64 3.57 2.73 7 Jul 219 — — 2 Sep 234 — — 4 Nov 228 — — 1991 25 May 2 222 1.50 1.19 1.83 1.59 7 Jul 1 228 1.46 1.17 1.78 1.75 31 Aug 16 212 17.30 5.48 21.11 9.28 3 Nov 6 217 6.15 2.32 11.26 4.97 Northern Pamlico Sound 1989 30 May 1 387 0.86 0.81 0.77 0.67 24 Jul 4 399 3.35 1.73 3.00 1.53 1 Sep 6 393 3.39 2.10 3.04 2.43 29 Sep 14 383 1.74 1.09 2.34 1.25 14 Oct 8 369 4.52 2.39 5.69 2.46 13 Nov 4 367 0.91 0.89 0.81 0.87 1990 24 May 392 — — 3 Jul 392 — — 13 Sep 259 — — 15 Nov 368 — — Southern Pamlico Sound 1989 29 May 14 523 4.46 1.33 6.30 1.39 15 Jul 14 510 6.53 2.15 7.63 2.59 1990 19 May 1 504 0.66 0.62 0.59 0.54 4 Aug 2 534 0.62 0.58 0.56 0.49 3 Sep 512 — — 1 All turtles sighted, including those censored in calculations of density. Epperly et al.: Aerial surveys for sea turtles 259 pattern (Table 1; Fig. 3). Volunteer commercial fish- ermen and the general public reported turtles in in- shore waters April-December. Turtles were also sighted in the sounds during April-December aerial surveys. Spring aerial surveys (March-May) indi- cated that turtles were distributed mainly in Core Sound and along the eastern edge of southern Pamlico Sound. Summer (June-August) and fall (September-November) aerial surveys demonstrated that turtles were distributed throughout the sounds. No sea turtles were sighted during fall 1990 aerial surveys, but turtles were reported in the area by the public and by commercial fishermen (Epperly et al., in press, a). Turtles were still present in Core Sound in December 1989, but none was sighted during Janu- ary or March 1990 aerial surveys. Species were generally indistinguishable from the air because of their small size, except for leather- back sea turtles, Dermochelys coriacea, which were sighted only during the December 1989 survey (three individuals). The loggerhead turtle, with a reddish- brown carapace, was the species most often identi- fied. Data from commercial fishermen indicated that the species composition in Pamlico and Core Sounds was 80% loggerhead, 159?- green, and 5% Kemp's rid- ley sea turtles; leatherback turtles infrequently en- ter inshore waters, and hawksbills, Eretmochelys imbricata, are very rare (Epperly et al., in press, a). Nearly all of the turtles measured by fishermen were greater than 30 cm carapace length (measured over the curve) — the smallest model tested and successfully detected in the aerial survey experiment. Density estimates from line- and strip-transect analysis are given in Table 1. The Fourier series es- timator fit the sighting distance data from both sounds well 0.05). Values of/10) differed substantially between the two sounds: /tO) Con? =8.13 (SE=0.75) and/lO) Pam/;co =5.99 (SE=0.52). Confidence intervals for the estimates of /10) s over- lapped at the 95% confidence level but not at the 90% confidence level. The cause of the difference in our ability to sight turtles between the two sounds was not obvious. Observer fatigue could have been a fac- tor. Transects in Core Sound were short (2.7-14.9 km) and observers were able to take frequent breaks between them. Pamlico Sound transects were long ( 13.9-57.1 km in northern Pamlico Sound; 37.5-94.1 km in southern Pamlico Sound), and breaks occurred infrequently. Homogeneity of background could have been another factor. Core Sound waters were rela- tively clear, and bottom structures (channels, seagrass beds, etc.) were usually visible. This het- erogeneous background served to attract observers and to intensify the observers' searches in order to detect turtles. Consequently, the visual sweep of the observers was confined to an area near the flight path. Conversely, the majority of Pamlico Sound waters usually were turbid and presented a homo- geneous background, except for the easternmost por- tion of the sound which was very similar to Core Sound. Line-transect estimates of density in Core Sound averaged 40% greater than estimates derived from strip-transect theory (Table 1). Line-transect esti- mates of density in Pamlico Sound were, on average, 14% greater than strip-transect estimates. Coefficients of variation of strip- and line-transect estimates of den- sity were nearly identical within each sound (67% for strip- and 66% for line-transect estimates for Pamlico Sound; 47% and 54% for strip- and line-transect esti- mates, respectively, for Core Sound) (Table 1). Application of line-transect and strip-transect analyses to the North Carolina aerial survey data requires several assumptions. Strip-transect analy- sis assumes that 1) transect lines are randomly lo- cated, 2) the strip over which all turtles are assumed to be seen and counted, 0.15-0.30 km, remains con- stant during a single survey and from survey to sur- vey, i.e. sighting conditions (distance from plane, size of turtles, sun position and glare, sea state, weather, etc.) do not affect the ability to sight turtles, 3) no turtle is counted more than once in a given survey, and 4) sightings are independent events. In addition to the first, third, and fourth assumptions above, line- transect analysis requires that 1) all turtles on the line (defined as 0.15 km from the flight line) are seen with certainty, 2 ) turtles do not move prior to sight- ing or before distance measurements are made, 3) measurements are taken without error, and 4) the probability density function remains constant dur- ing a single survey and from survey to survey (i.e. the ability to sight turtles does not change). The underlying assumptions of both methodologies are violated in important ways, primarily with re- spect to the ability to sight turtles. For strip-transect analysis, conditions are such that probabilities of sighting individual turtles within the strip are less than one. In addition, these probabilities vary within and among surveys. For line-transect theory, we do not know that all turtles on the line (x=0) are seen. The histogram of sighting distances (Fig. 2) indicates avoidance behavior in response to the aircraft in com- bination with poor downward visibility near the air- plane, but we cannot be sure that locating the line Cr=0) at 0.15 km from the flight line eliminated this effect entirely. In addition, the use of a pooled pdf may not be completely valid, because factors affecting the ability to sight turtles varied over the course of the study. As applied, strip-transect methods assuredly underestimate the density of turtles on the surface of the water. Line-transect methods, however, may over- 260 Fishery Bulletin 93(2), 1995 estimate or underestimate densities depending on the universality of the pdf. A criticism of strip-transect methods is that observations outside the strip are not included in the analysis and, in the study of rare ani- mals, every observation is important (Eberhardt et al., 1979). In this study, however, only 22 of 171 turtles ( 13%) were sighted at distances greater than 0.30 km from the flight line. In the following comparative dis- cussion, the results of strip-transect analysis are cited, but their use does not affect the overall conclusions. Estimated densities of sea turtles on the surface of Core Sound were consistently higher than surface densities for Pamlico Sound (Table 1). Where compara- tive data exist, densities in southern Pamlico Sound were greater than in northern Pamlico Sound. Densi- ties ranged from 0-30.5 turtles/100 km 2 in Core Sound to 0-4.5/100 km 2 in northern Pamlico Sound and to 0— 6.5/100 km 2 in southern Pamlico Sound. Densities gen- erally were highest during late spring through sum- mer. Densities in northern Pamlico Sound tended to peak at least one month later than in southern Pamlico and Core Sounds. The estimated density of sea turtles on the surface of the sounds was quite different among the study years; turtles were more abundant in 1989. The densities reported in this study are surface densities. Sea turtles are estimated to spend 3.8^11% of their time on the surface (Kemmerer et al., 1983; Keinath et al., 1987; Byles, 1989; Byles and Dodd, 1989; Musick et al. * ). Thus, the estimated number of sea turtles on the surface represents a small frac- tion of those actually in the sounds. Because of the large range in proportion of time that monitored- turtles spend on the surface, we did not try to ex- trapolate surface estimates to an estimate of the sub- merged population in the sounds. For comparison purposes, density estimates from studies that made the extrapolation were converted to surface densities. Comparison of density estimates among aerial survey studies is confounded by differences in plat- forms and altitudes. Aerial surveys utilizing aircraft equipped with bubble observation windows (Fritts et al., 1983; Thompson et al., 1991; Shoop and Kenney, 1992; Thompson 2 ; Lohoefener et al. 3 ) af- 1 Musick, J. A., R. Byles, and S. Bellmund. 1983. Mortality and behavior of sea turtles in the Chesapeake Bay. Annual report for the year 1982, NEFC/NMFS Contract NA80-FAC-99994, Virginia Institute of Marine Science, Gloucester Point, VA, 41 p. 2 Thompson, N. B. 1984. Progress report on estimating density and abundance of marine turtles: results of first year pelagic surveys in the southeast U.S. U.S. Natl. Mar. Fish. Serv, Miami, FL, 59 p. 3 Lohoefener, R., W. Hoggard, K. Mullin, C. Roden, and C. Rogers. 1990. Association of sea turtles with petroleum platforms in the North-Central Gulf of Mexico. Report to the U.S. Dep. Inte- rior, Minerals Manage. Serv., Gulf of Mexico Outer Continental Shelf Regional Off., New Orleans, MMS contract 14-12-0001- 30398, OCS study MMS 90-0025, Natl. Mar. Fish. Serv., Pascagoula, MS, 90 p. forded observers a direct and unobstructed view of the flight line, thus maximizing the area sampled and the number of sea turtles observed per transect. Conversely, our study and other studies utilizing side- viewing aircraft (Keinath et al., 1987; Lohoefener et al., 1988; Keinath, 1993; Epperly et al., in press, b) did not have downward visibility directly beneath the plane, thereby minimizing the area sampled and the number of sea turtles observed per transect. Like- wise, differences in altitude could affect the number of sea turtles sighted. Smaller turtles have a de- creased chance of being sighted at higher altitudes. The altitude used in this study, 152 m, is consistent with that of the 1982-84 study of the offshore wa- ters between Cape Hatteras and Key West, Florida (Schroeder and Thompson, 1987; Thompson 2 ), sur- veys of the Chesapeake Bay and adjacent waters (Keinath et al., 1987; Keinath, 1993) and surveys off the northern North Carolina coast (Epperly et al., in press, b). It differs from the 229 m altitude used in the 1983-86 and the 1988-89 surveys of offshore waters of the Gulf of Mexico (Thompson et al., 1991; Lohoefener et al., 1990) and the 1979-81 surveys of the offshore waters between Nova Scotia and Cape Hatteras (Shoop and Kenney, 1992). Lohoefener et al. (1988), collected turtle data during their 1987 red drum surveys of the Gulf of Mexico using altitudes of 305-457 m. Fritts et al. ( 1983) collected turtle data during marine mammal, bird, and turtle surveys of the Gulf of Mexico and eastern Florida using alti- tudes of 91 m and 228 m. Another factor affecting comparability of density estimates is the proportion of suitable habitat sur- veyed in each study. Comparisons of density esti- mates can be made only for surveys with comparable ratios of suitable to unsuitable habitats surveyed. Suitable habitat presumably accounts for all the area surveyed in inshore studies. Offshore studies gener- ally extended well seaward of suitable habitat and in winter included habitat rendered unsuitable by low temperatures nearshore. Because of methodological differences in aerial survey studies, the application of strip- versus line-transect theory, and our inability to reliably correct surface densities for the proportion of the population that was submerged, comparisons of density estimates among studies are nearly impossible. We compare the results of this study only with other studies with comparable methodologies. Our density estimates for Pamlico and Core Sounds, respectively, were comparable to those for the mid- (0-8.5 turtles/100 km 2 ) and lower (0-57.4 turtles/100 km 2 ) Chesapeake Bay, Virginia (Keinath et al., 1987). Densities in Core Sound and the lower Chesapeake Bay were particularly high, comparable to density estimates of sea turtles in offshore waters Epperly et al.: Aerial surveys for sea turtles 261 (0-126.1, Keinath, 1993; 0-12.3 turtles/100 km 2 , Epperly et al., in press, b). The abundance of sea turtles in the inshore waters of the Atlantic Coast (North Carolina and Virginia), at densities at least as great as in the ocean, indicates the importance of these estuarine habitats for the foraging and devel- opment of immature turtles. Acknowledgments We thank Joseph Smith and Neil McNeill for their dedication as observers during many aerial surveys that were eye-straining and occasionally hazardous, and John Betts, Bob Burrows, Pim Lauret, Karl Marks, Anthony Marsh, Pat Smith, Ron Snoeij, and Fred Swain for their excellent piloting and naviga- tion skills. We appreciate the efforts of personnel at the Marine Corps Air Station Cherry Point, the U.S. Navy VACAPES, and the U.S. Air Force Seymour Johnson Base in providing airspace clearance. We thank the staff of the Virginia Institute of Marine Science sea turtle project for initial observer train- ing. This manuscript benefitted from reviews by David Colby, Nancy Thompson, Lawrence Settle, and anonymous individuals. This research was funded by the U.S. Fish and Wildlife Service and the Na- tional Marine Fisheries Service. Literature cited Burke, V. J., S. J. Morreale, P. Logan, and E. A. Standora. 1992. Diet of green turtles (Chelonia mydas) in the waters of Long Island, N.Y. U.S. Dep. Commer., NOAA Tech. Memo. NMFS-SEFSC-302:140-142. Burke, V. J., E. A. Standora, and S. J. Morreale. 1993. Diet of juvenile Kemp's ridley and loggerhead sea turtles from Long Island, New York. Copeia 1993: 1176-1180. U u rnha in. K. P., D. R. Anderson, and J. L. Laake. 1980. Estimation of density from line transect sampling of biological populations. Wildl. Monogr. 72:1-202. Byles, R. A. 1989. Satellite telemetry of Kemp's ridley sea turtle, Lepidochelys kempi, in the Gulf of Mexico. U.S. Dep. Commer., NOAA Tech. Memo. NMFS-SEFC-232:25-26. Byles, R. A., and C. K. Dodd. 1989. Satellite biotelemetry of a loggerhead sea turtle {Caretta caretta) from the east coast of Florida. Dep. Commer., NOAA Tech. Memo. NMFS-SEFC-232:215-217. Cochran, W. G. 1977. Sampling Techniques, 3rd ed. Wiley, New York, 428 p. Eberhardt, L. L., D. G. Chapman, and J. R. Gilbert. 1979. A review of marine mammal census methods. Wildl. Monogr. 63:1-46. Ehrhart, L. M. 1983. Marine turtles of the Indian River Lagoon system. Fla. Sci. 46:337-346. Epperly, S. P., J. Braun, and A. Veishlow. In press, a. Sea turtles in North Carolina waters. Conserv. Biol. Epperly, S. P., J. Braun, A. J. Chester, F. A. Cross, J. V. Merriner, and P. A. Tester. In press, b. The winter distribution of sea turtles in the vicinity of Cape Hatteras and their interactions with the summer flounder trawl fishery. Bull. Mar. Sci. 56(2). Fritts, T. H., W. Hoffman, and M. A. McGehee. 1983. The distribution and abundance of marine turtles in Gulf of Mexico and nearby Atlantic waters. J. Herpetol. 17:327-344. Gates, C. E. 1979. Line transect and related issues. In R. M. Cormack, G. P. Patil, and D. S. Robson (eds.), Sampling biological populations, p. 71-154. Int. Co-operative Publ. House, Farland, MD. Jolly, G. M., and R. M. Watson. 1979. Aerial sample survey methods in the quantitative assessment of ecological resources. In R. M. Cormack, G. P. Patil, and D. S. Robson ( eds. ), Sampling biological popu- lations, p. 203-216. Int. Co-operative Publ. House, Farland, MD. Keinath, J. A. 1993. Movements and behavior of wild and head-started sea turtles. Ph.D. diss.. College of William and Mary, Gloucester Point, VA, 206 p. Keinath, J. A., J. A. Musick, and R. A. Byles. 1987. Aspects of the biology of Virginia's sea turtles: 1979- 1986. Va. J. Sci. 38:329-336. Kemmerer, A. J., R. E. Timko, and S. Burkett. 1983. Movement and surfacing behavior patterns of logger- head sea turtles in and near Canaveral Channel, Florida (September and October 1981). U.S. Dep. Commer., NOAA Tech. Memo. NMFS-SEFC-112, 43 p. Laake, J. L., K. P. Burnham, and D. R. Anderson. 1979. User's manual for program TRANSECT. Utah State Univ. Press, Logan, 26 p. Lohoefener, R. R., W. Hoggard, C. L. Roden, K. D. Mullin, and C. M. Rogers. 1988. Distribution and relative abundance of surfaced sea turtles in the north-central Gulf of Mexico: spring and fall 1987. U.S. Dep. Commer., NOAA Tech. Memo. NMFS- SEFC-214:47-50. Lutcavage, M., and J. A. Musick. 1985. Aspects of the biology of sea turtles in Virginia. Copeia 1985:449-456. Medonca, M. T., and L. M. Ehrhart. 1982. Activity, population size and structure of immature Chelonia mydas and Caretta caretta in Mosquito Lagoon, Florida. Copeia 1982:161-167. Schroeder, B. A., and N. B. Thompson. 1987. Distribution of the loggerhead turtle, Caretta caretta, and the leatherback turtle, Dermochelys coriacea, in the Cape Canaveral, Florida area: results of aerial surveys. In W. N. Witzell (ed.). Ecology of east Florida sea turtles, p. 45-53. U.S. Dep. Commer., NOAA Tech. Rep. NMFS 53. Shoop, C. R., and R. D. Kenney. 1992. Seasonal distributions and abundances of loggerhead and leatherback sea turtles in waters of the northeastern United States. Herpetol. Monogr. 6:43-67. Thompson, N. B., E. S. Denton, D. B. Koi, A. Martinez, and K. Mullin. 1991. Turtles in the Gulf of Mexico: pelagic distributions and commercial shrimp trawling. U.S. Dep. Commer., NOAA Tech. Memo. NMFS-SEFSC-286, 24 p. Abstract. — Videotapes of the sea floor were taken from a sub- mersible during dives at two areas on the continental slope off Cape Hatteras and Cape Lookout, North Carolina, in September 1989. We counted demersal nekton, epi- fauna, and environmental features for 1-minute intervals from video transects. Common morphospecies of demersal nekton were identified, and multivariate analyses were performed to find environmental features that related to habitat use by these forms. In both areas, the ocean floor was extensively sculp- tured with holes and mounds, and both small and large sea anemones were commonly observed. Crinoids were seen in Cape Hatteras dives. Small sea anemones were much more abundant off Cape Hatteras, whereas holes and mounds were more densely distributed off Cape Lookout. Rattails, hake, and serge- stid shrimp were common at both locations. Eels were extremely abundant at the Cape Lookout site, whereas eelpouts, flounder, and lizardfish were found only at the Cape Hatteras location. At both lo- cations, analyses of nekton habitat choices showed that habitat selec- tion was related to density of the holes and mounds made by infauna and to density of the epifauna, such as crinoids and the different types of anemones. Hake, squid, serge- stid shrimp, and lizardfish showed the strongest evidence of habitat selection. Analysis of videotapes, originally recorded for other pur- poses, is a cost-effective means for preliminary examination of the problems that may only be ad- dressed by in situ observations. Assessing habitat use by nekton on the continental slope using archived videotapes from submersibles James D. Felley Office of Information Resource Management, Room 23 1 A&l Building, Smithsonian Institution, Washington, DC. 20560 Michael Vecchione National Marine Fisheries Service Systematics Laboratory National Museum of Natural History, Washington, DC 20560 Manuscript accepted 29 August 1994. Fishery Bulletin 93:262-273 (1995). Understanding of the ecology of the deep ocean floor has improved sub- stantially since underwater cam- eras have begun recording life at depths beyond which divers may penetrate. Recently, nekton commu- nities on the shelf and slope have been studied by means of underwa- ter cameras carried by remotely operated vehicles (ROVs) and occu- pied submersibles. Such studies have included analyses of environ- mental features (Hecker, 1990b; Levin et al., 1991), spatial distribu- tion of individual species (Vecchione and Gaston, 1986; Wenner and Barans, 1990; Schneider and Haed- rich, 1991), and patterns of habitat use by species assemblages (Rich- ards, 1986; Felley et al., 1989; Auster et al., 1991; Carey et al., 1990). Underwater cameras have allowed questions to be addressed that are intractable to conventional sampling methods (Haedrich and Gagnon, 1991). Though problems with accurate identification of spe- cies and habitat variables are inher- ent to these studies, such studies open an important window to poorly known ecosystems. We used archived videotapes re- corded by the submersible Johnson Sea-Link to investigate patterns of habitat use by demersal and bentho- pelagic nekton on the continental slope off Cape Hatteras and Cape Lookout, North Carolina. From the videotapes, we identified and counted nekton species, and quantified se- lected environmental variables dis- cernible from video images. Using these environmental variables, we identified the habitat where each species was most likely to be found. We used factor analysis to identify patterns of habitat use among the species (Felley and Felley, 1987; Felley et al., 1989) and to determine which environmental variables seemed most important in structur- ing the nekton assemblage of the continental slope off North Caro- lina. We then compared distribu- tional variances of environment and species occurrence to identify those species selecting subsets of avail- able habitats. Materials and methods Video recording Video transects were recorded dur- ing dives by the Johnson Sea-Link II submersible from the RV Edwin Link. Table 1 summarizes latitudes and longitudes, dates, and dive times. These data and videotapes are from NOAA's National Under- sea Research Center at the Univer- sity of North Carolina at Wilming- ton. Time starting and time ending are the beginning and ending points of the videotape section that we 262 Felley and Vecchione: Nekton habitat on the continental slope of North Carolina 263 Table 1 Information on dives at Cape Hatteras and Cape Lookout, North Carolina, from which videotapes were used for analysis of demersal nekton habitat use. "Dive no." is the dentification number we used to request the tapes. "Start time" and "End time" are the beginning and ending points on the vi deotape section used in the analyses (not the launch and recovery times of the dives I. Depths are in m. Start End Date Latitude Longitude time time Start End Dive no. 1989 °N °W (HH:MM) (HH:MM) depth depth Cape Hatteras 2623 14 Oct 35°23' 74°50 - 15:37 18:11 853 853 2627 16 Oct 35°38' 74°48' 8:52 10:01 782 573 2629 17 Oct 35°23' 74°51' 7:29 8:24 610 549 2630 17 Oct 35°29' 74°48' 13:16 13:43 511 420 Cape Lookout 2619 12 Oct 34°15' 75°45' 13:40 14:47 903 853 2620 13 Oct 34°14' 75°45' 9:00 9:07 945 843 2621 13 Oct 34°14' 75°46' 16:31 18:28 793 843 used in the analyses (not the launch and recovery times of the dives). The videotapes were recorded as the submersible cruised along the bottom, generally at a speed of 0.5-1 knot (ca. 25-50 cm/sec). The cam- era faced forward and down and was not panned or moved during the recording of videotape sections used for analysis. At times the submersible stopped to deploy experiments or pick up samples and at other times moved away from the bottom. We recorded data from video images only during periods when the sub- mersible was moving and the bottom was clearly vis- ible. During these periods, we quantified environ- mental variables and counted individuals of nekton species during 1-minute intervals. If the submers- ible stopped or moved away from the bottom during an interval, that interval was discarded. We did not start measuring again until the submersible began moving steadily and the bottom was clearly visible. The bottom topography at the Cape Hatteras site was ex- tremely complex, with gullies, walls, and flat expanses. Only videotapes of flat areas were used for the analy- sis. The videotapes of Cape Lookout dives included only broad expanses of flat slope. Environmental variables recorded are listed in Table 2 and included holes, mounds, and tubes. Holes and mounds are indicators of infaunal activity. Holes were generally 1-3 cm in diameter and mounds gen- erally >10 cm in diameter. Tubes were 5-10 cm in length and most often curved, sometimes with both ends touching the substrate. Objects classified as tubes were identified (Schaff 1 ) as those of polycha- etes and foraminifera (Bathysiphon spp.). Further characterization of sediment samples from these dives can be found in Levin ( 1991) and Gooday et al. (1992). Holes, mounds, and tubes were coded as fol- lows: = none visible during the whole interval; 1 = no more than a total of 1 or 2 visible during the whole interval; 2 = 1 or 2 visible at all times during the interval; 3 = several always visible at any time in the interval, but countable; 4 = too many to count in the interval. Category 4 coded those situations where the environmental feature was so densely distributed that individual features were obscured by others nearer the camera. Other coded variables were gas- tropod/echinoderm tracks ( grooves in the substrate), sea grass detritus/Z/ya/moecia tubes, and sargassum detritus. These were coded 1 or for presence or ab- sence in the interval; e.g. a value of 1 was assigned to the interval whenever one or more tracks were observed. Long thin dark objects that appeared to be bits of sea grass detritus might also include tubes of the polychaete Hyalinoecia (Schaff 2 ). Such objects are referred to as "grass detritus" in this study. Finally, we counted raw numbers of small anemones, large anemones, gastropods, and crinoids. Small anemo- nes probably represented Actinauge verrilli and large anemones may be Bolocera sp. (Levin 3 ). Gage and Tyler (1991) give excellent descriptions of epifaunal and infaunal organisms and benthic features simi- lar to those listed above. 1 Schaff. T. Natl. Mar. Fish. Serv., Silver Spring, MD. Personal commun., 1992. 2 Schaff, T. Natl. Mar. Fish. Serv., Silver Spring, MD. Personal commun., 1993. 3 Levin, L. Scripps Institution of Oceanography, La Jolla, CA. Personal commun., 1992. 264 Fishery Bulletin 93(2). 1995 Numbers of individuals of selected demersal nek- ton species were also recorded for each 1 -minute in- terval. This provided a consistent estimate of rela- tive abundance. Nekton included fishes, cephalopods, and macrocrustacea. As no voucher specimens were collected, identifications were made visually with the assistance of specialists familiar with the groups (noted below in the Results section). Most of these forms could be confidently identified only to genus from the videotapes. Data analysis Data from dives at Cape Hatteras and at Cape Look- out were analyzed separately. Cape Hatteras dives spanned a depth range that included two faunal zones (upper and middle slope) identified by Haedrich et al. ( 1980) and Wenner and Boesch ( 1979). In general, these authors found differences between continental slope communities above 700 meters and those below. Thus, Cape Hatteras dives 2629 and 2630 (Table 1) were con- ducted on the upper slope, whereas dive 2623 was con- ducted on the middle slope. Dive 2627 crossed the boundary identified by Haedrich et al. ( 1980). All Cape Lookout dives were conducted on the middle slope. Depth was not included as a variable in the statistical analyses detailed below, because it was not recorded for each 1-minute videotape segment. Potential effects of biotic zonation were investigated separately by com- parison of species distribution with dive depth. Statistical analysis of habitat choice by the identi- fied nekton followed Felley and Felley (1986, 1987) and Felley et al. ( 1989). All statistical analyses were conducted with the SAS program (SAS Institute, 1988). The steps in the analysis were as follows: 1) calculation of species' mean abundances for environ- mental variables; 2) calculation of a correlation ma- trix among species' mean abundances; 3 ) factor analy- sis of the correlation matrix; 4) comparison of vari- ances of sampling units and of numbers of individu- als of a species on the artificial variables (factors) generated by the factor analysis. These steps were accomplished as follows. First, we calculated means of environmental vari- ables for each species as each variable's mean over 1-minute intervals, weighted by the number of indi- viduals of that species seen in each interval. Thus, a species' mean abundance for a variable represented the value of that environmental variable in inter- vals where the species was most likely to be found. The species' mean abundance was considered the species "preference" for the variable, assuming that these nektonic species select their habitat. Second, species' mean abundances for the environ- mental variables were used to construct a correla- tion matrix among the variables. Note that this cor- relation matrix implies standardizing each variable using a "mean of means" and a "standard deviation of means." A high correlation between two variables is seen when species tend to occur in habitats with contrasting values for both of these variables. For example, an analysis might include some species found typically in shallow gravel areas and some preferring deep sandy areas. This analysis would generate a high correlation between such environ- mental variables as depth and substrate particle size. Thus, patterns of habitat use by species are reflected in patterns of interrelations among the variables. This is an analysis of species associations with par- ticular environments, and the data contain no infor- mation about why a particular species is occurring more often in one habitat type than another. Third, factor analysis (principal component analy- sis with Varimax rotation, Mulaik, 1972) was per- formed on the correlation matrix. Factor analysis resolves patterns of interrelationships among vari- ables into a smaller set of composite variables (fac- tors) to which observed variables (species mean abun- dances) are correlated. Sets of interrelated variables correlating highly with a factor are variables reflect- ing similar patterns of habitat use among the spe- cies. Each factor represents a particular trend in habitat use, an axis differentiating among sets of species that are likely to be found in habitats with contrasting conditions for the variables that define the factor. The example above might produce a fac- tor defined by depth and substrate particle size. Species' values, or scores, for a factor can be calcu- lated by using a factor scoring function. Species with contrasting scores are those found most often in con- trasting environments relative to that factor. To con- tinue the example, species more likely to be found in deep water over sandy substrate would have factor scores that contrasted with those of species more of- ten found in shallow water over coarse substrates (i.e. positive vs. negative scores on the factor). Species with intermediate scores may be characteristic of in- termediate environments on that factor, or they may be found over the entire range of environments reflected by a factor (because the species' score is the weighted mean of scores of intervals where it was found). Note that only a subset of the species analyzed in the example may in fact select habitat based on en- vironmental variables related to depth and substrate. Though a trend in habitat use may be identified for a species assemblage, not all species in the assem- blage may select habitat according to that trend. Further analysis is required to determine which spe- cies show evidence of active selection according to a particular habitat trend. Felley and Vecchione: Nekton habitat on the continental slope of North Carolina 265 Fourth, we investigated habitat selection by indi- vidual species by comparing species' variances on each factor with variance of the environment. Envi- ronmental variance on a factor was determined by calculating factor scores for each 1-minute interval. First, the value for each environmental variable in a 1-minute interval was standardized by using the appropriate "mean of means" and "standard devia- tion of means" noted above. Then the scoring func- tion was applied to each 1-minute sampling unit. Environmental variance was then determined as the variance of sampling unit scores. The score of a 1- minute interval was assigned to all individuals of all species seen in the interval. A species' variance was then calculated for each species as the variance of these scores. The procedure of investigating both species and locality scores on multivariate axes cor- responds to Rotenberry and Wiens' 4 "synthetic ap- proach" to the study of communities. We compared a species' variance with environmen- tal variance for each factor by using Levene's test (Levene, 1960; Van Valen, 1978). Bonferroni correc- tions for multiple statistical tests were made by us- ing Rice's (1989) method for investigating tables of statistical test results. Rice's method is a correction for inflated type-I error in situations where several 4 Rotenberry, J. T., and J. A. Wiens. 1981. A synthetic approach to principal component analysis of bird/habitat relationships. In D. E. Capen (ed.), The use of multivariate statistics in stud- ies of wildlife habitat, p. 197-208. USDA Forest Serv. Gen. Tech. Rep. RM-87, Rocky Mountain Forest and Range Experiment Station, Fort Collins, CO. different tests of significance are made for a particu- lar null hypothesis. Such a series of tests constitute a "table of statistical tests." In this study, a "table" was considered to be all significance tests made rela- tive to a factor, the corresponding null hypothesis being "species variances are not significantly differ- ent from environmental variance with respect to this factor." Active habitat selection by a species was in- ferred when a species' variance was significantly smaller than the observed environmental variance (1-tailed test). This implies that the species was ac- tively selecting a subset of the available environment with respect to that factor. See Felley and Felley ( 1987) and Felley et al. ( 1989) for more details. Results Environments and biota Cape Hatteras — Table 2 presents means of environ- mental variables for flat areas traversed by dives on the slope off Cape Hatteras. Holes and mounds were common environmental features: one to several holes and mounds were in view at almost all times. In gen- eral, intervals where holes were dense also had a large number of mounds. Tubes were variable in oc- currence. Many were seen in dive 2627 but relatively few were seen in dives 2629 and 2630. Grass detri- tus was very common in dives 2627, 2629, and 2630, occurring in almost every interval. Sargassum de- tritus was infrequent in upper slope intervals (dives Table 2 Environmental variables measured on each interval, with means and standard deviations (in parentheses) for each dive at Cape Hatteras and Cape Lookout, North Carolina. Holes, mounds, and tubes were coded as follows: 0=none in the interval; l=no more than 1 or 2 seen in an interval; 2=always 1 or 2 visible throughout an interval; 3=several always visible, but countable; and 4=too many visible to count. Gastropod/echinoderm tracks, and grass and sargassum detritus were coded 1/0 for presence/absence in the interval (only percentages are reported for these variables). Number of individuals were counted for small anemones, large anemones, gastropods, and crinoids. Environmental variables Holes Mounds Grass Sargassum Small Tubes Tracks detritus detritus anemones Large anemones Crinoids Gastropods Cape Hatteras 2623 2627 2629 2630 Cape Lookout 2619 2620 2621 61 35 41 7 36 7 32 1.75 (0.830) 2.63 (0.490) 2.51 (0.506) 2.29 (0.756) 3.36(0.529) 3.28 (0.488) 3.25 (0.440) 1.36 (0.484) 1.66 (0.482) 1.78 (0.571) 1.14(0.378) 2.22 10.485) 2.14 (0.378) 2.25 (0.508) 2.41(1.321) 2.23 (0.942) 0.73 (0.633) 0.57(0.535) 0.25 (0.439) 0.00 (-) 0.25 (0.440) 100.0 45.7 85.4 14.3 16.7 28.6 53.1 47.5 88.6 82.9 100.0 69.4 14.3 62.5 18.0 6.87(6.711) 0.03(0.180) 5.90(15.367) 0.31(0.564) 8.6 25.80(19.954) 0.17(0.382) 0.00 (-) 0.40(0.976) 4.9 1.37(1.577) 4.63(3.006) 4.66(13.190) 0.27(0.449) 0.0 0.00 (-) 0.00 (-) 0.00 (-) 0.00 (-) 38.9 0.33 (0.676) 28.6 0.14 (0.378) 40.6 0.41 (0.560) 0.53 (0.629) 0.43 (0.534) 0.44 (0.619) 0.00 (-) 0.00 (-1 0.00 (-) 0.03(0.167) 0.00 1 -) 0.00 (-) 266 Fishery Bulletin 93(2), 1995 2627, 2629, 2630), but was more common at the middle slope site (dive 2623). Anemones, echinoderms, gastropods, and inverte- brate tracks were common. Epifaunal forms tended to occur in patches. Coefficients of dispersion (CD, Sokal and Rohlf, 1981) were calculated for small anemones, large anemones, crinoids, and gastropods (data in Table 2). Coefficients of dispersion much greater than 1 (indicating clumped distribution pat- terns) were found for small anemones in all Cape Hatteras dives where they were observed. Small anemo- nes were very abundant in dive 2627. For 15 minutes, the submersible traversed a dense aggregation where numbers ranged from 30 to 80 individuals per inter- val. Small anemones were also common (though not as densely distributed) in dive 2629. Large anemones were seen regularly and were relatively dense in dive 2629 (up to 12 in an interval ). Large anemones had a clumped distribution in this dive, indicated by a high CD value. Coefficients of dispersion were very high for crinoids. A dense patch of crinoids appeared in dive 2629, with 4 to 62 individuals per interval for 6 consecutive inter- vals. Another area of dense crinoids appeared in dive 2623, with 7-70 individuals per interval in 10 consecu- tive intervals. In dive 2630, an extremely dense patch of ophiuroids appeared over 4 consecutive intervals (ophiuroids were not included in the statistical analy- sis as they were seen in so few intervals). Cape Lookout — Holes and mounds were very dense; holes were, in fact, too dense to count during some portions of dives 2619 and 2621. As at Cape Hatteras, intervals with high numbers of holes also had large numbers of mounds. Tubes were rarely observed and were not seen in dive 2620. Grass detritus was com- monly seen but was not as frequent as at Cape Hatteras. Conversely, sargassum detritus was quite frequent, occurring in 39-41% of Cape Lookout in- tervals. Epifaunal species were not abundant and were not patchily distributed. Small anemones were not common (fewer than one per interval) and were less abundant than large anemones. No crinoids were seen in the Cape Lookout dives. Demersal nekton species Many nektonic species were observed on the tapes, but only a few appeared in abundance. These were the spe- cies included in analysis of habitat preferences. As no voucher specimens were obtained, identifications were assigned on the basis of species known to be common in the area, after consultations with taxonomic experts (listed in the Acknowledgments section). Table 3 lists the species included in analyses of habitat choice and their mean numbers in particular dives. The eel (Synaphobranchus sp.; Smith 5 ), though rare at Cape Hatteras, was the most abundant form at Cape Lookout. This genus forms an important part of the middle-slope fauna (Markle and Musick, 1974; Haedrich et al., 1980; Sulak 6 ). Eels were always ob- 5 Smith, D. G. National Museum of Natural History, Washing- ton, DC. Personal commun., 1992. 6 Sulak, K. Atlantic Reference Centre, Huntsman Marine Sci- ence Centre, New Brunswick, Canada. Personal commun., 1990. Table 3 Common demersal nekton species identified in upper slope and middle slope dives, North Carolina, an d average num bers of individuals per 1-minute interval seen in each dive (number of intervals are given in Table 2). See text for discussion of the probable identities of these forms and scientific names Species Cape Hatteras dives C ape Lookout dives 2627 2629 2630 2623 2619 2620 2621 Eel — 0.02 0.10 2.17 2.71 1.75 Rattail 2.60 1.12 0.29 1.69 0.61 0.57 0.78 Longfin hake 0.43 0.66 0.57 0.54 0.22 0.14 0.25 Scorpaenid 4.26 0.07 0.57 1.20 — — 0.03 Lizardfish 0.03 0.34 — 0.02 — — — Eelpout 12.43 5.83 1.43 5.43 — — — Flounder 2.14 1.90 0.86 1.25 — — — Species A — 0.15 — — — — — Sergestid shrimp 0.17 0.59 0.86 0.25 0.11 0.29 0.72 Shrimp 0.09 0.02 — 0.07 0.03 — 0.03 Red deepsea crab — — — 0.02 0.06 0.14 0.16 Cancroid crab — 0.07 0.56 — 0.03 0.14 0.03 Shortfin squid 0.06 0.20 — 0.56 — — 0.22 Octopod 0.03 0.05 — 0.03 — — 0.06 Felley and Vecchione: Nekton habitat on the continental slope of North Carolina 267 served swimming slowly slightly above the bottom, maintaining position with low amplitude tail-beats. Individuals identified as rattails represented ei- ther Nezumia bairdi, N. aequalis (Sulak 6 ), or Coryphaenoid.es rupestris, the three species most commonly encountered in the depth range of these dives (Markle and Musick, 1974; Haedrich et al., 1980; Middleton and Musick, 1986). Rattails were common in all dives and were seen both lying on the bottom and maintaining position off the bottom by swimming slowly (with low amplitude tail-beats). The hake commonly observed in the tapes was the longfin hake, Urophycis ehesteri, a common species on the continental slope of the western North Atlan- tic (Markle and Musick, 1974; Haedrich et al., 1980; Wenner, 1983; Sulak 6 ). Hakes were observed in ev- ery dive, normally lying on the bottom. Quite often they were found in depressions, their bodies in a cir- cular or semicircular posture. Scorpaenids were observed in all Cape Hatteras dives but only in dive 2621 at Cape Lookout. The species represented may be Helicolenus dactylopterus (Sulak 6 ). At Cape Hatteras, they were abundant in both the upper slope (e.g. dive 2627) and the middle slope (dive 2623). When seen, they were always ly- ing on the bottom, their bodies often in a semicircu- lar posture. Lizardfish were seen only on the upper slope, most notably in dive 2629, where 14 individuals were ob- served. These may represent Saurida brasiliensis or S. normani (Sulak 6 ). Several different eelpouts were likely present on these tapes, including Lycenchelys verrillii and Lycodes atlanticus (Sulak 6 ). Lycenchelys paxillus is a more northerly species (Markle and Musick, 1974) but may occur on the North Carolina slope. Eelpouts were the most abundant fish at Cape Hatteras, in all dives, but were not seen at Cape Lookout. Indi- viduals tended to be small (<15 cm), with dark blotches, and lay in sinusoidal posture, usually near objects on the bottom (most often small anemones). Small flounders were seen in all dives at Cape Hatteras but were not found at Cape Lookout. There were most likely several species represented, includ- ing Glyptocephalus cynoglossus. This species is an important component of the slope fauna (Markle and Musick, 1974; Haedrich et al., 1980; Sulak 6 ). A fish occurring commonly only in dive 2629 was designated as Species A. This may have been the off- shore hake, Merluccius albidus ( Sulak 6 ). It was light- colored with dark dorsal blotches, of moderate size (<20 cm), had a terete shape, and a relatively large 7 Williams. A. Natl. Mar. Fish. Serv. Systematics Laboratory, Washington, D.C. Personal commun., 1992. head. It was always observed lying on the bottom, its body straight. Most individuals swam away be- fore the submersible got close enough for adequate observation. The eel and the shortfin squid, Illex illecebrosus (see below), also tended to move away from the submersible. Several decapod crustaceans were also observed. Sergestid shrimp were seen in every dive, always off the bottom. Another decapod seen regularly at both Cape Hatteras and Cape Lookout may have been the shrimp Glyphocrangon sp. (Williams 7 ). Wenner and Boesch (1979) found G. sculpta and G. longirostris at depths greater than 1,000 m. These shrimp were most abundant in dives 2623 and 2627. Individuals were seen walking on the open bottom, where their dark coloration and highly reflective eyes made sight- ing these easy. The red deepsea crab, Geryon quinquedens, was not seen in the upper slope dives but was observed in all middle slope dives, walking on the op